ID: 954001747

View in Genome Browser
Species Human (GRCh38)
Location 3:47563070-47563092
Sequence ATCAACACATGAGGCTATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 115}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954001747_954001752 4 Left 954001747 3:47563070-47563092 CCTCTATAGCCTCATGTGTTGAT 0: 1
1: 0
2: 0
3: 7
4: 115
Right 954001752 3:47563097-47563119 TCTGCGGGGCCTGCTGAGCCCGG 0: 1
1: 0
2: 2
3: 31
4: 291
954001747_954001751 -10 Left 954001747 3:47563070-47563092 CCTCTATAGCCTCATGTGTTGAT 0: 1
1: 0
2: 0
3: 7
4: 115
Right 954001751 3:47563083-47563105 ATGTGTTGATGAGCTCTGCGGGG 0: 1
1: 0
2: 0
3: 6
4: 81
954001747_954001754 15 Left 954001747 3:47563070-47563092 CCTCTATAGCCTCATGTGTTGAT 0: 1
1: 0
2: 0
3: 7
4: 115
Right 954001754 3:47563108-47563130 TGCTGAGCCCGGCCTTCCTCTGG 0: 1
1: 0
2: 4
3: 19
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954001747 Original CRISPR ATCAACACATGAGGCTATAG AGG (reversed) Intronic
901452475 1:9344548-9344570 CTCAACACCTGAGGCTATCAGGG - Intronic
906046207 1:42832846-42832868 TTCATCACAGGAGGCTATGGGGG + Intronic
909288454 1:73851655-73851677 ATCATCAAATGAGCCTATGGTGG - Intergenic
910434065 1:87187549-87187571 ATGAACACATGAGGAAATGGAGG + Intergenic
915138537 1:153751373-153751395 ATCAACAGATGAGGGTAGAAAGG + Intronic
917616784 1:176754036-176754058 TTCAACTCATGAGGTTATAGAGG + Intronic
917919607 1:179740289-179740311 AGCTACACAAGAGGCTAAAGGGG - Intergenic
921338428 1:214110878-214110900 AGAAACACATGAGGTTAAAGAGG - Intergenic
1063427882 10:5963925-5963947 ATCAACACATGAACTTACAGTGG + Intronic
1065132615 10:22637264-22637286 ATCAACAGATGAGGATATAACGG - Intronic
1073394170 10:103204516-103204538 AGCCACTCATGAGGCTAAAGTGG + Intergenic
1074045908 10:109838858-109838880 ATCAACACATGTGTTTCTAGAGG + Intergenic
1074418220 10:113285996-113286018 ATCAGGACATGAGGCTGGAGAGG - Intergenic
1074426088 10:113352779-113352801 ATCTACAGATGAGGCTAATGTGG + Intergenic
1074509263 10:114098262-114098284 AGCTACACAAGAGGCTATGGTGG - Intergenic
1075496836 10:122928544-122928566 ATCTCCACAGGAGTCTATAGGGG - Intergenic
1079062353 11:17260394-17260416 ATTAACACATGATGTCATAGGGG - Intronic
1081986222 11:47306270-47306292 GTCAAGACATCAGGCTAGAGTGG + Intronic
1085572531 11:77571831-77571853 ATCAACACAGGAAGCAAGAGTGG + Intronic
1093036379 12:14335976-14335998 AACAACCCATGAGGCCATAAGGG - Intergenic
1096365190 12:51023332-51023354 AGCAACTCAGGAGGCTCTAGTGG + Intronic
1097965724 12:65578822-65578844 ATCAACTAATGAAGATATAGAGG + Intergenic
1100320076 12:93482696-93482718 AGCTACTCATGAGGCTAAAGTGG - Intronic
1105732674 13:23234105-23234127 AGCAAAACAGGAGGATATAGAGG - Intronic
1106051633 13:26195745-26195767 ATCACCCCATGATGATATAGGGG - Intronic
1106078678 13:26482619-26482641 TTCAACACATGAAGCTTTGGGGG + Intergenic
1108283920 13:48887062-48887084 ATCAACACATGAGGCGTTCTTGG - Intergenic
1108346776 13:49554087-49554109 ATAAACACAGGATGCTATACAGG + Intronic
1115422490 14:33212617-33212639 ATCAACTCAATAGGCTATAAAGG - Intronic
1116570288 14:46508206-46508228 CTTAACACATGTGGCTATTGAGG - Intergenic
1116886297 14:50224771-50224793 AGCTACTCAGGAGGCTATAGTGG + Intronic
1116918262 14:50546301-50546323 ATAAACTCATGAGACTATAAAGG - Intronic
