ID: 954003939

View in Genome Browser
Species Human (GRCh38)
Location 3:47578074-47578096
Sequence GCTTAGAGGTACCGGGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 1, 2: 0, 3: 3, 4: 60}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954003939_954003950 7 Left 954003939 3:47578074-47578096 CCAGCCACCCGGTACCTCTAAGC 0: 1
1: 1
2: 0
3: 3
4: 60
Right 954003950 3:47578104-47578126 CGGAGTCTGCCCCCAAGACGAGG 0: 1
1: 0
2: 0
3: 5
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954003939 Original CRISPR GCTTAGAGGTACCGGGTGGC TGG (reversed) Intronic