ID: 954001921

View in Genome Browser
Species Human (GRCh38)
Location 3:47564416-47564438
Sequence CTCTGGAGAAGCACCGAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 151}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954001921_954001923 -10 Left 954001921 3:47564416-47564438 CCTCACTCGGTGCTTCTCCAGAG 0: 1
1: 0
2: 1
3: 8
4: 151
Right 954001923 3:47564429-47564451 TTCTCCAGAGGCCCAGATTAAGG 0: 1
1: 0
2: 0
3: 9
4: 141
954001921_954001924 -7 Left 954001921 3:47564416-47564438 CCTCACTCGGTGCTTCTCCAGAG 0: 1
1: 0
2: 1
3: 8
4: 151
Right 954001924 3:47564432-47564454 TCCAGAGGCCCAGATTAAGGAGG 0: 1
1: 0
2: 1
3: 13
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954001921 Original CRISPR CTCTGGAGAAGCACCGAGTG AGG (reversed) Intronic
900525303 1:3125575-3125597 CTCTGGAGGAGCAATGAGTTAGG + Intronic
901973959 1:12929870-12929892 CTGTGGAGAAACACAGAGAGAGG + Intronic
902011221 1:13271898-13271920 CTGTGGAGAAACACAGAGAGAGG - Intergenic
904680437 1:32225348-32225370 CTGTGGAGAAGCACAGTCTGAGG + Intronic
904936238 1:34131661-34131683 CTCTGAGGCAGCACAGAGTGGGG + Intronic
905915484 1:41681667-41681689 CTCTGGGGAAGCAAGGAGAGAGG - Intronic
906087546 1:43148686-43148708 TTCTGGAGCAGCAGAGAGTGGGG - Intronic
907459023 1:54594237-54594259 CGCTGGAGAAGCACAGGGAGAGG - Intronic
912248936 1:107991017-107991039 CTCTGGGGAAACAGCCAGTGAGG - Intergenic
912523691 1:110265201-110265223 CTCTGAAGATGCTCAGAGTGTGG - Intronic
913045436 1:115070042-115070064 TTCTGGAGAAACACAGACTGAGG + Intronic
917608379 1:176659933-176659955 CTCTGGAGTTGCACAGAGTGAGG + Intronic
921169099 1:212530038-212530060 CTCTCGAGAAGCACCGTGGCAGG + Intergenic
921932484 1:220766002-220766024 GTCTGGAGAAGCACTGAGCTAGG + Intronic
922958739 1:229626413-229626435 CTCTGGACCAGCCCCGGGTGGGG - Intronic
1065114339 10:22469953-22469975 CTCAGGAGACGCACAGAGTAAGG + Intergenic
1065806754 10:29400037-29400059 CTGTTGAGAAGCTCAGAGTGGGG - Intergenic
1068887857 10:62115938-62115960 CTCTGGCGAAGCACAAAGTAGGG + Intergenic
1071128032 10:82358491-82358513 CTCTGGAGAAGCCCCATTTGTGG - Intronic
1071233062 10:83611620-83611642 CTCTGTTGAAACACCTAGTGTGG - Intergenic
1071429960 10:85599356-85599378 CTCTGGATATGCACTGGGTGAGG + Intergenic
1071463510 10:85920059-85920081 CTCTGGAGAAGTCCCCAGTAGGG - Intronic
1072830082 10:98648215-98648237 ATGTGGAGAGGCACTGAGTGTGG + Intronic
1074369903 10:112891927-112891949 CTCTGGTGAAGCAATGAGAGGGG - Intergenic
1074617484 10:115083943-115083965 CTCTGCACAAGGACCCAGTGGGG - Intergenic
1075285867 10:121185386-121185408 GCCTGGAAAAGCACTGAGTGAGG - Intergenic
1076742892 10:132496754-132496776 TTCTGGAGAAGCAACGTCTGAGG - Intergenic
1077078020 11:709950-709972 CTCTGGGGAAGGGCAGAGTGGGG - Intronic
1077205048 11:1337863-1337885 CTCTGGTGAAGAAGGGAGTGAGG - Intergenic
1079107138 11:17578817-17578839 CTCAGTGGAAGCACTGAGTGGGG + Intronic
1079802269 11:24884763-24884785 CTCTGGAGAAGCACCTATTTAGG - Intronic
1081434290 11:43010139-43010161 CTCTGTAGCAACACCCAGTGTGG + Intergenic
