ID: 954005315

View in Genome Browser
Species Human (GRCh38)
Location 3:47585940-47585962
Sequence ATGGAGAAAATGAATGAAGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1108
Summary {0: 1, 1: 0, 2: 12, 3: 104, 4: 991}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954005315 Original CRISPR ATGGAGAAAATGAATGAAGA AGG (reversed) Exonic
901332020 1:8417534-8417556 ATAGAGAAAATGAAGATAGAAGG + Intronic
901767084 1:11508858-11508880 ATGGAGAAAATCATTGAAATGGG - Intronic
902944303 1:19823685-19823707 AAGAAGAAAATAAATAAAGAAGG + Intergenic
903409532 1:23129782-23129804 ATGCAGAAAATGAATGAACTGGG - Intronic
903489246 1:23715384-23715406 AAGGACAAACTGAATGCAGAGGG - Intergenic
903788161 1:25875108-25875130 TTGGAGAAAATGAAGGATGGAGG - Intergenic
903939559 1:26920071-26920093 AAGGAAAAAAGGAAAGAAGAAGG + Intronic
904019398 1:27450846-27450868 ATTGAGGAAAGAAATGAAGAAGG - Intronic
904390822 1:30184640-30184662 ATGGACTAAAGGAAAGAAGATGG - Intergenic
904489789 1:30851503-30851525 GTGGAGCAAATTAATGAAGGAGG - Intergenic
904888195 1:33757714-33757736 ATGGAGATAAGGAATGAAGGAGG - Intronic
905074890 1:35261733-35261755 AAGGAGAAAAAGGAGGAAGAAGG - Intergenic
905885573 1:41489983-41490005 ATGGAGAGAAAGAAGGCAGATGG - Intergenic
906180840 1:43817557-43817579 AAGGAGAAGAAGAAGGAAGAAGG - Intronic
906541000 1:46585980-46586002 AAGGAAAAAATGTAGGAAGATGG + Intronic
906562023 1:46765314-46765336 ATGGAGAGAAGGAATGAAGAGGG - Intronic
906739401 1:48167402-48167424 GTGAAAAAAAAGAATGAAGAGGG - Intergenic
906784494 1:48602829-48602851 AAGAAGAAAAGGAATGAAGAGGG - Intronic
906951425 1:50337072-50337094 ATGAAGTAAATGAATAAATATGG + Intergenic
907164821 1:52401073-52401095 ATGGAGAGAATGGATGAATTTGG - Intronic
907688184 1:56634847-56634869 ATGGAGAATATCAAGGATGAAGG + Intronic
907703122 1:56808900-56808922 ATTAAGCTAATGAATGAAGAAGG - Intronic
907802337 1:57782301-57782323 ATGAAGAATATGAAAAAAGAGGG + Intronic
907942633 1:59104301-59104323 TTGGAGAAAATGAAGGAAAAAGG + Intergenic
908312878 1:62903081-62903103 AGGGAGAAAGCAAATGAAGATGG - Intergenic
908880991 1:68733109-68733131 GTGGAGAAAATGCTTCAAGATGG - Intergenic
909102524 1:71367327-71367349 ATGGAGAAAATGACAGCAGCAGG - Intergenic
909108756 1:71447702-71447724 AGGGAGAAAATGTATAAACAGGG - Intronic
909251630 1:73364353-73364375 AAGGAGAGAAAGAAGGAAGAAGG - Intergenic
909399008 1:75205027-75205049 AAGGAGAATAAGAATGCAGAAGG + Exonic
909716924 1:78719514-78719536 TTGAAATAAATGAATGAAGAAGG - Intergenic
909805825 1:79873260-79873282 AGGGAGGAAATGAGTGAACATGG + Intergenic
909818798 1:80031912-80031934 ATGGATATAATGAGTGAATATGG - Intergenic
909953075 1:81743238-81743260 ATGTAGGGAATGAATGGAGAGGG + Intronic
909974704 1:82031481-82031503 CTGAAGTAAATGACTGAAGATGG - Intergenic
910286413 1:85559536-85559558 ATGGAGATAATGAAATTAGAAGG + Intronic
910660892 1:89671309-89671331 AAGGAGAAAAGGAAAGAGGAAGG + Intronic
910683115 1:89888166-89888188 CTGAAGAAAGTGAATGAAAAAGG + Intronic
911036571 1:93556408-93556430 ATGGAGAAAAGGGAGAAAGACGG - Intergenic
911063060 1:93764335-93764357 ATGGAGAAAGAGGATGAAGGAGG - Intronic
911462280 1:98205971-98205993 AAGGAAAAAAGGAAGGAAGAAGG + Intergenic
911525368 1:98978349-98978371 ATGGAGAAGAAGATTGAAGATGG - Intronic
911580878 1:99631831-99631853 CTGGTTAAAATGAATAAAGAAGG + Intergenic
911681322 1:100719332-100719354 ATGGAGAAAATCAATTCACATGG + Intergenic
911984573 1:104604742-104604764 ATAGAAAGAAAGAATGAAGAGGG - Intergenic
912157335 1:106937911-106937933 ATGGAGAGAAAGACTGAGGATGG - Intergenic
912570394 1:110617091-110617113 AGGGAGTGAATGAATGAAGCAGG - Intronic
912733237 1:112128170-112128192 TTGGGGAAAATGTATGTAGATGG - Intergenic
912977144 1:114341159-114341181 ATGGAGGAAGGGAGTGAAGATGG - Intergenic
913056622 1:115167938-115167960 ATGAAGAGAATGGATAAAGAGGG - Intergenic
913300580 1:117366174-117366196 AAAGAGAAAATGGATGAATAAGG - Intergenic
913646783 1:120864127-120864149 CTGGAGAAAATTAATGAATTAGG - Intergenic
913691177 1:121281339-121281361 AAGAAGAAAGAGAATGAAGAAGG - Intronic
914079864 1:144398743-144398765 CTGGAGAAAATTAATGAATTAGG + Intergenic
914146365 1:144998633-144998655 AAGAAGAAAGAGAATGAAGAAGG + Intronic
914174768 1:145267278-145267300 CTGGAGAAAATTAATGAATTAGG + Intergenic
914529495 1:148508762-148508784 CTGGAGAAAATTAATGAATTAGG + Intergenic
914700054 1:150124062-150124084 ATGGGGAAAATAATTGAAAATGG - Intronic
915650124 1:157303567-157303589 AGGGAGAAGGTGCATGAAGATGG + Intergenic
915806604 1:158860017-158860039 AAAGAGAAAAAGAATTAAGAAGG + Intergenic
915813326 1:158939265-158939287 TTGAAGAAAATGAATCAAAAGGG - Intronic
917195256 1:172457528-172457550 ATGTAGAAAATGAACATAGATGG - Intronic
917499194 1:175570620-175570642 AAGGAAAAAAGGAAAGAAGAAGG - Intronic
917544365 1:175947911-175947933 TGAGAGAAAATGAATGAAGAAGG - Intronic
918144261 1:181741991-181742013 AAAGAGAAAATGGATGGAGAAGG - Intronic
918256859 1:182756479-182756501 ATGGGGATAAAGAATGAAGATGG + Intergenic
918288280 1:183080332-183080354 ATGTAGATAATCAATGATGAAGG - Intronic
918358187 1:183725601-183725623 ATGGAGTCAATGAATCAATAAGG + Intronic
918570483 1:185985779-185985801 ATGGAGACACAGAATGATGAAGG - Intronic
918786496 1:188769989-188770011 ATGGAGAAATTGACAGAAGCAGG + Intergenic
918807893 1:189073109-189073131 GTGGTGAAAATTAATAAAGATGG + Intergenic
918841229 1:189542307-189542329 ATGGAAAATATAAATTAAGAAGG - Intergenic
919019827 1:192090590-192090612 ATGGTGACAATGAATAAAAATGG + Intergenic
919058852 1:192605950-192605972 ATAGAGAGAAAGAAAGAAGAGGG + Intergenic
919119127 1:193316953-193316975 ATGAAGAAAATAAAGGGAGAGGG + Intergenic
919166549 1:193902320-193902342 AGGAAGAAAAACAATGAAGATGG + Intergenic
919392429 1:197003892-197003914 AAGGAGATAATTCATGAAGAAGG + Intronic
919547384 1:198940689-198940711 GAGGAGAAAAGGAATGAAGGGGG - Intergenic
919554737 1:199036819-199036841 ATGGAGAAAAGGAATAAGCAAGG - Intergenic
919654813 1:200186766-200186788 ATGAATGAAATGAAGGAAGAAGG + Intergenic
920179616 1:204124456-204124478 ATTGGGCAAATGAATGAAGTTGG - Intronic
920331938 1:205215092-205215114 ATCTAGGAATTGAATGAAGAGGG - Intergenic
920478501 1:206299815-206299837 AAGAAGAAAGAGAATGAAGAAGG - Intronic
920571297 1:207019983-207020005 ATCAAGAAAATTAATGAATAAGG + Exonic
921027332 1:211298604-211298626 ATGCAGAGAAGGAATGAACATGG + Intronic
921555215 1:216590627-216590649 TTGGAGAAAATGAAGGCAGAAGG + Intronic
922129354 1:222761620-222761642 AAGGAGAAAAGGAAGGAAGGAGG - Intergenic
922141174 1:222888506-222888528 ATGGAGCAAAGGAATGCCGAGGG + Intronic
922281705 1:224131613-224131635 ATCTTGAAAATGAATGAAGTTGG + Intronic
922592361 1:226786975-226786997 GTGGAATGAATGAATGAAGATGG - Intergenic
922848284 1:228708073-228708095 ATGAATAAAATGAAGGGAGAAGG + Intergenic
922852206 1:228742542-228742564 TAGGAGAAAATGAAGGAAGGAGG + Intronic
923163151 1:231335659-231335681 GTGGAGAAAAGGTTTGAAGAAGG - Exonic
923247574 1:232147458-232147480 AAGGAGGAAGTGAAGGAAGAAGG + Intergenic
923493892 1:234508209-234508231 AAGAAGGAAAGGAATGAAGAAGG - Intergenic
923842427 1:237687747-237687769 AAAGAGCAAATGAATGAAAATGG + Intronic
924038515 1:239960019-239960041 AAGGAAAAAATGAAGGAAGGAGG - Intergenic
924136743 1:240975064-240975086 ATGGAGAGAAGGAAAAAAGATGG + Intronic
1062966043 10:1608585-1608607 AAGGAAAAAAGGAATGAGGAAGG + Intronic
