ID: 954003950

View in Genome Browser
Species Human (GRCh38)
Location 3:47578104-47578126
Sequence CGGAGTCTGCCCCCAAGACG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 67}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954003933_954003950 20 Left 954003933 3:47578061-47578083 CCCCAGTGTGACCCCAGCCACCC 0: 1
1: 0
2: 1
3: 30
4: 372
Right 954003950 3:47578104-47578126 CGGAGTCTGCCCCCAAGACGAGG 0: 1
1: 0
2: 0
3: 5
4: 67
954003932_954003950 23 Left 954003932 3:47578058-47578080 CCGCCCCAGTGTGACCCCAGCCA 0: 1
1: 0
2: 5
3: 37
4: 364
Right 954003950 3:47578104-47578126 CGGAGTCTGCCCCCAAGACGAGG 0: 1
1: 0
2: 0
3: 5
4: 67
954003937_954003950 9 Left 954003937 3:47578072-47578094 CCCCAGCCACCCGGTACCTCTAA 0: 1
1: 0
2: 1
3: 7
4: 113
Right 954003950 3:47578104-47578126 CGGAGTCTGCCCCCAAGACGAGG 0: 1
1: 0
2: 0
3: 5
4: 67
954003942_954003950 -1 Left 954003942 3:47578082-47578104 CCGGTACCTCTAAGCCCCGTCCC 0: 1
1: 0
2: 1
3: 9
4: 118
Right 954003950 3:47578104-47578126 CGGAGTCTGCCCCCAAGACGAGG 0: 1
1: 0
2: 0
3: 5
4: 67
954003941_954003950 0 Left 954003941 3:47578081-47578103 CCCGGTACCTCTAAGCCCCGTCC 0: 1
1: 0
2: 1
3: 14
4: 87
Right 954003950 3:47578104-47578126 CGGAGTCTGCCCCCAAGACGAGG 0: 1
1: 0
2: 0
3: 5
4: 67
954003929_954003950 28 Left 954003929 3:47578053-47578075 CCCCACCGCCCCAGTGTGACCCC 0: 1
1: 0
2: 2
3: 23
4: 221
Right 954003950 3:47578104-47578126 CGGAGTCTGCCCCCAAGACGAGG 0: 1
1: 0
2: 0
3: 5
4: 67
954003931_954003950 26 Left 954003931 3:47578055-47578077 CCACCGCCCCAGTGTGACCCCAG 0: 1
1: 0
2: 5
3: 22
4: 283
Right 954003950 3:47578104-47578126 CGGAGTCTGCCCCCAAGACGAGG 0: 1
1: 0
2: 0
3: 5
4: 67
954003935_954003950 18 Left 954003935 3:47578063-47578085 CCAGTGTGACCCCAGCCACCCGG 0: 1
1: 0
2: 3
3: 26
4: 339
Right 954003950 3:47578104-47578126 CGGAGTCTGCCCCCAAGACGAGG 0: 1
1: 0
2: 0
3: 5
4: 67
954003939_954003950 7 Left 954003939 3:47578074-47578096 CCAGCCACCCGGTACCTCTAAGC 0: 1
1: 1
2: 0
3: 3
4: 60
Right 954003950 3:47578104-47578126 CGGAGTCTGCCCCCAAGACGAGG 0: 1
1: 0
2: 0
3: 5
4: 67
954003944_954003950 -7 Left 954003944 3:47578088-47578110 CCTCTAAGCCCCGTCCCGGAGTC 0: 1
1: 0
2: 0
3: 7
4: 82
Right 954003950 3:47578104-47578126 CGGAGTCTGCCCCCAAGACGAGG 0: 1
1: 0
2: 0
3: 5
4: 67
954003934_954003950 19 Left 954003934 3:47578062-47578084 CCCAGTGTGACCCCAGCCACCCG 0: 1
1: 0
2: 0
3: 13
4: 171
Right 954003950 3:47578104-47578126 CGGAGTCTGCCCCCAAGACGAGG 0: 1
1: 0
2: 0
3: 5
4: 67
954003930_954003950 27 Left 954003930 3:47578054-47578076 CCCACCGCCCCAGTGTGACCCCA 0: 1
1: 0
2: 0
3: 6
4: 148
Right 954003950 3:47578104-47578126 CGGAGTCTGCCCCCAAGACGAGG 0: 1
1: 0
2: 0
3: 5
4: 67
954003938_954003950 8 Left 954003938 3:47578073-47578095 CCCAGCCACCCGGTACCTCTAAG 0: 1
1: 0
2: 0
3: 3
4: 54
Right 954003950 3:47578104-47578126 CGGAGTCTGCCCCCAAGACGAGG 0: 1
1: 0
2: 0
3: 5
4: 67
954003940_954003950 3 Left 954003940 3:47578078-47578100 CCACCCGGTACCTCTAAGCCCCG 0: 1
1: 0
2: 0
3: 3
4: 71
Right 954003950 3:47578104-47578126 CGGAGTCTGCCCCCAAGACGAGG 0: 1
1: 0
2: 0
3: 5
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954003950 Original CRISPR CGGAGTCTGCCCCCAAGACG AGG Intronic