ID: 954001746

View in Genome Browser
Species Human (GRCh38)
Location 3:47563063-47563085
Sequence CATGAGGCTATAGAGGCGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 69}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954001746_954001754 22 Left 954001746 3:47563063-47563085 CCAGGCGCCTCTATAGCCTCATG 0: 1
1: 0
2: 0
3: 3
4: 69
Right 954001754 3:47563108-47563130 TGCTGAGCCCGGCCTTCCTCTGG 0: 1
1: 0
2: 4
3: 19
4: 190
954001746_954001752 11 Left 954001746 3:47563063-47563085 CCAGGCGCCTCTATAGCCTCATG 0: 1
1: 0
2: 0
3: 3
4: 69
Right 954001752 3:47563097-47563119 TCTGCGGGGCCTGCTGAGCCCGG 0: 1
1: 0
2: 2
3: 31
4: 291
954001746_954001749 -5 Left 954001746 3:47563063-47563085 CCAGGCGCCTCTATAGCCTCATG 0: 1
1: 0
2: 0
3: 3
4: 69
Right 954001749 3:47563081-47563103 TCATGTGTTGATGAGCTCTGCGG 0: 1
1: 0
2: 2
3: 47
4: 634
954001746_954001751 -3 Left 954001746 3:47563063-47563085 CCAGGCGCCTCTATAGCCTCATG 0: 1
1: 0
2: 0
3: 3
4: 69
Right 954001751 3:47563083-47563105 ATGTGTTGATGAGCTCTGCGGGG 0: 1
1: 0
2: 0
3: 6
4: 81
954001746_954001750 -4 Left 954001746 3:47563063-47563085 CCAGGCGCCTCTATAGCCTCATG 0: 1
1: 0
2: 0
3: 3
4: 69
Right 954001750 3:47563082-47563104 CATGTGTTGATGAGCTCTGCGGG 0: 1
1: 0
2: 0
3: 10
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954001746 Original CRISPR CATGAGGCTATAGAGGCGCC TGG (reversed) Intronic
901195380 1:7437200-7437222 CTGGAGGCTAAAGAGGGGCCAGG - Intronic
902279778 1:15365989-15366011 GATGAGGCTAAAGAGTCGGCCGG + Intronic
909542216 1:76803652-76803674 CATGAGGATATAGAGGGACAAGG + Intergenic
922983748 1:229850505-229850527 CATGAGGCTGTAGAGGTTCTGGG + Intergenic
1068155238 10:53188895-53188917 CATGAGATTTTAGAGGTGCCAGG + Intergenic
1068954831 10:62813310-62813332 CAGGAGGCTGTAGAGGGGGCTGG + Exonic
1069368110 10:67714675-67714697 CATGAGGTTTGAGAGGGGCCAGG + Intergenic
1075128088 10:119716926-119716948 CATGGGGGTATAGAGGCGGGGGG - Intergenic
1076934554 10:133558756-133558778 CATGAGGCTAGAGAGGGTACAGG + Intronic
1077113517 11:872556-872578 CATGTGGCCATTGAGGGGCCTGG - Intronic
1091186404 11:133651544-133651566 CTGGAGGCTATAGAGGGGGCAGG - Intergenic
1101593107 12:106139845-106139867 GATGGGGCTCTAAAGGCGCCGGG + Exonic
1102792544 12:115659410-115659432 CATCAGGCAACAGAGGGGCCTGG - Intergenic
1112905801 13:104419764-104419786 CCTGAGGCAATAGAGGTGCCTGG - Intergenic
1115964659 14:38874279-38874301 CATAAGGCTAGAGAGGACCCAGG + Intergenic
1119806942 14:77488281-77488303 GATGAGGCTATGGAGGCTCAGGG + Intronic
1121615956 14:95313957-95313979 CATGAGGCTATAGGGCCAGCAGG + Intronic
1126220756 15:46209814-46209836 CAAGAGGCCAGAGAGGAGCCCGG - Intergenic
1129605808 15:77024446-77024468 CATGAGGCCATATGGCCGCCAGG + Intronic
1129708508 15:77808231-77808253 GATGAGGCTGGAGAGGGGCCCGG - Intronic
1132959460 16:2613861-2613883 CAGGAGGCTTCAGAGGCACCAGG - Intergenic
1132972521 16:2695836-2695858 CAGGAGGCTTCAGAGGCACCAGG - Intronic
1137811688 16:51358831-51358853 GATGAGGAAATAGAGGCACCAGG + Intergenic
1141650932 16:85392819-85392841 CCTGAGGCTGGAGAGGCGGCTGG + Intergenic
1147873492 17:43604298-43604320 CATGAGGCTAGAAAGGCAGCTGG - Intergenic
1152710232 17:81867650-81867672 CGTGAGGCAGTAGAGGAGCCAGG + Intergenic
1156401221 18:36742184-36742206 CATGAGGCTACAGAGCAGGCTGG + Intronic