1063164692 10:3450556-3450578 AGGGAGAAAAGGAAGAAAGAGGG - Intergenic
1063698029 10:8356541-8356563 AGGGAGAAAATAAATTAAGAAGG - Intergenic
1063924365 10:10962757-10962779 AGAGAGGAAATGAAGGAAGAAGG + Intergenic
1064061918 10:12145084-12145106 GTGGAAGAAATGAAAGAAGAGGG + Intronic
1064720077 10:18220075-18220097 AAGGAGAAGAGGAATTAAGATGG - Intronic
1064740153 10:18424655-18424677 ATGTAGAAAATAAATATAGATGG - Intronic
1065692928 10:28353891-28353913 ATGGAGACCATGAATGGAGTAGG - Intergenic
1065731172 10:28711021-28711043 ATGGACAAAGTGAATGAACTTGG + Intergenic
1065820800 10:29523534-29523556 ATGGCTAAAATGAATGCACAAGG - Exonic
1067417218 10:46112225-46112247 ATGCATAAAATAAATCAAGATGG - Intergenic
1067443430 10:46326202-46326224 ATGGATAAAAGGAAGGAACAGGG + Intronic
1068330525 10:55560224-55560246 AAGGAAAAAATGCAGGAAGATGG + Intronic
1068394761 10:56446808-56446830 ATGAAGGAAATGAAGCAAGAAGG - Intergenic
1068505218 10:57891677-57891699 AGGGAGAAACTGAAAGAAGGTGG - Intergenic
1068966731 10:62919335-62919357 AAGGAGTAAATTGATGAAGAGGG + Intronic
1070075539 10:73131177-73131199 TTAGAGAAAATGACTGAACAAGG - Exonic
1070421722 10:76243989-76244011 ATGGAGAAGAGATATGAAGATGG + Intronic
1070574431 10:77666846-77666868 TTGGAGAGCATCAATGAAGATGG - Intergenic
1070676689 10:78416646-78416668 ATGGAAGAAAGGAATGGAGAAGG - Intergenic
1071020568 10:81050084-81050106 ATTTAGAAGATGAATGAAAAGGG - Intergenic
1071402554 10:85289284-85289306 GTTTAGAAAATGAATGAAAATGG + Intergenic
1071817075 10:89243133-89243155 ATAGATAAAAAGAATGGAGAAGG - Intronic
1071822320 10:89291148-89291170 AAGGAAAAAAGGAATGAAGGAGG - Intronic
1071983318 10:91025572-91025594 ATGGATAGAAAGAATGAATATGG + Intergenic
1072930277 10:99656435-99656457 ATGGAGAATATGGATGGAGGAGG + Intergenic
1073234880 10:102005548-102005570 AAGGAGAGAAAGAATAAAGAAGG + Intronic
1073411283 10:103344104-103344126 ATGGTGAAAATGAATGAACTAGG + Intronic
1074335506 10:112570307-112570329 AGGGGGAAAATGAAGGAAGCAGG - Intronic
1074724081 10:116289688-116289710 AGGGAGAAAAAGAAGGAAGGAGG - Intergenic
1075414122 10:122249895-122249917 ATGTTGAAAAGGAATGAAAATGG - Intronic
1076021049 10:127073766-127073788 ATGCAGAAAATGGAGAAAGAGGG + Intronic
1076148720 10:128145982-128146004 ATTGAGTAAATGAATGGAGAAGG + Intergenic
1076802774 10:132839038-132839060 AAGGAGACACTGATTGAAGATGG - Intronic
1077785992 11:5383985-5384007 AGGGAGAAAATGAGGGAAAATGG + Intronic
1078036296 11:7808639-7808661 TTGGAAAAAATAAATCAAGAAGG + Intergenic
1078183700 11:9033412-9033434 TTTGAGCAAATAAATGAAGATGG - Intronic
1078366072 11:10707580-10707602 ATGGAGAAAATGAGTCAATAGGG + Intergenic
1078691369 11:13583458-13583480 ATGGACAAAATGACAGAAGTAGG + Intergenic
1078788408 11:14519804-14519826 CTGGACAAAATGATTGAAAAGGG + Intronic
1078825851 11:14929821-14929843 ATTGAGTAAATGAATTAATATGG + Intronic
1079961676 11:26931949-26931971 AGGGAGCAAAGGAATGAAGAAGG + Intergenic
1080017535 11:27523160-27523182 ATGAAGAAAATGTATCAAGGAGG - Intergenic
1080712549 11:34763563-34763585 ATGAAGGAAATGAAGCAAGAAGG - Intergenic
1080811054 11:35704175-35704197 ATGAAGGAAATGAAGCAAGAAGG + Intronic
1080889554 11:36397754-36397776 ATGAAGGAAAAGAATTAAGAAGG - Intronic
1081231430 11:40590204-40590226 ATGAAGAAAATGAAGCGAGAAGG - Intronic
1081232608 11:40604769-40604791 ATGGATAAAATAAAGGAAGAAGG + Intronic
1081442864 11:43099725-43099747 ATGAATAAAATGAAGCAAGAAGG - Intergenic
1082121224 11:48382193-48382215 ATGGAGAAAAGGAATTTAGTTGG + Intergenic
1082184976 11:49168024-49168046 AAGGACTAAATGAATGAAGGGGG - Intronic
1082186798 11:49192263-49192285 AAGGAGAATATTAATAAAGAAGG + Intronic
1082211074 11:49502124-49502146 TTGGAAAACCTGAATGAAGAAGG + Intergenic
1082596288 11:55085784-55085806 ATGAATAAAATGAAGCAAGAAGG + Intergenic
1082622636 11:55442567-55442589 ATGGTAAAAATGAAAGAAAAAGG - Intergenic
1082763619 11:57149355-57149377 AAGGAGGAAAGGAAGGAAGAGGG + Intergenic
1083161087 11:60854491-60854513 ATGGAGTAAGTGAATGAACAGGG - Intronic
1083161743 11:60858683-60858705 AGGGAGCAAAGGAATGAAGGAGG + Intergenic
1084583985 11:70044544-70044566 ATGGAAATAAATAATGAAGAAGG + Intergenic
1084762422 11:71282553-71282575 AAGGTGCAATTGAATGAAGAGGG - Intergenic
1084992024 11:72935011-72935033 GTAGATAAAATGAATAAAGAGGG - Intronic
1085326448 11:75610342-75610364 TGGGTGAAAATGAATGATGAGGG - Intronic
1086285680 11:85247487-85247509 AAGGAAAAAATGAGGGAAGAAGG - Intronic
1086480262 11:87228249-87228271 ATGGAATAAATAAATGAAGGAGG + Intronic
1086541919 11:87922974-87922996 AAGGAGAAAATAAAAGAATAGGG + Intergenic
1086638570 11:89122916-89122938 TTGGAAAACCTGAATGAAGAAGG - Intergenic
1086679536 11:89653107-89653129 AAGGAGAATATTAATAAAGAAGG - Intergenic
1086681362 11:89677322-89677344 AAGGACTAAATGAATGAAGGGGG + Intergenic
1086867831 11:92001685-92001707 GTGGAGAAAATGAAGGAAGGAGG + Intergenic
1086881002 11:92153118-92153140 ATGGGGAAGGTGAAAGAAGAAGG - Intergenic
1086998286 11:93384921-93384943 TTAGAAAAAATGAATGAAGGAGG + Intronic
1087055613 11:93933082-93933104 ATGAAGACATTGAATGAAGTGGG - Intergenic
1087147406 11:94825741-94825763 ATGGAGTAATAGAAAGAAGAAGG + Intronic
1087164857 11:94991845-94991867 ATGGATAAAATGTAAGAATATGG + Intronic
1087564836 11:99841652-99841674 AAGGAGAAGGAGAATGAAGAAGG + Intronic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1087937703 11:104054608-104054630 GGGGAGAAAACAAATGAAGATGG + Intronic
1088052651 11:105536657-105536679 CTGGAGAAAAATAATTAAGAGGG - Intergenic
1088389967 11:109303344-109303366 AGGGAGAACATAGATGAAGAGGG - Intergenic
1088731004 11:112683276-112683298 ATGAATGAAATGAAGGAAGAAGG - Intergenic
1088735814 11:112726903-112726925 ATCTATATAATGAATGAAGAAGG - Intergenic
1088952870 11:114588554-114588576 ATAGAGAAAATGAAGAAATAGGG + Intronic
1089087374 11:115833812-115833834 TTTGAAAAAATGAATGAAGAGGG + Intergenic
1089233292 11:116999724-116999746 AGGGAGAAAACAAATGAAAATGG - Intronic
1089916956 11:122166173-122166195 AAGAAGAAACTGAATTAAGAGGG + Intergenic
1090066211 11:123505841-123505863 AGGGAGAGAAAGAAAGAAGAAGG - Intergenic
1090125245 11:124077410-124077432 AGAGAGAAAAAGAAAGAAGATGG - Intergenic
1090315931 11:125788418-125788440 AGGGAGAAAATGAGTTAAAAGGG - Intronic
1091289933 11:134433636-134433658 ATGGAGTCAATGAGTGAATAAGG + Intergenic
1091952892 12:4609599-4609621 ATGGAGGGAATGACTGATGAGGG + Intronic
1092018331 12:5178618-5178640 ACTGAGAGAATGAAAGAAGATGG - Intergenic
1092233323 12:6790044-6790066 GAGGAGAAAAAGAGTGAAGAAGG + Intronic
1092307259 12:7314140-7314162 ATGTAGAAGATGAAGGAAGAAGG + Intronic
1092620854 12:10265866-10265888 AAGGAGAAAATAATTGAAAAAGG - Intergenic
1092654324 12:10668730-10668752 CTGGAGAAAGTGAAAGTAGAAGG - Intronic
1092778349 12:11963433-11963455 ATGGAAAAAGTAAATGAAGTTGG + Intergenic
1092798516 12:12139108-12139130 AGGGAGAAACTGAATAAAGCAGG - Intronic
1092968458 12:13668893-13668915 AAGGAAAGAAGGAATGAAGAAGG + Intronic
1093013216 12:14129872-14129894 CTGGAGACAACGAATGAAAACGG + Intergenic
1093080031 12:14799634-14799656 ATGGAGAAATTGGATGAAATGGG - Exonic
1093235726 12:16606544-16606566 AGGGAGAGAAGGAAAGAAGAGGG - Intronic
1093436082 12:19136945-19136967 ATTCAAAATATGAATGAAGATGG + Intronic
1093625894 12:21347701-21347723 AAGGAAAAAAGGAAGGAAGAGGG + Intronic
1093795127 12:23301978-23302000 CAGGAGGAAAAGAATGAAGAGGG - Intergenic