1081600232 11:44487809-44487831 CCCTGGGGAAGCCCCGAGTGTGG - Intergenic
1081863162 11:46345695-46345717 CTCTGCAGAGGCACAGAGTAGGG + Intronic
1084518293 11:69648103-69648125 CTCTGGAGAGGAAGCGTGTGAGG - Exonic
1085128023 11:74015143-74015165 CCCTGCAGGAGCACCCAGTGTGG - Intronic
1089742776 11:120596467-120596489 GACTGGAGAAGGACAGAGTGGGG + Intronic
1090117739 11:123992800-123992822 TTCAGGAGAAGCACAGAGAGAGG - Intergenic
1090786257 11:130050392-130050414 TTCTGGGGAAGCCCCTAGTGTGG - Intergenic
1091704014 12:2681587-2681609 CTTTGGTGAAGCACGGAGGGAGG - Intronic
1094493900 12:30977614-30977636 CCCTGGAGGAGCACGGAGAGGGG - Intronic
1096233547 12:49910731-49910753 ATCTGGAGAGGCACAGTGTGAGG - Intergenic
1101849940 12:108393879-108393901 CTCTGGAGAATCCCGGGGTGGGG - Intergenic
1102215802 12:111160698-111160720 CTCTGGAACAGCACCGTGGGGGG + Intronic
1104884699 12:132099992-132100014 CTCAGGAAAAGCACCGTCTGTGG + Intronic
1104927589 12:132321738-132321760 CACTGCAGTGGCACCGAGTGGGG + Intronic
1108327424 13:49347885-49347907 CTCGGGAGAACAGCCGAGTGAGG - Intronic
1113377998 13:109782488-109782510 CTCAGGAAAAGCAGCGAGGGCGG - Exonic
1113381487 13:109809978-109810000 CTGTGGAGAAGCTCTGAGTGAGG + Intergenic
1113634088 13:111908269-111908291 CTCTGGAGCAGCATAGAATGTGG + Intergenic
1115208112 14:30935181-30935203 AGCTGGAGAAGCACGGAGTTCGG - Exonic
1116769914 14:49115310-49115332 CTCTGGAGAATGAGGGAGTGTGG + Intergenic
1117868273 14:60171767-60171789 CTCTGCAGAAGCATGGAGTTTGG + Intergenic
1117898335 14:60509724-60509746 CTGTGGACAAGTACCGAGTAAGG + Exonic
1119139679 14:72255062-72255084 CTCAGCGGAAGCACAGAGTGAGG + Intronic
1120996060 14:90419582-90419604 CTCTGGAGAAACCCTGGGTGTGG - Intergenic
1122983589 14:105202332-105202354 CTCTTGGGAGGCACCGAGGGGGG - Intergenic
1124402544 15:29362115-29362137 CTGTGGAACAGCACTGAGTGGGG - Intronic
1125523277 15:40359707-40359729 CTCTGGAGAAGTCCAGAGAGGGG - Intronic
1128392452 15:67191403-67191425 GACTGGAGACGCACCCAGTGTGG - Exonic
1128491382 15:68149049-68149071 CACTGGAAAAGGACTGAGTGTGG + Intronic
1131298620 15:91174635-91174657 CTCTGGAGAAGCGCCCATGGAGG + Intronic
1132223005 15:100118806-100118828 CACCGGAGAAGGAACGAGTGAGG + Intronic
1132937783 16:2490356-2490378 CCCTGCAGAGGCACGGAGTGAGG - Intronic
1136381466 16:29898020-29898042 CTCTGGAGAAGGAAGGGGTGTGG - Intronic
1141810149 16:86370711-86370733 CTTAGGAAAAGCTCCGAGTGTGG - Intergenic
1143627042 17:8116477-8116499 CTCTGGAGAAGTGCAGAGGGAGG + Intronic
1144912912 17:18698013-18698035 CTCTGGAGGAGCTCCGCGCGTGG + Exonic
1149553468 17:57556949-57556971 CTCAGTGGAAGCACCGGGTGTGG + Intronic
1150326417 17:64262279-64262301 CTCTGGAGAAAGAGCGAGGGTGG + Intronic
1151728974 17:75899861-75899883 GGCTGGAGGAGCTCCGAGTGGGG + Intronic
1152072089 17:78138918-78138940 CACTGGGGAAGCACCGTGTCTGG + Intronic
1152804923 17:82351050-82351072 CCCTGGAGAAGCCTCGAGGGTGG - Intergenic
1155208456 18:23580702-23580724 CTCTGGAGAAGCAATGAGGTAGG - Intronic
1155239952 18:23855458-23855480 TTCTGGAGAGACAGCGAGTGTGG - Intronic
