ID: 954003939 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:47578074-47578096 |
| Sequence | GCTTAGAGGTACCGGGTGGC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 65 | |||
| Summary | {0: 1, 1: 1, 2: 0, 3: 3, 4: 60} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 954003939_954003950 | 7 | Left | 954003939 | 3:47578074-47578096 | CCAGCCACCCGGTACCTCTAAGC | 0: 1 1: 1 2: 0 3: 3 4: 60 |
||
| Right | 954003950 | 3:47578104-47578126 | CGGAGTCTGCCCCCAAGACGAGG | 0: 1 1: 0 2: 0 3: 5 4: 67 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 954003939 | Original CRISPR | GCTTAGAGGTACCGGGTGGC TGG (reversed) | Intronic | ||