1093844509 12:23952137-23952159 ATAGAGAAAAAAAGTGAAGAAGG + Intergenic
1094531233 12:31277121-31277143 ATGGAGATAATCTAGGAAGAAGG + Intergenic
1095353236 12:41240023-41240045 ATGGAGTAAATCACTGAAGCAGG + Intronic
1095926700 12:47585894-47585916 AGGGAGGAAAGGAAAGAAGAAGG - Intergenic
1096072854 12:48785156-48785178 ATGGAGAAAAAGCATAAAGCTGG - Intronic
1096311484 12:50525045-50525067 ATGGAGAAAAAGCATCAAGAGGG + Intronic
1096494621 12:52032921-52032943 ATGGGGGAAATGAGTTAAGAGGG - Intronic
1097302034 12:58029217-58029239 ATCAGGAAAATGAAGGAAGAGGG - Intergenic
1097333437 12:58356647-58356669 ATGAAAAAAATGAATGAGGCTGG + Intergenic
1097533240 12:60832650-60832672 ATGCAGAAAATGAAAGAAAAGGG - Intergenic
1098072994 12:66696031-66696053 ACGGAAAAACTAAATGAAGAGGG + Intronic
1098096600 12:66963480-66963502 ATGAAGAAAAAGAAGGAATAAGG + Intergenic
1098229338 12:68357111-68357133 ATGGAACAGATGAATGAAGTAGG - Intergenic
1098469371 12:70826103-70826125 ATGGAGAGAGGGAAAGAAGAAGG + Intronic
1098485829 12:71020624-71020646 ATGGAGTATATGCATGAATATGG + Intergenic
1098563741 12:71907515-71907537 ATGATGAAAATAAATGAGGATGG + Intronic
1098730053 12:74024670-74024692 ATGGAGGAGATGGAGGAAGAGGG + Intergenic
1099079426 12:78157810-78157832 GAGGAGAAAAAGAAGGAAGAGGG + Intronic
1099359290 12:81679560-81679582 ATGTAGAAGATGAATGAAAAGGG + Intronic
1099406433 12:82269209-82269231 ATGTAGAAAATCAATGGTGAAGG + Intronic
1099447743 12:82772241-82772263 ATAGATAAAATGCATGAAGTTGG - Intronic
1099476579 12:83114821-83114843 ATATATAAAATGAATGAAGATGG - Intronic
1099654896 12:85477974-85477996 AAGGAGATAATGAATGAAATTGG + Intergenic
1100023867 12:90103932-90103954 ATGAAGAAAAAAAATCAAGAAGG - Intergenic
1100778904 12:98002875-98002897 AAGGAGAGAAGGAAGGAAGAAGG + Intergenic
1101250132 12:102925215-102925237 AAGGAGAAAATAAAAGGAGAAGG - Intronic
1101302883 12:103499516-103499538 ATGGAGAAGAGAAAGGAAGATGG + Intergenic
1101533975 12:105600545-105600567 TTGGAGATTATGAATGGAGATGG + Intergenic
1101804695 12:108053155-108053177 ATTTAGAAAATGAATCAAGATGG + Intergenic
1102562031 12:113769225-113769247 GAGGAGAAAATGAAAGCAGACGG + Intergenic
1102593833 12:113977395-113977417 ATTGTGAAAATGAAAAAAGAAGG + Intergenic
1102837077 12:116074489-116074511 ATAGACAAAATGAATAAAGGAGG + Intronic
1102899320 12:116624090-116624112 AAGGAGAAAGAGAATGAAGAAGG + Intergenic
1102906992 12:116684297-116684319 AAGAAAAAAAAGAATGAAGAAGG + Intergenic
1102974978 12:117200190-117200212 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
1103040336 12:117689984-117690006 AAGAAGAAAAGGAAGGAAGATGG + Intronic
1103042248 12:117705318-117705340 TTGGAGCAAATGAATGGAGCTGG - Intronic
1103044825 12:117727370-117727392 GTGAAGAAAAAGAAGGAAGAAGG + Intronic
1103160729 12:118727065-118727087 GAGGAGAAAATTAATGTAGACGG + Intergenic
1104510269 12:129371372-129371394 ATGGTGATGATGAATGATGATGG + Intronic
1104539476 12:129649273-129649295 AAGGAGAAAGTGAAGGAATATGG - Intronic
1104738944 12:131158589-131158611 ATAGAGAAGAGGAAGGAAGAAGG - Intergenic
1105492920 13:20904950-20904972 GTAGAGAAAATGAATTAACAAGG + Intergenic
1105800815 13:23901883-23901905 TTGGAGAAAATTAATCAGGAAGG - Intronic
1106027048 13:25965247-25965269 ATGGGGAAAATGTAGAAAGATGG - Intronic
1106041360 13:26096840-26096862 AAGGAGAAAGAGAAGGAAGAGGG - Intergenic
1106544519 13:30718487-30718509 ATGGAGAAAAGGATGGAGGAAGG - Intronic
1107026445 13:35806641-35806663 AGTTAGAAACTGAATGAAGAAGG - Intronic
1107216847 13:37931669-37931691 AAAGAGAAAGAGAATGAAGAGGG - Intergenic
1107267331 13:38571833-38571855 ATGCAGAAATTAACTGAAGATGG + Intergenic
1107897114 13:44976269-44976291 ATGCAAAAAATGAAAGAAGAAGG + Intronic
1107951620 13:45466982-45467004 ATGGAAAAAAAGAACAAAGAAGG + Intronic
1108044036 13:46366133-46366155 AGGGAGAAAATGAATGTGGGTGG - Intronic
1108349768 13:49581276-49581298 ATGGAGAAAATTGAACAAGAAGG + Intronic
1109098708 13:58150883-58150905 AAGGAGTCAATGAATGAAAATGG - Intergenic
1109167937 13:59058960-59058982 ATGTAGAATGGGAATGAAGACGG + Intergenic
1109489766 13:63082014-63082036 TTGGACATGATGAATGAAGATGG + Intergenic
1109812978 13:67539902-67539924 AGGGAGATAAAGAATGCAGAAGG - Intergenic
1110079182 13:71289535-71289557 AAGGAAAGAATGAATGAAAAAGG + Intergenic
1110268643 13:73568371-73568393 ATGGAGAGAAGAGATGAAGAAGG - Intergenic
1110496896 13:76178469-76178491 GTGGAGAGAAAGAGTGAAGACGG + Intergenic
1111187851 13:84763841-84763863 ATGTAAAGAATGAATGAAGGAGG + Intergenic
1111453517 13:88449849-88449871 CTGGAGGAGATGAATGAAGGAGG - Intergenic
1111529130 13:89513808-89513830 ATGGATACAATGAAGGAAAATGG + Intergenic
1112063302 13:95763932-95763954 ATAGAGGAAATGTATGATGAAGG + Exonic
1112067102 13:95804500-95804522 ATTGTGAAAAAGAATGAAGTTGG + Intronic
1112119644 13:96395853-96395875 AAGGAGGAAAGGAAGGAAGAAGG + Intronic
1112124237 13:96447217-96447239 ATGGAGAGAATGCATGAAAGCGG - Intronic
1112239357 13:97665669-97665691 CTGGAGAACAAGAGTGAAGAGGG + Intergenic
1112431582 13:99355075-99355097 ACGGAGGAAATGTAAGAAGAGGG + Intronic
1112632450 13:101177465-101177487 ATAGAGAAAATGCTTGAAGGAGG + Intronic
1112757973 13:102660935-102660957 ATATAGAAAAAGAATGAAGTTGG + Intronic
1113040278 13:106097708-106097730 ATGAAAAAAATAAATGAATAAGG - Intergenic
1113159130 13:107359587-107359609 AGGGAGGAAATGAAGGAAGGAGG - Intronic
1113771126 13:112909608-112909630 ATGGAAACAAGAAATGAAGAGGG + Intronic
1114120480 14:19666188-19666210 AGGAAGAAGATGAAAGAAGAAGG + Intergenic
1115224878 14:31092202-31092224 GAGGAGAAAATGAATGAAGAAGG - Intronic
1115714765 14:36091114-36091136 ATGGAGTAAACAAATGAAGAGGG - Intergenic
1116250612 14:42478020-42478042 ATGTTGAAAATGATTGGAGATGG + Intergenic
1116453308 14:45088144-45088166 ATGGAGAAAAAGAATGCTGTTGG + Intronic
1116751524 14:48891570-48891592 ATCGAGAAAATGAAGACAGATGG - Intergenic
1117472504 14:56060343-56060365 GTGGGGAAGATGCATGAAGAAGG - Intergenic
1117662608 14:58022771-58022793 ATGTACAAAATGAATGAAATTGG - Intronic
1117872474 14:60215740-60215762 ATGGAGAATGTGAATGAGGTTGG - Intergenic
1118104868 14:62647126-62647148 ATGGAGGGATTGAAGGAAGACGG - Intergenic
1118639412 14:67778363-67778385 ATGATGAAAATGATTGAAGCAGG + Intronic
1118664334 14:68050355-68050377 CAGGAGAAAATGAAAGATGATGG - Intronic
1118878204 14:69802788-69802810 AGGGAGAAAGAGAATGCAGAGGG + Intergenic
1119042264 14:71285654-71285676 AAGGAGAAGGTGATTGAAGATGG - Intergenic
1119110533 14:71969614-71969636 AAGGAGGAAAAGAATGAAGAAGG - Intronic
1119531884 14:75367544-75367566 TTGGGGAAATTGAATGAAGAAGG + Intergenic
1120227083 14:81802836-81802858 ATCCAGAAAATGAATGAGTAGGG + Intergenic
1120407597 14:84108352-84108374 CTGCTGAATATGAATGAAGAAGG + Intergenic
1120817325 14:88875913-88875935 ATGAAAAAAATGAGTGAGGAAGG - Intronic
1121220538 14:92281601-92281623 TAGCAGAAAATGGATGAAGAGGG - Intergenic
1121432458 14:93897731-93897753 ATGGCTAAAATAAATGAAGGGGG + Intergenic
1121888050 14:97562596-97562618 AGGGAGAAAAGGAAGGAAAAAGG + Intergenic
1122069667 14:99197452-99197474 ATAAAGAAAATGAGTGAAGTTGG + Intronic
1122667207 14:103339166-103339188 TTGCAGAAAAAGAAAGAAGAGGG + Exonic
1123408457 15:20038932-20038954 TTGGAGAACTTGAAAGAAGAGGG + Intergenic
1123517781 15:21045573-21045595 TTGGAGAACTTGAAAGAAGAGGG + Intergenic
1124874966 15:33583466-33583488 ATGGAGACAATAAATGCATAAGG - Intronic