1117091414 14:52254541-52254563 ATTAACAAATGAGGCTATGTGGG + Intergenic
1120649100 14:87109644-87109666 ATCAACACACAAGGTTAAAGAGG - Intergenic
1121995181 14:98596890-98596912 GTCAAGACATGAGGTTACAGAGG + Intergenic
1123068953 14:105631844-105631866 TTCAACACATGAATTTATAGGGG + Intergenic
1123073110 14:105651802-105651824 TTCAACACATGAATTTATAGGGG + Intergenic
1123093030 14:105750572-105750594 TTCAACACATGAATTTATAGGGG + Intergenic
1123098503 14:105777669-105777691 TTCAACACATGAATTTATAGGGG + Intergenic
1128160492 15:65420580-65420602 ATCAAGACAGGAGGCTGAAGAGG - Intronic
1128567497 15:68710976-68710998 ATGAACAGATGAGGCCATATTGG - Intronic
1129202866 15:74015583-74015605 ACCAACAGGTGCGGCTATAGTGG + Intronic
1129240619 15:74249927-74249949 ATCAAGAGATGTGGCCATAGGGG - Intronic
1134614530 16:15640581-15640603 ATCTACTCAGGAGGCTATGGTGG + Intronic
1135651461 16:24210001-24210023 AGCTACTCATGAGGCTAAAGTGG + Intronic
1138847966 16:60590035-60590057 ATCAACAAATTAGGCAAAAGAGG - Intergenic
1144937737 17:18913658-18913680 ATCTACTCATGAGGCTGAAGTGG - Intronic
1145048904 17:19643864-19643886 ATCACCACAGCAGGTTATAGGGG - Intergenic
1146248108 17:31309193-31309215 ATAAAAACATGAGGCAATAAAGG - Intronic
1149202912 17:54208631-54208653 AACAACAACTGAGGCTAAAGAGG - Intergenic
1149883603 17:60317701-60317723 AGCTACACAGGAGGCTAAAGAGG + Intronic
1150178211 17:63085127-63085149 ATCAAAACATGAGGCAAAAATGG - Intronic
1153433501 18:5043852-5043874 ATCAACACATGAACTTTTAGGGG + Intergenic
1155131207 18:22936404-22936426 AACAATACATTAGTCTATAGTGG + Intronic
1155304607 18:24466647-24466669 AAGACCACATGAGGCTATAATGG - Intronic
1155984471 18:32215477-32215499 ACCACCACATGAAGCTATAGCGG + Intronic
1157631078 18:49096506-49096528 ACCAACACAGGAGGTCATAGTGG - Intronic
1161784253 19:6313366-6313388 TTCAACACTTTAGGCTATGGTGG - Intronic
1163497100 19:17652938-17652960 ATGAACAAGTGAGACTATAGGGG - Intronic
925671314 2:6312440-6312462 ATGAACCCATGAGGCCATGGCGG + Intergenic
926633261 2:15156688-15156710 ATCAACATATGAGTTTTTAGGGG + Intergenic
928787274 2:34903918-34903940 ATCAAGACAAATGGCTATAGAGG - Intergenic
932594474 2:73085697-73085719 AGGAACAAATGAGGCTATACAGG - Intronic
935334264 2:102000670-102000692 ATCAACACCTGGAGCTAGAGGGG - Intronic
939799701 2:146694407-146694429 AGCTACTCAGGAGGCTATAGTGG - Intergenic
943931506 2:193859663-193859685 ATCATCACATGAGGGTAAATGGG + Intergenic
944887007 2:204073140-204073162 ATCAACAGATGAGGAGATTGAGG - Intergenic
946598759 2:221336078-221336100 ATCACCACATGAGGAAATGGAGG - Intergenic
946606767 2:221413589-221413611 ATTAAGACATGGAGCTATAGTGG - Intergenic
946975714 2:225147744-225147766 ATCAGCAAATGAGACTATAAAGG - Intergenic
1175486367 20:59349692-59349714 ATCATCACCTCAGGCTATTGGGG + Intergenic
1177598761 21:23282890-23282912 ATCCACACATGAGATTATAGAGG - Intergenic
1182817556 22:33179219-33179241 ATCCACACATGCAGCTATGGGGG + Intronic
950969044 3:17168180-17168202 ATTGACCCATGAGGCTATACAGG - Intronic
953615535 3:44487530-44487552 TTCAACAAATGAGTCTAAAGGGG + Intergenic
954001747 3:47563070-47563092 ATCAACACATGAGGCTATAGAGG - Intronic
954306961 3:49732413-49732435 ATCATCACATGTGGCTAGTGTGG - Intronic
