ID: 954001751

View in Genome Browser
Species Human (GRCh38)
Location 3:47563083-47563105
Sequence ATGTGTTGATGAGCTCTGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 81}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954001746_954001751 -3 Left 954001746 3:47563063-47563085 CCAGGCGCCTCTATAGCCTCATG 0: 1
1: 0
2: 0
3: 3
4: 69
Right 954001751 3:47563083-47563105 ATGTGTTGATGAGCTCTGCGGGG 0: 1
1: 0
2: 0
3: 6
4: 81
954001744_954001751 4 Left 954001744 3:47563056-47563078 CCTTGGCCCAGGCGCCTCTATAG 0: 1
1: 0
2: 0
3: 5
4: 80
Right 954001751 3:47563083-47563105 ATGTGTTGATGAGCTCTGCGGGG 0: 1
1: 0
2: 0
3: 6
4: 81
954001747_954001751 -10 Left 954001747 3:47563070-47563092 CCTCTATAGCCTCATGTGTTGAT 0: 1
1: 0
2: 0
3: 7
4: 115
Right 954001751 3:47563083-47563105 ATGTGTTGATGAGCTCTGCGGGG 0: 1
1: 0
2: 0
3: 6
4: 81
954001745_954001751 -2 Left 954001745 3:47563062-47563084 CCCAGGCGCCTCTATAGCCTCAT 0: 1
1: 0
2: 1
3: 6
4: 90
Right 954001751 3:47563083-47563105 ATGTGTTGATGAGCTCTGCGGGG 0: 1
1: 0
2: 0
3: 6
4: 81
954001743_954001751 5 Left 954001743 3:47563055-47563077 CCCTTGGCCCAGGCGCCTCTATA 0: 1
1: 0
2: 0
3: 2
4: 55
Right 954001751 3:47563083-47563105 ATGTGTTGATGAGCTCTGCGGGG 0: 1
1: 0
2: 0
3: 6
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954001751 Original CRISPR ATGTGTTGATGAGCTCTGCG GGG Intronic
906457743 1:46011650-46011672 GTGATGTGATGAGCTCTGCGGGG - Intronic
909453412 1:75823787-75823809 ATGAGTTCATGACCTCTGCAGGG - Intronic
918810418 1:189111223-189111245 ATGTGTTGCTGAGGTTTGCTGGG - Intergenic
922678426 1:227568619-227568641 ATGTTTTGCTGAGTTCTGTGAGG + Intronic
923348926 1:233084890-233084912 CTGTCTTGATGAGCTCTGCCTGG - Intronic
923950401 1:238945021-238945043 ATGTGCTTCTGAGCTCTGCATGG + Intergenic
924688311 1:246319585-246319607 TTTTGTTGATGAGCTCTGTTGGG - Intronic
1064867055 10:19892765-19892787 ATGTTTTGATGTTCTCTGCTGGG + Intronic
1084689264 11:70715715-70715737 ATTTGCTGATGAGCTCGGCTGGG + Intronic
1091521622 12:1250285-1250307 TTTTGTTGATGAACTCTGCCTGG + Intronic
1091783829 12:3230567-3230589 AAGTGTTGAAGAGCGCTCCGTGG - Intronic
1092449673 12:8590312-8590334 ATGCTCTGATGAGCTCTGCTAGG - Intergenic
1097301756 12:58026581-58026603 ATCTGTTGATTTGCTCTGGGAGG + Intergenic
1104630384 12:130396197-130396219 ATGTGTGGTTAAGCTCTGTGTGG - Exonic
1106545029 13:30723259-30723281 ATGTGTTGATGATTTTTGTGAGG + Intronic
1111144401 13:84161545-84161567 ATGAGTTCATGAGCTTTGCAGGG - Intergenic
1116401306 14:44510911-44510933 ATGAGTTCATGACCTCTGCAGGG - Intergenic
1123994016 15:25705839-25705861 ATGTATCCATGAGCTCTGCCAGG + Intronic
1124896293 15:33780352-33780374 ATGGGTTGATGACCTTTGAGGGG - Intronic
1129702251 15:77774639-77774661 ATGGGCTGATGGGCTCTGTGTGG - Intronic
1131358545 15:91768032-91768054 AAGTGTTCATGAGATCTGTGGGG - Intergenic
1138962045 16:62038764-62038786 ATGTGTTGTGGAGCATTGCGGGG + Intergenic
1140925879 16:79583018-79583040 ATATGTTGATGGGTTCTGCAAGG + Intergenic
1144750056 17:17642342-17642364 AAAGGTTGATGAGCTCTTCGTGG - Intergenic
1146615401 17:34353132-34353154 ATGTTTTGATGAGTTGTGGGAGG + Intergenic
1153905570 18:9658489-9658511 ATGAGGTGATCAGGTCTGCGAGG + Intergenic
1155659086 18:28226731-28226753 AGATGTTGATGAGGTCTGCTTGG + Intergenic
1161160451 19:2758749-2758771 ATGTGTGGATCAGCACAGCGTGG + Intronic
1164770773 19:30807163-30807185 CTGTGTCGCTGAGCTCTGCTCGG + Intergenic
1164853580 19:31503730-31503752 AAGTGCTGATGAGCTCTCCGCGG - Intergenic
1166425215 19:42671378-42671400 ATATTTTGGTGAGCTCTGAGTGG + Intronic
1166425330 19:42673019-42673041 ATATTTTGGTGAGCTCTGAGTGG - Intronic
1167495021 19:49812656-49812678 AGGTGCAGCTGAGCTCTGCGAGG - Exonic
926352344 2:12007577-12007599 ATGTGTTGAGGAACTCAGCCTGG - Intergenic