1125406996 15:39363105-39363127 AAGGAGGAAATAAATAAAGAAGG + Intergenic
1126552108 15:49943180-49943202 AAAGAGAAAAAGAATGAAAAAGG + Intronic
1126558270 15:50015237-50015259 ATAGAGAAAGAAAATGAAGAGGG + Intronic
1126948206 15:53849277-53849299 AAGGAAAAAATAAAGGAAGATGG - Intergenic
1127122105 15:55780596-55780618 AGGGAGAAGAAGAAGGAAGAAGG + Intergenic
1127127623 15:55827669-55827691 ATGAAGAAAATGAATTATGATGG + Exonic
1127291243 15:57573422-57573444 AAGGAGAAAAGGAGTGAAGGAGG - Intergenic
1127537558 15:59904246-59904268 AGGGAGAAATGGAAAGAAGAAGG + Intergenic
1128095748 15:64953691-64953713 AAGGAGAAGAAGAAAGAAGAAGG - Intronic
1128754568 15:70172611-70172633 ATGGAAAAAATGGAGGAAGAAGG + Intergenic
1129708016 15:77805708-77805730 ATGGAGGAAATGCATGGAGCTGG - Intronic
1129818669 15:78579807-78579829 ATGAAGAAAATGCAGCAAGAAGG - Intronic
1129932257 15:79421680-79421702 ATGGAGTAAGTGAATGAGGGAGG + Intronic
1130654300 15:85781346-85781368 CTGGAGAGAATGAGTGAAAAGGG + Intronic
1130682519 15:86009114-86009136 AAGGAGGAAAGGAAAGAAGAAGG + Intergenic
1130755400 15:86757658-86757680 ATGGAGAAAATGACAAAAAAGGG - Intronic
1130828875 15:87579229-87579251 AATGAGAAAATGAAATAAGATGG - Intergenic
1131224967 15:90616994-90617016 AAGGAGAGAATGGAAGAAGAGGG - Intronic
1131425187 15:92340286-92340308 AGGGAAATAATGGATGAAGAAGG - Intergenic
1131622755 15:94084463-94084485 AAGGAGAAACTGGATAAAGATGG - Intergenic
1131856308 15:96599841-96599863 ATGGAGAAAATGATTGCATTAGG + Intergenic
1131937771 15:97525742-97525764 ATGGAAAAAAGGAAAGAAGAAGG + Intergenic
1131981267 15:97997062-97997084 ATGCAGAAAATAAAGAAAGATGG + Intergenic
1132004092 15:98210628-98210650 AAGGAGAAAAAGAAGGAACAAGG + Intergenic
1132028862 15:98424425-98424447 GTGGAGAAAATGAATGCAGGAGG + Intergenic
1133688267 16:8187920-8187942 AGGAAGAAAATGAATGAAGGAGG + Intergenic
1133711727 16:8408158-8408180 AAGGAGAGAAGGAATGAAGGAGG - Intergenic
1133950744 16:10390197-10390219 ATGGAGAAACCCAATGAAGCAGG + Intronic
1134203506 16:12218453-12218475 ATGGAAATAATGAATGAATATGG - Intronic
1134419068 16:14069922-14069944 ATGGAGGAAGTGGGTGAAGAAGG - Intergenic
1134788955 16:16971160-16971182 ATCTAGAAACTGAAGGAAGATGG - Intergenic
1134881891 16:17752204-17752226 ATGTCAAAAATGAATGATGATGG + Intergenic
1135012140 16:18891400-18891422 CAGGAGAAAATTAATGAAAATGG - Intronic
1135059579 16:19259629-19259651 ATGTACAAAATCCATGAAGAGGG - Intronic
1135263325 16:21000003-21000025 AAGGAGAAAAGGAGGGAAGAAGG + Intronic
1135279817 16:21144717-21144739 ATGGAGGAAATGATTGCAAACGG - Intronic
1135318996 16:21478624-21478646 CAGGAGAAAATTAATGAAAATGG - Intergenic
1135346808 16:21695737-21695759 TTGGGGAAAATGAAGGAAGTGGG - Intronic
1135371894 16:21910417-21910439 CAGGAGAAAATTAATGAAAATGG - Intergenic
1135439894 16:22460287-22460309 CAGGAGAAAATTAATGAAAATGG + Intergenic
1135657015 16:24259056-24259078 AGTGAGAAATTGAATCAAGAAGG + Intronic
1135862167 16:26066515-26066537 AGGGAGAGAAGGAAAGAAGAAGG - Intronic
1135923617 16:26673079-26673101 GAGGAGAAAATGGATGAAGCAGG + Intergenic
1136329301 16:29560694-29560716 CAGGAGAAAATTAATGAAAATGG - Intergenic
1136443930 16:30300405-30300427 CAGGAGAAAATTAATGAAAATGG - Intergenic
1136968305 16:34941754-34941776 AAGGAGGAAATGATGGAAGAAGG + Intergenic
1137219836 16:46437618-46437640 AAGGAGGAAATGAGGGAAGAAGG - Intergenic
1137980935 16:53068972-53068994 AAGAAGAAAATGCATTAAGATGG - Intronic
1138028482 16:53540538-53540560 AAGGAGAAAGAGAATGAAGGTGG + Intergenic
1138298722 16:55908920-55908942 ATGGAGAGAAAGGAGGAAGAAGG - Intronic
1138462001 16:57154663-57154685 ATGGGGAAACTGAAGGAGGAAGG + Intronic
1138621244 16:58212973-58212995 AGGGAGGAAATGAGGGAAGAGGG + Intergenic
1138881912 16:61026966-61026988 ATGGAGATAGTGAAGGAAAAGGG + Intergenic
1138980251 16:62259189-62259211 ATAAAGGAAATGAAAGAAGAAGG + Intergenic
1139038570 16:62977149-62977171 AAGAAAAAAATGAATGAGGAGGG + Intergenic
1139045354 16:63051344-63051366 ATGGAAATAATGAATGTAGGGGG - Intergenic
1139167552 16:64585954-64585976 ATGGAGACAAAAGATGAAGAAGG - Intergenic
1139352801 16:66347850-66347872 GTGGAGGCAGTGAATGAAGAGGG + Intergenic
1139761670 16:69188789-69188811 AGGGAGGAAAGGAATGAAGTTGG + Intronic
1140128871 16:72140255-72140277 ATGGAGAATATGAACAAAGTTGG + Intronic
1140178492 16:72689746-72689768 ATGGAGAAAGGGAAGGAAGGAGG - Intergenic
1140541984 16:75764638-75764660 AAGAAGACAAAGAATGAAGATGG + Intergenic
1140632406 16:76869978-76870000 GTGGAGAAAAAGAATGGATATGG - Intergenic
1140808172 16:78552754-78552776 AAAAGGAAAATGAATGAAGAAGG - Intronic
1140886354 16:79247306-79247328 ATGGAGAACAGAAATGAATATGG + Intergenic
1140895039 16:79317352-79317374 AGGGAGAAAAGGAGGGAAGAAGG - Intergenic
1140991514 16:80217304-80217326 AGGGAGAAGATGAGTGAACAAGG - Intergenic
1141500859 16:84443250-84443272 AGGGAGCAAAGGAAGGAAGAAGG + Intronic
1141902310 16:86999510-86999532 ACGGAGGGAATGAACGAAGAAGG - Intergenic
1142930719 17:3282022-3282044 ATGGAGAAAAACAATGAAGAGGG - Intergenic
1143008261 17:3851290-3851312 ATGGAGAAGGTGAGGGAAGATGG - Intergenic
1143418246 17:6766221-6766243 ATGGAAAAAATAATAGAAGAAGG - Intronic
1144067980 17:11641495-11641517 ATGGAGGAAATGAAGAGAGAAGG + Intronic
1144227338 17:13162355-13162377 AAAGAGAAAATGAATGAAGTGGG + Intergenic
1144670534 17:17130339-17130361 AAGGAGAAAATGAAGAAAGGAGG - Intronic
1145119592 17:20245820-20245842 GTGGAGAAAATAAATGAAGCTGG - Intronic
1145758080 17:27407532-27407554 ATAGAGGAAAGGAAGGAAGAAGG - Intergenic
1146148334 17:30442665-30442687 TTGAAGAAAATGATTGAACAAGG + Intronic
1146269063 17:31472621-31472643 ATAGAGAAAGTGCATCAAGAAGG + Intronic
1146442344 17:32908061-32908083 TTGGAGAAACTAAATGAAGCTGG + Intergenic
1146471388 17:33127786-33127808 ATGTGGAAAATGAATGGAGGAGG - Intronic
1146525364 17:33562897-33562919 GTGCAGAAAATGAATCAAGAGGG - Intronic
1147205107 17:38831815-38831837 AAGGAAAAAAGGAAGGAAGAAGG - Intergenic
1147438549 17:40432597-40432619 AATGAACAAATGAATGAAGAGGG + Intergenic
1147979578 17:44266280-44266302 AGGAAGAAAGTGAATAAAGATGG - Intronic
1148203334 17:45764296-45764318 AGGGAGGAAAGGAAGGAAGAGGG + Intergenic
1148616251 17:49002463-49002485 GGGCTGAAAATGAATGAAGAGGG + Intronic
1148661016 17:49332852-49332874 CTGGAGAAACTGAAAGAAAAGGG - Intronic
1148866134 17:50629693-50629715 GTGGAGAAAATGAAGGAGGCTGG + Intergenic
1149003770 17:51783583-51783605 AAGGAGAATAAGAAAGAAGAAGG + Intronic
1150101456 17:62427304-62427326 ATGGAGATAATGTATGTAAAAGG + Intronic
1151107194 17:71629820-71629842 AGAGAGCAAATGAATGAAGGGGG + Intergenic
1151489682 17:74425347-74425369 AGGGAATAAATGAATGAAGGAGG - Intronic
1152198471 17:78931274-78931296 ATAGAGAACAAGAATGCAGATGG + Intergenic
1152412793 17:80137690-80137712 ATGGAGAAAATGAAGTAAGAGGG - Intronic
1152499767 17:80700063-80700085 ATGGAGAAAAGGTAGGAAGAAGG + Intronic
1152984707 18:311213-311235 ATGGAGAATATGGAGGAAGGGGG + Intergenic
1153689348 18:7575946-7575968 GTGGAGAATCTGATTGAAGATGG + Intronic
1154059572 18:11047070-11047092 ATGGAAAGGATGAGTGAAGACGG - Intronic
1154138253 18:11799955-11799977 ATAGGGAAAAGGAATGGAGAGGG - Intronic
1154162470 18:11990434-11990456 ATAGAGAAGATGAAAGCAGAAGG + Intronic
1154519100 18:15207948-15207970 ATGGAAAGAAGGAAGGAAGACGG - Intergenic
1155078257 18:22382064-22382086 ATGAGGAAAAGCAATGAAGAAGG - Intergenic