956575938 3:70752935-70752957 ATCAACAGATGAGGAAATAGAGG + Intergenic
958053583 3:88381517-88381539 AACAAAGCATGAGGCTATGGTGG + Intergenic
960398702 3:117169600-117169622 ATCTACTCAGGAGGCTAAAGTGG - Intergenic
965186372 3:165469739-165469761 AACAATGCCTGAGGCTATAGGGG + Intergenic
971229353 4:24787438-24787460 AACAACATATCAAGCTATAGAGG - Intergenic
971947418 4:33299250-33299272 AAGAACACATGAAGATATAGCGG - Intergenic
972762004 4:42115597-42115619 AAAAACAGATGAGGCTATGGTGG + Exonic
976026908 4:80698906-80698928 TTCAACACATGAGGATTAAGGGG + Intronic
980101313 4:128543933-128543955 ATCATCACATGAGGTGAAAGTGG - Intergenic
980993322 4:139757701-139757723 CTCAACAGATGAGGCTGGAGAGG - Intronic
981807283 4:148731427-148731449 ACCAACATATGAGGACATAGTGG - Intergenic
982038906 4:151375522-151375544 ATGAACACAAGAGACTAGAGAGG - Intergenic
985322132 4:188724796-188724818 ATCAACAGATCAGGCTATTAGGG + Intergenic
988295017 5:29346425-29346447 ATCTTCACATGAGATTATAGTGG + Intergenic
990574926 5:57115159-57115181 ATCAACACATGAGGAAGGAGGGG + Intergenic
999213013 5:149906592-149906614 AGCAAAACATGAGGCTCAAGAGG - Intronic
999655890 5:153810383-153810405 CTTAACACATGCCGCTATAGAGG + Intronic
1000691235 5:164323914-164323936 AGCAACTCATGCGGCTATGGTGG + Intergenic
1003012527 6:2439030-2439052 ATCACTACATGAAGCTAAAGTGG + Intergenic
1003854781 6:10262289-10262311 AGCTACACAGGAGGCTAGAGTGG + Intergenic
1005296623 6:24433603-24433625 ATCAACTCACGAGGCTGAAGCGG - Intronic
1009835540 6:68996517-68996539 ATCCACACATGAGGCTGGAAAGG - Intronic
1012075495 6:94677746-94677768 ATAAACACATGAGGAGAGAGAGG - Intergenic
1013976854 6:116089021-116089043 ATCAATACATGAGGCAAAAGAGG + Intergenic
1014107691 6:117585353-117585375 TTCAAAACATGAGGCTTTTGAGG - Intronic
1014188702 6:118466684-118466706 ACCAAGAAATAAGGCTATAGAGG + Intronic
1017735890 6:157362782-157362804 ATCAACTCAGGAGGCTGAAGTGG + Intergenic
1022671087 7:32456949-32456971 ACCAATACATGGAGCTATAGAGG + Intergenic
1023264948 7:38394554-38394576 AGCAACAAATGAGGCCTTAGGGG + Intronic
1024120228 7:46229392-46229414 AACAACAACTGATGCTATAGGGG + Intergenic
1024793893 7:52999989-53000011 AACAAAACATAAGGCTATATTGG + Intergenic
1027350485 7:77306542-77306564 AACAAGACTTGGGGCTATAGTGG - Intronic
1033297612 7:140154987-140155009 ATCAACACAGGAGACTAAAATGG + Intronic
1034612484 7:152384296-152384318 GTCAAGAGATGAGGCTTTAGAGG - Intronic
1035039723 7:155919240-155919262 ATAAACACACGAGGCTTTAGAGG + Intergenic
1048885063 8:138903179-138903201 CTCAGCACATCAGGCTATGGTGG - Intronic
1051730492 9:20137773-20137795 TTCAACATGTGAGGCTATTGGGG - Intergenic
1054701857 9:68420853-68420875 ACCACCACATGAGGCAATTGAGG - Intronic
1058257481 9:102786895-102786917 ATAAACACTTGAGGTGATAGAGG + Intergenic
1059531372 9:115038582-115038604 TTTTACACATGAGGATATAGAGG - Intronic
1187658180 X:21505347-21505369 TTCAATAGATGAGGCTATAAAGG + Intronic
1189371098 X:40430095-40430117 ACTAACACACTAGGCTATAGTGG - Intergenic
1190455241 X:50620796-50620818 ATTTACACATGAGGCAATAAAGG - Intronic
1198527409 X:137515655-137515677 ATCAGCTCATGAGATTATAGAGG - Intergenic
1199389885 X:147267227-147267249 AGCAACTCATGAGGCTGAAGTGG + Intergenic
1201725625 Y:17147615-17147637 ATAATCACATGAGGGTATATGGG - Intergenic