1157002482 18:43543076-43543098 ATCTGGAGAAGGAAAGAGTGAGG + Intergenic
1157415981 18:47503452-47503474 CTGTGGCCAAGCACAGAGTGAGG + Intergenic
1157727078 18:49972875-49972897 CAGTGGAGAATCACCGAGAGTGG - Intronic
1161258130 19:3320997-3321019 CCCTGGAGAAGAAAAGAGTGAGG - Intergenic
1161585074 19:5101622-5101644 CCCGGGTAAAGCACCGAGTGAGG - Intronic
1161585118 19:5101754-5101776 CCCGGGAAAAGCACCGAGTGAGG - Intronic
1165738335 19:38191687-38191709 CTCTGGAGTAGCAAGGATTGGGG - Intronic
1167457028 19:49601707-49601729 CTCAGGAGGAGCAGCCAGTGGGG - Exonic
924959754 2:23722-23744 CTCTGGAGAAACACGTAGTTTGG + Intergenic
925263494 2:2547903-2547925 CTCTGGAGAAGGGCTGGGTGAGG + Intergenic
925348365 2:3185553-3185575 CAGTGGAGAAGCACAGAGGGGGG - Intergenic
925670056 2:6301595-6301617 CTGTGGAGGAGCACTCAGTGGGG + Intergenic
926134241 2:10325522-10325544 CTCTGCAGAAGCAGGCAGTGGGG - Intronic
929580807 2:43080831-43080853 CTCTGGGGGAGCACGGAGCGTGG + Intergenic
932331369 2:70900244-70900266 CTCTGGGAAAGAACGGAGTGGGG + Intergenic
934791988 2:97069504-97069526 CTCTGGGGAAGGGCTGAGTGTGG - Intergenic
935445183 2:103148875-103148897 GTTGGGAGGAGCACCGAGTGGGG + Intergenic
937851400 2:126639450-126639472 CACTGCAGAAGCACAGAGGGAGG - Intergenic
941328477 2:164146007-164146029 CTTTGGATGAGCACCAAGTGGGG + Intergenic
943370577 2:187010925-187010947 TTGTTCAGAAGCACCGAGTGGGG - Intergenic
943476494 2:188364082-188364104 CTCCTGAGAAGCACAGAGGGAGG - Intronic
947107210 2:226680029-226680051 CTTAGGAGAAGCACGGAGTGAGG - Intergenic
947952830 2:234162716-234162738 GTCTGGAGAGCCACTGAGTGAGG + Intergenic
1168948511 20:1780839-1780861 ATCTGGAGAAGGACCAAGTTGGG + Intergenic
1173365200 20:42379000-42379022 CACGGTAGAAGCACCAAGTGGGG - Intronic
1174610077 20:51791446-51791468 CTCTGGAAGAGCACCGAGCCCGG + Exonic
1175653790 20:60751210-60751232 ATCTGGAGAAATACCGAGAGTGG - Intergenic
1175695870 20:61102223-61102245 ACCTGGAGAGGCCCCGAGTGAGG + Intergenic
1178484590 21:33010611-33010633 CACAGGAGGAGCACCCAGTGGGG - Intergenic
950083370 3:10239371-10239393 TCCTGGAGAAGGACCTAGTGAGG - Intronic
952744545 3:36764589-36764611 CACTGGAGAAGCAGGGGGTGTGG - Intergenic
953198231 3:40753961-40753983 CTTTGGAGAAGCTCCCATTGTGG + Intergenic
954001921 3:47564416-47564438 CTCTGGAGAAGCACCGAGTGAGG - Intronic
954717364 3:52533403-52533425 CTCCGGGGAAACACCCAGTGGGG - Intronic
957952671 3:87145681-87145703 CTCTGGGGAAGCTCTGACTGTGG + Intergenic
961446572 3:126984012-126984034 CCCTGGAGAGGCCCCGAGAGGGG - Intergenic
963119581 3:141764804-141764826 CTCTGGAGGAGCAGGGTGTGGGG - Intergenic
965328146 3:167333840-167333862 CTCTGGAGAAGTACAGATTTGGG + Exonic
968375384 4:36158-36180 CTCTGGAGAAACACATAGTTTGG + Intergenic
969196386 4:5566853-5566875 CTCTGGAGTAGGAACGTGTGTGG - Intronic
972571659 4:40316874-40316896 CTCAGCAGAGGCACAGAGTGGGG - Intergenic
975693949 4:76993220-76993242 CTCTGGAGAAGGGGCGAGTTTGG + Intronic
981041992 4:140231710-140231732 GGCTGGAGGAGGACCGAGTGAGG - Intergenic