1155165933 18:23232507-23232529 ATGGAGATGATGAATGCACAGGG - Intronic
1155366570 18:25055111-25055133 ATGGACTAAATGATTGAAAAAGG + Intergenic
1155378632 18:25191257-25191279 ATGGAGAAAATGAATGGAATAGG - Intronic
1155531600 18:26772467-26772489 AAGGTGAAAATGAAAGATGAAGG - Intergenic
1155558896 18:27053425-27053447 AAGGAGCAAAAGAAAGAAGACGG - Intronic
1155776651 18:29771478-29771500 ATGGAAATAATGAATGAATTTGG + Intergenic
1155793202 18:29999100-29999122 GTTGAGAAAACCAATGAAGACGG + Intergenic
1155836268 18:30588888-30588910 ATAAAGAAAATAAATAAAGATGG + Intergenic
1155882829 18:31170949-31170971 ATGGAGAAGATGAAGGAGGATGG + Intergenic
1155947200 18:31868303-31868325 ATGAAGAAAATGGACTAAGATGG - Intronic
1156072000 18:33222694-33222716 AGGGAGAAAAGGAAGGAAAAGGG - Intronic
1156211181 18:34944758-34944780 AAGGAGCAAAAGAAGGAAGAAGG + Intergenic
1156230010 18:35144286-35144308 TGGGAGGAAATGAATGTAGATGG - Intergenic
1156664399 18:39388544-39388566 ATGGACAAAATATATGAAAAAGG + Intergenic
1156768543 18:40689609-40689631 AAGGAGAAAAAGAAGGAGGAGGG - Intergenic
1156829796 18:41478187-41478209 AAGCAGAAAATCATTGAAGATGG + Intergenic
1156920016 18:42510645-42510667 AAGGAGAAAATGAGGGAAGGAGG - Intergenic
1157007360 18:43599583-43599605 ATACAGAAAAAGAAGGAAGAAGG + Intergenic
1157150016 18:45207334-45207356 AGGGAGAAAAGGAAGGAAAAGGG + Intergenic
1157511201 18:48276188-48276210 AATGAGAAGAGGAATGAAGAGGG - Intronic
1157654165 18:49369109-49369131 ATAGAGAAAATGAACCAAAACGG - Intronic
1157678420 18:49584575-49584597 ATGGAGAAAATGCCAGAGGAGGG - Intronic
1157732249 18:50014256-50014278 ATGGAGAAAATGGATGAGAAAGG + Intronic
1157992433 18:52512947-52512969 GTGGAGAGAAGAAATGAAGATGG + Intronic
1158126669 18:54107169-54107191 ATAAAGAAAATGCATGAGGATGG + Intergenic
1158183972 18:54750420-54750442 AAGGAGGAAAAGAAGGAAGAAGG - Intronic
1158490768 18:57907491-57907513 ATGGAGAAAAGAAATTAGGATGG + Intergenic
1159688364 18:71453000-71453022 AAAGAGAAAATAAATGAAGAAGG + Intergenic
1159708393 18:71721587-71721609 ATTGATAAGATGAATGAAAAAGG - Intergenic
1159746314 18:72240237-72240259 TTGAAGAAGATGAATGAAGTTGG - Intergenic
1160086978 18:75785610-75785632 AGAGAGAAAATAAATGCAGATGG + Intergenic
1160090150 18:75819205-75819227 ATGGAGAGGAAGAATGAACATGG + Intergenic
1160326495 18:77954277-77954299 ATGTAAAAAATGAATGAATCAGG + Intergenic
1161905842 19:7155916-7155938 AAGAAGAAAAAGAAAGAAGAAGG + Intronic
1162639094 19:11993714-11993736 ATGGAGATCAAGAGTGAAGAGGG + Intergenic
1162844725 19:13383366-13383388 ATGGGGAAGATGGAGGAAGAAGG + Intronic
1163194773 19:15708651-15708673 ATGAATAAAATGACAGAAGAAGG + Intergenic
1163219629 19:15907431-15907453 ATGAATAAAATGACAGAAGAAGG - Intergenic
1163468378 19:17482971-17482993 ATGGAGGGAATGAATGAATGAGG + Intronic
1164234509 19:23320526-23320548 AGGGAGAAAGTGAATAAAGAAGG + Intronic
1164249279 19:23462930-23462952 AGGGAGAAAGTGAATGAAGAAGG + Intergenic
1164302719 19:23976023-23976045 AGGGAGAAAGTGAATAAAGGAGG - Intergenic
1164325020 19:24183663-24183685 AGAGAGAAAGTGAATGAAGGAGG - Intergenic
1164841023 19:31392254-31392276 ATGCGGAGAATAAATGAAGATGG - Intergenic
1165328739 19:35129191-35129213 TTGGATAACTTGAATGAAGAGGG + Intronic
1165687335 19:37833149-37833171 ATGGAGAATATGAATTCTGAGGG + Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1167682294 19:50931215-50931237 ATAGAGAAAGTGATGGAAGAAGG - Intergenic
1167819952 19:51918611-51918633 ATGGTGAAAAAGGATTAAGAGGG + Intronic
1168331239 19:55570421-55570443 CTGTAAAAAAGGAATGAAGAGGG + Intergenic
925130731 2:1492487-1492509 ATGGACAAAGTGAAAGAGGAAGG - Intronic
925172078 2:1756185-1756207 GTGGAGTAAATGGATGATGATGG + Intergenic
925625920 2:5842035-5842057 AAGGAGAAAAGAAAAGAAGAGGG + Intergenic
925775985 2:7336291-7336313 ATGAGGAATATGAGTGAAGAGGG + Intergenic
926381413 2:12294229-12294251 CTGGAATAAATGAATGAACATGG - Intergenic
926462637 2:13151606-13151628 ATGGGCAAAATGGATGAAAAGGG + Intergenic
926744730 2:16141596-16141618 ATGGAGCAAATGCATGAAGATGG - Intergenic
926893104 2:17655227-17655249 ATGATGAAAATGAATGAGGATGG + Exonic
927235619 2:20871882-20871904 AGGTAGCAAAAGAATGAAGAAGG + Intergenic
927397355 2:22668613-22668635 AAAGAGAAAATGAAGGAACATGG + Intergenic
927482808 2:23467894-23467916 AGGGCACAAATGAATGAAGAGGG - Intronic
928190010 2:29155681-29155703 CAGCAGAAACTGAATGAAGAGGG - Intronic
928215071 2:29354555-29354577 ATTGAGAAGAAGGATGAAGAAGG - Intronic
928237488 2:29557176-29557198 ATGGAAAAAATAAAAGAATAAGG + Intronic
928541227 2:32285425-32285447 AGGGATAAAAAGACTGAAGAAGG - Intronic
928620012 2:33079248-33079270 ATGGAGAAAACAAATGAATAAGG + Intronic
928696030 2:33851179-33851201 ATGGAAAAACTGATTGAAGAAGG + Intergenic
928785248 2:34876320-34876342 ATAGGGAAAACTAATGAAGAAGG - Intergenic
928794828 2:35005417-35005439 ATGGATAGAAAGAATGAACATGG + Intergenic
928919947 2:36516455-36516477 ATGTTGAAAATGTCTGAAGAGGG - Intronic
929332853 2:40704889-40704911 ATGGGGAAGATGCATGGAGAGGG - Intergenic
929417041 2:41754131-41754153 AGGGAGAAAGTGAATCAGGATGG - Intergenic
929804292 2:45131294-45131316 ATGAAGAAAAGTAATGAAGCTGG - Intergenic
929910954 2:46089185-46089207 ATGTAGAATAAGAATGAGGAGGG - Intronic
929988470 2:46762845-46762867 ATGAAGAAAATGAATGAGAATGG - Exonic
930776274 2:55174079-55174101 ATGGAAAAAAGGAATGGAAAGGG - Intergenic
930837201 2:55807072-55807094 ATGGAGAAAAGGGAAGAAAAGGG - Intergenic
930934813 2:56935791-56935813 ATGGAGAAAAGGAAAGGAGCAGG + Intergenic
931020496 2:58039473-58039495 AGGGAGAAAAATAATTAAGAAGG - Intronic
931060712 2:58526202-58526224 ATGGACACAATGAAGGAAGGTGG + Intergenic
931076702 2:58723331-58723353 AAGGAGAAAATGATTCAAGGTGG + Intergenic
931114084 2:59145579-59145601 ATGGACTCAATGAATGATGAAGG + Intergenic
931133009 2:59360217-59360239 ATGAAGAAAATTAAAAAAGAGGG + Intergenic
931153092 2:59597064-59597086 ATGAGCAAAATGAATGAAGAAGG - Intergenic
931296390 2:60930098-60930120 ATGGAGAAATGGAAAGAATAGGG + Exonic
931605339 2:64046793-64046815 ATAGAGAGTATGAATGAATATGG - Intergenic
931660868 2:64561112-64561134 ATAGAGAAAATGAAAAAGGAGGG + Intronic
931911375 2:66903702-66903724 ATGGGGAAAATGATTCAAAATGG - Intergenic
932132979 2:69204334-69204356 ATGGAGATGCTGAACGAAGATGG - Intronic
932516465 2:72355348-72355370 AATGATAAAATGAAAGAAGAAGG + Intronic
932601042 2:73125827-73125849 TTCCAGAAAATGAATGAAGAAGG + Intronic
933059334 2:77717153-77717175 AGGGAGAAAATGAAGGTAGGAGG + Intergenic
933431416 2:82184824-82184846 AAATAGAAAATGAATGATGAAGG + Intergenic
934987677 2:98899654-98899676 ATGGAGGAAATGAGAGAAAAGGG + Intronic
935319498 2:101872042-101872064 TTGGATAAAAAGAATGAAAAAGG - Intronic
936134726 2:109880355-109880377 ATTGAGAAAATAAATAAATAGGG - Intergenic
936209971 2:110491130-110491152 ATTGAGAAAATAAATAAATAGGG + Intergenic
936429160 2:112446385-112446407 ATTGAGAAAATAAATAAATAGGG + Intergenic
936605239 2:113945620-113945642 ATGAAGCAAATGAATAAACAAGG - Intronic
936669619 2:114641740-114641762 ATGAAGCAAATGATTAAAGAAGG + Intronic
936751442 2:115647113-115647135 ATGGACAGAAAGAAGGAAGATGG + Intronic
936977236 2:118232376-118232398 AAGGAGAAGAGGAAGGAAGAGGG - Intergenic
936996631 2:118421562-118421584 ATGGAGAAAACAAATGAAATAGG + Intergenic
937089908 2:119199234-119199256 ATGGAGAAAATGCATCAGGTCGG + Intergenic