1163724898 19:18917329-18917351 CATGAGGCTAGAAAGGGGGCTGG - Intronic
1164643245 19:29841642-29841664 CCTGAGGCTAGATAGGCCCCTGG - Intergenic
1166451821 19:42908415-42908437 CATCAGGCACTAGAGGCACCAGG + Intronic
1167068920 19:47208051-47208073 CATGAGGACATAGAGTCGCTAGG - Intronic
928422500 2:31149603-31149625 GATGAAGGTAAAGAGGCGCCAGG + Intronic
929797604 2:45072235-45072257 CATGCCGCCATAGAGGGGCCAGG - Intergenic
938939909 2:136161094-136161116 CATGAGGTTAGACAGGGGCCGGG + Intergenic
947042269 2:225936832-225936854 CATGAGGTCAGAGAGGCACCTGG - Intergenic
948231836 2:236354787-236354809 CATCAGGCTGTGGAGGCCCCGGG - Intronic
948705826 2:239791995-239792017 CATGCGGCTCTAGGGGCCCCAGG + Intronic
1175752217 20:61506941-61506963 CATGAGGCTGTGGATGCCCCAGG + Intronic
1182090590 22:27591883-27591905 CATGTGGCTCTAGGGGCCCCGGG - Intergenic
1183004606 22:34890735-34890757 CATGAGATTTTAGAGGGGCCAGG + Intergenic
1183209001 22:36438662-36438684 AATTAGGCTCTAGAGGCTCCAGG - Intergenic
1183324505 22:37184077-37184099 CATGAGGTTGGAGAGGTGCCTGG - Intronic
954001746 3:47563063-47563085 CATGAGGCTATAGAGGCGCCTGG - Intronic
954426185 3:50444276-50444298 GATGAGGATACTGAGGCGCCGGG + Intronic
956860523 3:73319258-73319280 CCTGAGGCTAGAGAGGCCTCAGG - Intergenic
964650327 3:159004318-159004340 CAGGAGGCAACAGAGGCACCAGG + Intronic
967517225 3:190384501-190384523 GATGAGGCTTTAGAGCCACCTGG - Intronic
969482185 4:7452635-7452657 CATGTGGCTAGAGAGAGGCCCGG - Intronic
969627527 4:8315172-8315194 AAGAAGGCTATAGAGGTGCCGGG - Intergenic
974838572 4:67277883-67277905 GATTAGGGTATAGAGGGGCCTGG + Intergenic
979106851 4:116700601-116700623 CATGAGCCTATAGTGGCACCTGG + Intergenic
988770322 5:34426772-34426794 CATGAGGTTTTGGAGGGGCCAGG - Intergenic
992231919 5:74672123-74672145 CATGACGCTAGAGAGGGGTCAGG - Intronic
993409257 5:87554026-87554048 CATGAGACTTGAGAGGGGCCAGG - Intergenic
1003021818 6:2516575-2516597 CATGGGACTATAAAGGAGCCTGG - Intergenic
1004871736 6:19912036-19912058 GATGAGGCAATAGAGGCACAGGG + Intergenic
1008176708 6:48277025-48277047 CATGAGGCTGTAGTGGCTACAGG + Intergenic
1019219257 6:170461879-170461901 AAAGAGGCTGTAGAGGTGCCAGG + Intergenic
1019639915 7:2097786-2097808 CTTGAGGCTGCAGAGGCGTCTGG + Intronic
1020809424 7:12833377-12833399 CATGAGGTTTTGGAGGTGCCAGG - Intergenic
1024754877 7:52518114-52518136 CATGAGATTTTAGAGGGGCCAGG - Intergenic
1027267157 7:76500752-76500774 CATCAGGCTATGGAGAGGCCAGG - Intronic
1027318969 7:77000620-77000642 CATCAGGCTATGGAGAGGCCAGG - Intergenic
1030758588 7:113321333-113321355 CATGAGGCCAGAGAGTTGCCAGG - Intergenic
1032488936 7:132309447-132309469 GATGAGGCAATAGAGGCGTGTGG - Intronic
1037415927 8:18649629-18649651 CATGAGATTTTAGAGGCGCCAGG + Intronic
1038240973 8:25807780-25807802 CATGATGGTATACAGGGGCCTGG - Intergenic
1038639066 8:29309395-29309417 GATTAGACTATAGAGGGGCCTGG - Intergenic
1061891688 9:133624841-133624863 CATGAGACTTTGGAGGGGCCAGG - Intergenic
1186192079 X:7076085-7076107 CTTGAGCCTATAGAGGCAGCCGG - Intronic
1188662239 X:32774785-32774807 CATGAGGCTTGGGAGGGGCCGGG - Intronic
1189995424 X:46632807-46632829 CAAGAGGGTATAGGGGCACCAGG - Intronic
1195753364 X:108178435-108178457 CATGAGGCCATGGAGGAGGCGGG + Intronic