984693423 4:182754791-182754813 ATCTGGAGAAGCAGCCAGGGAGG - Exonic
985469431 5:29732-29754 CTCTGGAGAAACACACAGTTTGG + Intergenic
986169406 5:5303537-5303559 GTCAGGATAAGCACCCAGTGAGG - Intronic
988721885 5:33887390-33887412 CCCTGGAGATGCACACAGTGAGG - Intronic
990040725 5:51376690-51376712 CTCTGGCTAATCACCCAGTGTGG + Intergenic
999442798 5:151615487-151615509 CTCTGGAGAAGGTCAGGGTGTGG - Intergenic
1000031597 5:157406632-157406654 CACTGGAGAAACACCAAGAGGGG - Intronic
1000778367 5:165447197-165447219 GTCTGGAGAAGTAAAGAGTGAGG + Intergenic
1001408440 5:171493615-171493637 CACTGGAGAGCCACCGAGAGTGG + Intergenic
1001762542 5:174220246-174220268 CTCTGGAGAAACTAGGAGTGGGG + Intronic
1002456932 5:179350608-179350630 CTCTGCAGAAACACCGAGACTGG + Intergenic
1002636659 5:180612082-180612104 CCCTGGAGGAGCACCACGTGGGG + Intronic
1004163927 6:13239044-13239066 CTGTGGAGGAGCAGGGAGTGGGG + Intronic
1006947639 6:37795749-37795771 CCCTGGAGAAGGAAAGAGTGGGG + Intergenic
1012391043 6:98740493-98740515 CTATGGAGAAGCATTGACTGTGG + Intergenic
1015605585 6:134952076-134952098 CTCTTTAGAAGCACCGTGTCCGG - Intergenic
1016354199 6:143200484-143200506 CTCTGGAGAAGCTTAGAGTGAGG - Intronic
1016455965 6:144231084-144231106 CTTTGGAGAAGCAGAGAATGAGG - Intergenic
1022708667 7:32831381-32831403 CTCCGGGGAAGCAAGGAGTGGGG + Intergenic
1023999424 7:45180918-45180940 TTCTAGAGAAGCACTGAATGTGG + Intronic
1029282021 7:99441464-99441486 ATATGGACAAGCAGCGAGTGTGG - Intronic
1032468941 7:132164342-132164364 CTTTGGAGAAGCAGGGACTGGGG - Intronic
1032709042 7:134446671-134446693 CTCTGGCGAAGCGCTCAGTGTGG - Intronic
1033286866 7:140049092-140049114 CTCTGCAAAAGCACCTGGTGGGG + Intronic
1036283063 8:7417721-7417743 TGGTGGAGAAGCACCGAGTGGGG + Intergenic
1036338407 8:7893798-7893820 TGGTGGAGAAGCACCGAGTAGGG - Intergenic
1038782492 8:30580102-30580124 GCCTGGAGCAGCACCGAGGGCGG + Intronic
1049192982 8:141298997-141299019 CTCTGGAGCAGCGCCTGGTGGGG - Intronic
1049300072 8:141864883-141864905 CTCTGCATAAGCACAGGGTGAGG + Intergenic
1049412370 8:142478959-142478981 CTGTGGAGAAGCAGAGTGTGGGG + Intronic
1052823823 9:33161066-33161088 CTCTGGAGAAGCAGCGGGTGTGG + Intronic
1052831950 9:33222904-33222926 CTCTTGAGAAGCACCTTGCGGGG + Intronic
1053294039 9:36900620-36900642 CCATGGAGAAGCCCGGAGTGGGG - Intronic
1056512240 9:87316947-87316969 CTCTGGACAAACACCGATGGTGG - Intergenic
1061127518 9:128686269-128686291 ATCTTGAGAAGCACTGTGTGGGG + Intronic
1062105503 9:134752805-134752827 GGCTGGAGCAGCACCGAGAGAGG - Intronic
1062578691 9:137220372-137220394 CCCTGAAGAAGCAGCGAGCGAGG + Exonic
1062678736 9:137764378-137764400 CTCTGCAGAGGGGCCGAGTGTGG - Intronic
1203573842 Un_KI270744v1:157986-158008 CTCTGGAGAAACACATAGTTTGG - Intergenic
1187520851 X:20012741-20012763 CTCTGGAGAAGAGCAGAGTCAGG + Intronic
1192261573 X:69508819-69508841 CTCAGGAGAAGCTCTGAGGGTGG - Intronic
1194122315 X:89976203-89976225 CTCTGGAGAACCAGGGAGTTTGG - Intergenic
1200475175 Y:3633638-3633660 CTCTGGAGAACCAGGGAGTTTGG - Intergenic