937499373 2:122461834-122461856 ATGGAGAAAATTAAGGCAGACGG + Intergenic
937576781 2:123433123-123433145 ATGAAGAAAATGTAAGAAAATGG + Intergenic
937818214 2:126276433-126276455 AAGGAGAAAAGGAAGGGAGAAGG + Intergenic
938665502 2:133531155-133531177 ATGGTGAAAGGGAATGAGGAAGG + Intronic
938963209 2:136361485-136361507 ATGGAGAGAGAGAAGGAAGAAGG - Intergenic
939291313 2:140198923-140198945 AAGGAGAAAAAGAAAGAAGGAGG + Intergenic
939759522 2:146156791-146156813 ATGAATACAATGAATGGAGATGG + Intergenic
940026664 2:149215575-149215597 ATAGAGAATATGACTGAAGGAGG - Intergenic
940556348 2:155233362-155233384 ATGTATAATATGAATGCAGAAGG - Intergenic
940574631 2:155485588-155485610 ATAGAAAAAATGAATGGAGAGGG - Intergenic
940599125 2:155835213-155835235 AAGGAGAGATTGAAGGAAGAAGG + Intergenic
940702743 2:157066308-157066330 AAGGAGGAAAGGAAGGAAGAAGG - Intergenic
940845625 2:158638711-158638733 ATGGAGAAAATGAATGGATTTGG + Intronic
941019975 2:160397613-160397635 AAAGAGTGAATGAATGAAGAGGG - Intronic
941198745 2:162483010-162483032 AAGGAGAATGGGAATGAAGAAGG + Intronic
941223396 2:162813511-162813533 TGGGAGAGAATGAATGATGAAGG - Intronic
941365622 2:164607681-164607703 ATTGATAAAATGAATGAATCTGG - Intronic
941461141 2:165773199-165773221 ATGGAGATAATGAATCATGGGGG + Intronic
942214614 2:173706362-173706384 AATGAGAAAATGAATGTAAAAGG + Intergenic
942291480 2:174476209-174476231 GTGAATAAAATGGATGAAGAAGG - Intronic
942539496 2:177001062-177001084 GAGGAGAAAATGAATGAGGACGG - Intergenic
942978270 2:182046136-182046158 AAGGAGGAAAGGAAGGAAGAAGG - Intronic
943110327 2:183596648-183596670 ATGGAAAAAATCCATGAACAAGG - Intergenic
943763536 2:191635711-191635733 AAGGATAAAATGAATGATGGAGG + Intergenic
943986942 2:194635109-194635131 ATGGTAAAAAAGATTGAAGATGG - Intergenic
944196338 2:197057989-197058011 ATGCAGGAAATAAATGAAAATGG - Intronic
944418262 2:199500296-199500318 ATTTTGAAAATGAATGAAGTTGG + Intergenic
945194282 2:207223832-207223854 CTGAAGAAAATGAGTGAAGTGGG - Intergenic
945268711 2:207917017-207917039 CTGGAGAAAAAGAAGGGAGAGGG + Intronic
945323997 2:208461926-208461948 TTGAAGAAAATTAATGTAGAAGG + Intronic
945708360 2:213264726-213264748 ATGGACAAAATGGATGAAGAAGG + Intergenic
946460035 2:219860810-219860832 AAGGAAAAAAAGAAGGAAGAAGG + Intergenic
946494923 2:220186503-220186525 ATGGAGAAAATGAATGGATTTGG + Intergenic
946528533 2:220546585-220546607 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
946609221 2:221439965-221439987 ATGCAGAAAATTTGTGAAGATGG - Intronic
947089822 2:226497173-226497195 AAGGAGAAAATGAAAATAGAAGG - Intergenic
947106468 2:226673095-226673117 AGGGAGAAAAAAAATGAAAAGGG - Intergenic
947234972 2:227931682-227931704 ATAGAGAAAATAAAGGAAAAAGG - Intergenic
947280217 2:228443773-228443795 ATAGAGAAAATGAATAATTAAGG + Intergenic
948148241 2:235724431-235724453 ATCGGGAAAATGAATGAGGGAGG - Intronic
948743032 2:240060661-240060683 ATGGAAAAACTGATTGAAGAAGG - Intergenic
1169026281 20:2374335-2374357 ATGGAAGAAATGAATGAAGAGGG + Intergenic
1169405865 20:5320654-5320676 ATGGAGATAACGAATGAAGCAGG + Intergenic
1169566943 20:6865032-6865054 ATGGAGAAAATCATAGAGGACGG + Intergenic
1169600849 20:7259096-7259118 AGGAAGAAAAAGAATGCAGAAGG - Intergenic
1169697215 20:8403524-8403546 ATGGAGGGAATGCAGGAAGATGG + Intronic
1169715007 20:8605941-8605963 ATGGATGAAATGGATGAAGCTGG - Intronic
1170135329 20:13067632-13067654 ATAGAGATATTGAATAAAGATGG - Intronic
1170340403 20:15320533-15320555 ATGGATAAAATGAATGAATGAGG - Intronic
1170354435 20:15477071-15477093 ATAGAGAAAAGGAATGGAAAAGG - Intronic
1170387108 20:15831537-15831559 AGGCACAAAATGAATGAAGGTGG - Intronic
1171212263 20:23326136-23326158 ATGGAGAAAATGGATATTGAGGG - Intergenic
1171340239 20:24421643-24421665 AGGGAGAAAATAAATGAGTAAGG - Intergenic
1172144717 20:32748736-32748758 AGAGAGAGAATGAATGAACAAGG + Intergenic
1172197997 20:33105221-33105243 ATGGAGAAAAAGAGTTTAGAAGG - Intronic
1172367364 20:34360331-34360353 CTAGAGAAACTGAATGAGGATGG + Intergenic
1172798262 20:37558457-37558479 AAGGACAGAATGAGTGAAGAGGG + Intergenic
1172988894 20:39017220-39017242 ATCAACATAATGAATGAAGATGG - Intronic
1173243167 20:41316248-41316270 ACATAGAAAATGAATGAAAAGGG - Intronic
1174096536 20:48093874-48093896 ATGAATAAAATGAATAAAGAAGG + Intergenic
1174214652 20:48906963-48906985 AAGGAGAGAAAGAAGGAAGAAGG - Intergenic
1174283280 20:49454598-49454620 GTGGAGAAAAAGAATGAAGCAGG + Intronic
1174530614 20:51210496-51210518 AGGGAGGGAATGAAGGAAGAAGG - Intergenic
1174725341 20:52855838-52855860 ATGAAGAAAAACAATGAGGAAGG - Intergenic
1174897519 20:54466747-54466769 CTGGATAAAATGTGTGAAGAGGG - Intergenic
1174923231 20:54727644-54727666 AAGGAGAAAAACAATGAGGATGG - Intergenic
1175271536 20:57737501-57737523 AGGGAGGAAAGGAAGGAAGAAGG - Intergenic
1175613927 20:60376424-60376446 AATGAGTGAATGAATGAAGATGG - Intergenic
1175650428 20:60716784-60716806 AAGAAGAAAATGAATGCAGGGGG - Intergenic
1176893559 21:14348407-14348429 ATTGAGAAAAGGAAAGAAGACGG + Intergenic
1178757715 21:35368340-35368362 TTGAAGAAAATGAATAAATAGGG + Intronic
1179262086 21:39766200-39766222 AAGGAGAAAGAGAATGAAGCAGG - Intronic
1181403099 22:22663657-22663679 ATGGGGAAAATCAAGAAAGAAGG + Intergenic
1181912877 22:26254410-26254432 AAGGAGGAAAGGAAGGAAGATGG + Intronic
1181917374 22:26292067-26292089 AGGAAGAAAATGAAGGAGGAAGG + Intronic
1181959107 22:26610333-26610355 TGGGAAAAAAAGAATGAAGAGGG - Intronic
1182048988 22:27298942-27298964 AGGGAGAAAAGGAAGGAGGAAGG + Intergenic
1182074608 22:27487376-27487398 CTGGGGAGAATGATTGAAGAGGG - Intergenic
1183124126 22:35759141-35759163 ATGGGGAAAAGGAGTGAAGATGG - Intronic
1183575058 22:38682633-38682655 TTGGAGATAATTAATGAATAAGG + Intronic
1184291801 22:43501374-43501396 AGGGAGAGAAAGAAGGAAGAGGG - Intronic
1185225620 22:49650373-49650395 TTGGAAAAAATGAATGGGGAAGG + Intronic
949098997 3:120392-120414 AGGGGGAAAAGGGATGAAGAAGG + Intergenic
949262721 3:2121096-2121118 AGGGAGAGAAGGAAGGAAGAAGG - Intronic
949381892 3:3455984-3456006 CTGGATAAAATGCATGAAGGTGG + Intergenic
949730851 3:7111063-7111085 ATGGAGAAATTGACTGATGTGGG + Intronic
950242728 3:11386165-11386187 CTGAAGAAAATAAATGAAGGCGG - Intronic
950284494 3:11733970-11733992 ATGGAGAAAGAGCATGGAGAAGG + Intergenic
951074496 3:18373150-18373172 CTTTAGAAAGTGAATGAAGAAGG + Intronic
951744023 3:25956681-25956703 ATGGACAGAAGGAATGAAGGAGG + Intergenic
952064823 3:29556614-29556636 AAAAAGAAAATGAATGAACAAGG + Intronic
952543212 3:34389790-34389812 ATGGAGATAATGGAAGAGGACGG + Intergenic
952563062 3:34618509-34618531 ATAGAGAAGCTGAATGAATAAGG - Intergenic
953014193 3:39057034-39057056 GTGGAGAAAACCATTGAAGAAGG + Intronic
953249638 3:41232842-41232864 ATGGAGAAAAATAATGGAGTGGG - Intronic
954005315 3:47585940-47585962 ATGGAGAAAATGAATGAAGAAGG - Exonic
954440019 3:50516680-50516702 CTGGAGAGAAGGAATGCAGAGGG - Intergenic
954499422 3:50996733-50996755 ATGGAGAGAATAAAAGAAAAGGG - Intronic
954791135 3:53134484-53134506 TTGGAATAAATGAATGATGAAGG + Intergenic
955137622 3:56235396-56235418 ATGGACAAAATGAATACACATGG + Intronic
955249847 3:57269184-57269206 ATGGAGAAAAGGGCTGGAGAGGG + Exonic
955631335 3:60978628-60978650 ATGGAGAAAATGAATTTAAGAGG - Intronic
955871523 3:63443295-63443317 AAGAAGAAAATCAATGCAGAGGG - Intronic