928054344 2:28036430-28036452 ATGTGTTGATTAGATCAGGGAGG + Intronic
928724117 2:34151152-34151174 ATGAGTTCATGTCCTCTGCGGGG + Intergenic
930673172 2:54172857-54172879 ATGAGTTCATGTTCTCTGCGGGG - Intronic
937425051 2:121791807-121791829 CTGTGCTGATGAGCTCTTCCAGG + Intergenic
938157205 2:128951868-128951890 ATGTGTGGCTGACCTCTGCATGG + Intergenic
938485778 2:131706350-131706372 ATGTGGTGATGAGCTCTTTTGGG - Intergenic
940907161 2:159179708-159179730 CTTTGTGGATGAGCTCTGTGTGG + Intronic
943943375 2:194027867-194027889 ATGAGTTGATGAGAGCTGGGTGG - Intergenic
943955332 2:194181389-194181411 TTTTGTTGATGAGCTGGGCGTGG + Intergenic
945184512 2:207125939-207125961 ATGTGTTGATAAGTTCTTAGGGG + Intronic
1170688653 20:18592007-18592029 ATGGATTGATGTGCTCTGCTGGG + Intronic
1181790618 22:25262937-25262959 GTGTGTTGCAGAGGTCTGCGTGG - Intergenic
1181826434 22:25519993-25520015 GTGTGTTGCAGAGGTCTGCGTGG - Intergenic
1183082911 22:35468239-35468261 GTGCTTTGATGAGCTCTGCTAGG + Intergenic
1183505135 22:38204536-38204558 ATGTGTTGTGGAGCTCTTAGAGG - Intronic
950812320 3:15660673-15660695 ATGTGTTTATGATCTCTTAGTGG + Intergenic
954001751 3:47563083-47563105 ATGTGTTGATGAGCTCTGCGGGG + Intronic
956901427 3:73720174-73720196 ATGTACTCATGAGCTCTGCTAGG - Intergenic
961466605 3:127085592-127085614 ATGGGTTTATGAGCTCTGAGGGG - Intergenic
967153171 3:186668104-186668126 ATGTGTTGATGAGCCTGGCATGG - Intronic
967553094 3:190822949-190822971 ATGTGTTGATTTGGTCTGCTAGG + Intergenic
967616904 3:191580835-191580857 ATTTTTTGATTAGCTCTGCTTGG + Intergenic
970680357 4:18500015-18500037 ATGAGTTCATGTGCTTTGCGGGG + Intergenic
971425183 4:26508861-26508883 ATGTGTTGCGGGGCACTGCGAGG + Intergenic
973305099 4:48638786-48638808 ATGTGTTCATGTCCTTTGCGGGG + Intronic
975851506 4:78577684-78577706 GTGTGTAGATGAGGTCTGTGAGG + Intronic
978252013 4:106642347-106642369 ATGTGTTGCTGAACTCTCGGGGG + Intergenic
978555013 4:109970568-109970590 ATCTGTTGATGTGCTTTGGGAGG + Intronic
982063504 4:151628423-151628445 AAGTGTAGATGAGCCCTGAGTGG - Intronic
992034162 5:72754912-72754934 CTGTGGTGAAGAGCTCTACGTGG - Intergenic
993530884 5:89024004-89024026 ATGTGTTAATGAGCTATAAGGGG - Intergenic
998663097 5:144262858-144262880 ATCTGTTCATGAGCTCTCTGAGG + Intronic
1001604536 5:172950608-172950630 ATGAGATGATGGGCTCTGCAAGG - Intronic
1009515918 6:64617462-64617484 ATGTGTTCATGAACTCTGCATGG - Exonic
1012122016 6:95380664-95380686 ATGAGTTCATGTCCTCTGCGGGG + Intergenic
1013745639 6:113342739-113342761 ATGTGTTGATGAGTTCAGTCTGG - Intergenic
1022122995 7:27327782-27327804 ATGTATTGATCAGCTGGGCGCGG - Intergenic
1028429420 7:90730166-90730188 ATGAGTTCATGTCCTCTGCGCGG - Intronic
1035564979 8:635392-635414 TAGTGGTGATGAGCCCTGCGGGG - Intronic
1036220124 8:6914450-6914472 AGGTGTTGATGAGGTCTGAGTGG - Intergenic
1038424812 8:27458326-27458348 TCTTGTTGATGAGCTCTGCCAGG - Exonic
1039370553 8:36979968-36979990 AGGAGTTGATTAGCTCTGAGGGG - Intergenic
1040584726 8:48728024-48728046 ATGTGTTGAGGAGATCTAAGTGG + Intronic
1047638032 8:126787443-126787465 ATGGGATGATCAGCTCTGTGGGG - Intergenic
1049398625 8:142414062-142414084 ATGTGTGCATGAGCTGTGTGTGG - Intergenic
1049796214 8:144498371-144498393 CTGTGTTCATGAGCTCTCCTGGG - Intronic
1058211840 9:102178269-102178291 AGGTGTTGATGAGGGCTGCTGGG + Intergenic
1185848852 X:3466776-3466798 ATGTGTGGATGGGCTCTGCAAGG + Intergenic
1189196727 X:39159863-39159885 ATGTGGAGATGAGCTTTGAGGGG - Intergenic
1190510915 X:51173536-51173558 ATGGGTTGGTGCCCTCTGCGTGG + Intergenic
1191208599 X:57860817-57860839 ATGAGTTCATGAGCTTTGCAGGG + Intergenic
1192254306 X:69442868-69442890 GTCTGGTGATGAGCTCTGAGGGG + Intergenic
1197087202 X:122492784-122492806 ATGTGTTCATGACCTTTGCAGGG - Intergenic
1200814797 Y:7520072-7520094 GTGTGTAGATGGGCTCTGCAAGG - Intergenic