955888972 3:63630648-63630670 ATGGGGTGAATGAATGAAGGTGG - Intergenic
956295190 3:67704650-67704672 AGGGAGAAGATGATTAAAGAAGG - Intergenic
956553287 3:70486786-70486808 ATGGAGAAAATGAAGTCAAAGGG - Intergenic
956962194 3:74416027-74416049 TTAGAGAAAAGGAATGGAGATGG - Intronic
957200329 3:77126671-77126693 ATTGAGAAAAAGAAGGAATATGG + Intronic
957395835 3:79636563-79636585 ATGGAGTAAAGGAATGGTGAGGG - Intronic
957458498 3:80486160-80486182 AGAGAGAAAATGAAAGAATAAGG - Intergenic
957459596 3:80499104-80499126 GTTTAAAAAATGAATGAAGATGG - Intergenic
957725549 3:84061207-84061229 TTAAAAAAAATGAATGAAGATGG - Intergenic
957764872 3:84610526-84610548 AAGGGGAAAAAGAAGGAAGAGGG + Intergenic
957932881 3:86904831-86904853 ATGGAAAAAACGAAGGAAGAAGG + Intergenic
958641225 3:96808403-96808425 ATGAAAAAAATTAATGATGATGG + Intergenic
958645032 3:96859121-96859143 TTGAAGAAAATGAATGAATGAGG - Intronic
958769369 3:98407988-98408010 ATGAATGAAATGAAGGAAGAAGG + Intergenic
959098220 3:101980528-101980550 AAGGACAGAAAGAATGAAGAAGG - Intergenic
959367949 3:105487527-105487549 ATAGAGAAAAAAAATGAAAATGG + Intronic
960072359 3:113445338-113445360 ATTGAGAAACAGAATGAAGAAGG - Exonic
960499383 3:118418595-118418617 AAGGAGAAAATGCAAGAAAAGGG + Intergenic
961217629 3:125172715-125172737 GTGGAGAAACTGAGTGAAGGAGG + Intronic
961414730 3:126749039-126749061 AAGGAGACAAAGAATGAGGAGGG + Intronic
961436736 3:126924266-126924288 ATAGAGAAAATGTCTGAAAAAGG + Intronic
961660253 3:128464859-128464881 AAGGAGGAAATGAAGGAAGGAGG - Intronic
962054401 3:131854736-131854758 ACGGAGGAAAAGAATAAAGATGG - Intronic
962091747 3:132251595-132251617 ATGGAGCAAATGAAGGGAGGGGG + Intronic
962417097 3:135193052-135193074 ATGAATAAAATGAATAGAGAGGG + Intronic
962533122 3:136301959-136301981 AAAGAGAAAAAAAATGAAGATGG + Intronic
962595241 3:136935549-136935571 AGGGAGAAACTGAATTAATAAGG + Intronic
962653611 3:137520102-137520124 AGGGAAAAAATGAATGAGAAAGG - Intergenic
963108437 3:141665712-141665734 AAGGAGACAATGAAGGAAGGAGG + Intergenic
963108517 3:141665962-141665984 AAGGAGACAATGAAGGAAGGAGG + Intergenic
963722533 3:148879276-148879298 TTGGAGATAATGAATGAATGGGG - Intronic
963793236 3:149605402-149605424 ATGGAGGAAATGTATGAGGCGGG + Intronic
963998112 3:151735138-151735160 TTGGAGAAAATTTATGGAGAAGG - Intronic
964045594 3:152321603-152321625 ACGAATAAAATGAATGTAGAAGG - Intronic
964514213 3:157489595-157489617 ATGTAGAAAATTAACGCAGAGGG - Intronic
964734381 3:159901249-159901271 AAGGAGAAAGAGAATGGAGAGGG - Intergenic
964833664 3:160913058-160913080 GTGGACAAAATCCATGAAGATGG + Intronic
965017874 3:163182830-163182852 ATGAAGATGATGAAGGAAGAAGG - Intergenic
965205638 3:165717063-165717085 ATGGAGAAAAATAATTAAGTTGG + Intergenic
965298580 3:166979950-166979972 ATGGAATAAATGAATGAATAAGG + Intergenic
965346148 3:167553259-167553281 ACGGAAAACATGAAGGAAGATGG + Intronic
965365570 3:167794976-167794998 AAGAAGAAAATCAAAGAAGAAGG - Intronic
965518384 3:169646926-169646948 AGGAAGAAAATGAAAGATGAAGG + Intronic
965738099 3:171843567-171843589 ATTGAGAAAATAAAAGAAGGTGG + Intronic
965973992 3:174598354-174598376 AGGGAGAAAATGAATATAAAAGG - Intronic
965991166 3:174819934-174819956 ATGGAGAAATTGGATTAGGAAGG - Intronic
966092245 3:176154239-176154261 AAGGAGGAAAAGAGTGAAGAAGG - Intergenic
966285492 3:178290240-178290262 ATAGAGAAAAGGATTGAAGAGGG + Intergenic
966941295 3:184749318-184749340 AGGGAGAGAAAGAAAGAAGAAGG + Intergenic
967112377 3:186305420-186305442 ATGCTGAAAAGGAATGAAGATGG + Intronic
967271531 3:187737390-187737412 AGAGAGAAAATGAGAGAAGAGGG + Intronic
967699312 3:192572955-192572977 AGAGAGAAAATGAGGGAAGAAGG + Intronic
968380990 4:95642-95664 GTGGAGAAAATGAATAAAAAAGG - Intergenic
968819402 4:2838107-2838129 CTGCAGGAAATGAATGAAAAAGG - Exonic
968914209 4:3490108-3490130 AGGGAGAAAAGGAATGAATGGGG - Intronic
969211751 4:5693128-5693150 GTGGAGCAAATAAATGCAGAAGG + Intronic
969270317 4:6095149-6095171 AAGGAGCAAAGGAAGGAAGAAGG + Intronic
969444433 4:7236168-7236190 AAGGAGAAAATAAATACAGAAGG + Intronic
969486779 4:7476775-7476797 GTGGAGAAAATGGAAGCAGAGGG - Intronic
969926271 4:10588608-10588630 ATTGTGAAAATGAATGTAAATGG - Intronic
969991076 4:11262852-11262874 AGGGAGAAAAAGAAGGAAGAGGG + Intergenic
970197736 4:13569206-13569228 ACAGAGAAGAGGAATGAAGAGGG + Exonic
970377255 4:15471452-15471474 GTGGAAAAAAGGAATGAGGAGGG - Intronic
970420349 4:15900118-15900140 AGGAAGAAAATGAATGAAGAAGG - Intergenic
970696949 4:18689383-18689405 ACGGAGAAATTGAAGGAAGAGGG - Intergenic
971037763 4:22713827-22713849 AGAGTGAAAATAAATGAAGAGGG + Intergenic
971303382 4:25460480-25460502 ATGTAGAAAATGAAAAAGGAGGG - Intergenic
971830981 4:31694039-31694061 ATGGAGGAAATAAATACAGAGGG + Intergenic
971871563 4:32246577-32246599 ATGGGGAAAATGAAACAAGACGG - Intergenic
972473841 4:39432311-39432333 ATGGAGAAAATGAGAGACCAGGG + Intronic
972594303 4:40516558-40516580 AAGGAGAAATAGAATGATGAGGG - Intronic
972906863 4:43760756-43760778 CTGGAGCAAATGATTGGAGAAGG + Intergenic
972924240 4:43983906-43983928 AGGGAGAAAGTGAAGGAAGGAGG + Intergenic
973531281 4:51839092-51839114 AGAGAGAAAAGGAAGGAAGAAGG + Intergenic
973555809 4:52081560-52081582 ATGGAGAATAAGAATAAAAAGGG - Intronic
973620904 4:52724365-52724387 ATGGCTAAAATGAAAAAAGATGG - Intronic
973659755 4:53091786-53091808 ATTGCTAAAATGAATGTAGAAGG - Intronic
973910627 4:55576640-55576662 ACACAGAAAATGAAAGAAGAAGG + Intronic
974100411 4:57410285-57410307 ATGGAGAAAATGAAGGGTCAAGG - Intergenic
974446013 4:61982776-61982798 ATGGTGAACATGAATAAAAATGG - Intronic
974465918 4:62255796-62255818 ATGGGGAAAATGAAGAAAAATGG + Intergenic
974712605 4:65619622-65619644 AAGAAGAAAATGAGTTAAGATGG - Intronic
974738274 4:65969753-65969775 ACAGAGAAAATGAATGAACTTGG - Intergenic
974928774 4:68336418-68336440 ATTGAAGAAATGACTGAAGATGG + Intronic
975091022 4:70404371-70404393 ATGGAGAAAGGGTAAGAAGATGG - Intronic
975411286 4:74054197-74054219 CTGGAGGAAATGAATGCAGATGG + Intergenic
975760335 4:77613891-77613913 ACTGAGAAACTGAATGAAGGAGG + Intergenic
976366110 4:84234139-84234161 ATGGAGAATAAAAATGATGAAGG + Intergenic
976793975 4:88911883-88911905 GTAGAGAAAGTGAGTGAAGATGG - Intronic
976890819 4:90045332-90045354 CTGGGGAAAATTAATGAAGGTGG - Intergenic
976902531 4:90196588-90196610 ATGGGGAAAGGGAATAAAGAAGG - Intronic
977070019 4:92373852-92373874 AATGAGAAAATGAAGGAATAGGG + Intronic
977186665 4:93946810-93946832 GTGGAGCAAAAGAATCAAGAAGG - Intergenic
977851269 4:101832819-101832841 AAGGAGAAAACCAATGGAGATGG - Intronic
977895268 4:102357632-102357654 AAGGAGAGAATGAAAGAGGAAGG + Intronic
978206293 4:106084086-106084108 ATGGACAAAGTGACAGAAGAAGG + Intronic
978453136 4:108858819-108858841 ATGGAAAAAATGAAAGTAGAAGG + Intronic
978907115 4:114018690-114018712 GTGGAGGAAATGATTGAAAAAGG + Intergenic
978910712 4:114060468-114060490 ATGGAGAATATGAATAAAATTGG + Intergenic
979130713 4:117041214-117041236 AAGGAGGAAATGAAAGAAAAAGG - Intergenic
979340109 4:119512737-119512759 AGGGAGAAGATGATTAAAGATGG + Intronic
979427609 4:120586717-120586739 ATTAAAAAAATGAATGAATAAGG + Intergenic
979731448 4:124028031-124028053 ATAACGAGAATGAATGAAGATGG - Intergenic
979865049 4:125744084-125744106 ATGGAAAGATAGAATGAAGAAGG + Intergenic
979915363 4:126426175-126426197 ATAGTTAAAATGAATGAACAAGG - Intergenic
980258796 4:130420341-130420363 CTGAAGGAAATGAATGAAAATGG + Intergenic
980283264 4:130750347-130750369 CTGAATAAAATGAATGAAAATGG + Intergenic
980383113 4:132051797-132051819 ATGCACAAAGTCAATGAAGAAGG - Intergenic
980429571 4:132676071-132676093 AAGGGGAAAATGAGGGAAGATGG + Intergenic
980476192 4:133320573-133320595 ATGTAGAACATTAAGGAAGAAGG - Intergenic
980649351 4:135689947-135689969 ATGGAGAATAGGAGTGAAAAAGG + Intergenic
980663034 4:135891981-135892003 CAGCAGAAAATTAATGAAGATGG - Intergenic
980742371 4:136969259-136969281 AGTGAGAAAATGAATAAAGAGGG - Intergenic
981042309 4:140234412-140234434 ATGGGGAAAATGATTAAAAAGGG + Intergenic
981116883 4:141001719-141001741 ATGGAGGAAATAAATGGAAAAGG + Intronic
981179855 4:141728355-141728377 ATGGAAAATATGATTGCAGATGG - Intronic
981384243 4:144109153-144109175 AGGGAAAAAATGAATGGAGAAGG - Intergenic
981408671 4:144401880-144401902 ATGAAGATAATGAAGGAAAAGGG + Intergenic
981802126 4:148670154-148670176 CTGTAGAAAATTAATGAAAAGGG + Intergenic
981818521 4:148859221-148859243 ATGTTGAAAATGAATGATGATGG + Intergenic
982059538 4:151591043-151591065 AGGGAGAAAATTAATTAAGAAGG - Intronic
982469377 4:155769055-155769077 TTGGAGAAGATGAAGGAAGAAGG - Intronic
982651924 4:158097254-158097276 CTGGAGAAAATGGATGGAAATGG - Intergenic
982792354 4:159607534-159607556 AGGCAGAAAATGAATGCAGTAGG + Intergenic
982996580 4:162356083-162356105 ATGGAGAAAATAGCTAAAGAAGG - Intergenic
983206181 4:164912381-164912403 ATGAAGAAAATGAAATATGAAGG + Intergenic
983381283 4:166997423-166997445 TTGCTGAAAATGAATTAAGAAGG - Intronic
983483554 4:168305840-168305862 ATGGAGAAGGTCAATAAAGAAGG - Intronic
983569076 4:169185203-169185225 GAGGATAAAATGAATGAACAAGG + Intronic
983843279 4:172482748-172482770 GTGGAAAAGATGAATGATGAAGG - Intronic
983896453 4:173086186-173086208 AGGGAGGAAAGGAATGAAGGAGG - Intergenic
984042516 4:174752951-174752973 ATGGAGAACATGAAGAAACATGG - Intronic
984179995 4:176470503-176470525 ATAATGAAAATGAATGAAGTAGG + Intergenic
984420996 4:179521176-179521198 CTGGAGATAATGCATGAAAAGGG - Intergenic
984453372 4:179932558-179932580 AGAGAGAGAATGAAGGAAGAAGG + Intergenic
984731070 4:183068808-183068830 ATGCAGGAAATGAAGGAAAATGG + Intergenic
984751124 4:183276376-183276398 AGGAAGAAAAAGAATAAAGATGG - Intronic
984785768 4:183566044-183566066 ATGGAGGAAATGAGGGAAGGAGG + Intergenic
985020321 4:185682075-185682097 ATGAAGAAAATAAATGAAAAGGG - Intronic
985268346 4:188171207-188171229 ATAGAGATGATGACTGAAGAGGG + Intergenic
986071258 5:4286961-4286983 ATGGAAAACAGGAAAGAAGAGGG - Intergenic
986109811 5:4702620-4702642 CTGGAAAAGATGAATGTAGATGG - Intergenic
986877933 5:12133021-12133043 ATGGAGAGAATAATTGAAGGGGG + Intergenic
987113476 5:14708658-14708680 GTGAAGAAAATGTACGAAGAAGG + Exonic
987187495 5:15439786-15439808 AAGGAATAAATGAATAAAGAGGG + Intergenic
987435735 5:17891946-17891968 AGTGAGCAAATGACTGAAGACGG - Intergenic
987531351 5:19125000-19125022 AAGGAGAAAATCAATTAAAAAGG + Intergenic
987731796 5:21782546-21782568 ATGCACAAAATAAAAGAAGAAGG + Intronic
987813027 5:22863645-22863667 ATGAAGAAAATTAATGAGGCAGG + Intergenic
988308762 5:29529604-29529626 AAGGAAAAAATGGATCAAGATGG + Intergenic
988670016 5:33371333-33371355 ATGGAGAAAATGGATCCAGCAGG - Intergenic
988976123 5:36517264-36517286 ATGTAGAAAAAGAAGTAAGATGG - Intergenic
988983414 5:36594356-36594378 AGCGTGACAATGAATGAAGATGG - Intergenic
989553819 5:42767977-42767999 ATAGAGAAAATGGAGGATGAGGG + Intronic
989977647 5:50605797-50605819 CTGGAGAAAATTAATGAATTAGG - Intergenic
990056773 5:51591410-51591432 ATGGAAAAAGTGAATAAAGATGG + Intergenic
990504639 5:56432291-56432313 AAGGAGAAAACGAATGAAAGAGG - Intergenic
990555822 5:56934713-56934735 ATGGAGGAAAGGAAAAAAGAAGG + Intronic
990768822 5:59219777-59219799 ATGTAGACAATGAATGTAAAGGG + Intronic
991012525 5:61898959-61898981 ATGGAGGAAATGAAGGTAGAGGG + Intergenic
991537415 5:67686182-67686204 ATGGAGGAAGTGAAGCAAGATGG - Intergenic
992243741 5:74796375-74796397 ATGGATAGAATAAAAGAAGAAGG - Intronic
992321223 5:75614904-75614926 ATGGAGGAAAAGAATGGTGAGGG + Intronic
992327547 5:75676238-75676260 ATGTAGAAAATGTATAGAGATGG - Intronic
992366365 5:76094313-76094335 AAGGAGGCAATGAATGAAAAGGG - Intronic
992489530 5:77228688-77228710 ATGGAGAAAATGAAAGATGAGGG + Intronic
992953252 5:81881572-81881594 ATGGAGAAAATGAAGCAGGGAGG + Intergenic
993045212 5:82858632-82858654 AGGGAGACACTGAAGGAAGAAGG - Intergenic
993245736 5:85450817-85450839 ATAGAAAAAAAGAATGAAAAAGG - Intergenic
993271750 5:85806055-85806077 AGAGAGAAGAGGAATGAAGAGGG + Intergenic
993714295 5:91259698-91259720 ATGGATGAAATGAATGAAGCAGG - Intergenic
993725769 5:91364931-91364953 ATGAAATAAATGAATGAATATGG - Intergenic
993807371 5:92428036-92428058 AAGGAGAAACTAAATGAAGAAGG - Intergenic
994457041 5:100023861-100023883 AGTGACAAAATGGATGAAGAAGG - Intergenic
994867220 5:105290921-105290943 ATGGAGAAAAGAAATGTAGATGG - Intergenic
995045552 5:107642723-107642745 ATGGAGAGAAAGAAAGAATACGG + Intronic
995156177 5:108915919-108915941 ATGGGAAAAGTGAAAGAAGAGGG - Intronic
995662275 5:114498689-114498711 ATGAAGAAAATTATTGAGGAAGG - Intergenic
995747264 5:115416996-115417018 TTTGAGAAAATTGATGAAGATGG + Intergenic
995817343 5:116186071-116186093 AGGGAGAAAGATAATGAAGATGG - Intronic
996004466 5:118404525-118404547 ATGGATAAACTGAAAGAAGTGGG - Intergenic
996177336 5:120375491-120375513 ATGGAAAAAATGAAGCAAGAAGG + Intergenic
996491570 5:124104317-124104339 ATGGAGAAAATAAGGAAAGAAGG - Intergenic
996659025 5:125977435-125977457 ATTGTGGAAATGAATGCAGAAGG + Intergenic
997048042 5:130343528-130343550 ATGGAGAAAATGAATACAATTGG + Intergenic
998298337 5:140993430-140993452 AAGGAGAACAGGAATGAATAAGG - Intronic
998582711 5:143396733-143396755 TTGGAGAGAATGAATGATGTAGG - Intronic
998755498 5:145374973-145374995 ATGGATGAATTGAACGAAGAAGG - Intergenic
998813697 5:145991568-145991590 ACGGAGAAAAAGAAGAAAGAGGG + Intronic
998814196 5:145995586-145995608 AGTTAGAAAATGAATGAAGTTGG - Intronic
998883298 5:146667485-146667507 ATGGAGAAAAAGAAGAAAGCAGG + Intronic
998966085 5:147541774-147541796 ATATAGAAAATGAATAAACAAGG + Intergenic
999001515 5:147928867-147928889 AAATAGAAAATGAATGAAAAGGG + Intergenic
999037810 5:148373202-148373224 ATGAAGAAAATGAAAATAGATGG + Intergenic
999405210 5:151300943-151300965 ATGGAGGAAATGTATGGACATGG - Intronic
999504868 5:152184170-152184192 AGAAAGAAAAAGAATGAAGAGGG + Intergenic
999526772 5:152414816-152414838 AGGGAGAAAATGAATGGAGGTGG + Intronic
999857818 5:155614245-155614267 ATGAAGAAAATGTATTAAGGAGG + Intergenic
1000378956 5:160611762-160611784 ATGGAGAAAACGAAAGAAGACGG - Intronic
1000446226 5:161325093-161325115 ATGATGAAAATGATTGAAGAAGG - Intronic
1000463889 5:161551873-161551895 ATGGATAAGATGAATCAATATGG - Intronic
1000469827 5:161627553-161627575 ATGGAGGAAGGGAATGAGGACGG - Intronic
1000638468 5:163671760-163671782 ATCAAGAAAATAAATGAGGAAGG + Intergenic
1000671186 5:164065175-164065197 AAGGAAATAAGGAATGAAGATGG - Intergenic
1000718027 5:164671044-164671066 ATGGAGAAACTGATCAAAGAGGG - Intergenic
1000855359 5:166391275-166391297 ATGGAGTAAAATAATGAAGTGGG + Intergenic
1000988614 5:167888429-167888451 ATGGAGGAAAGGTATGCAGAGGG + Intronic
1001371309 5:171206039-171206061 ATGAAGATAATGAATGGACATGG + Intronic
1001372714 5:171222427-171222449 ATGTAGATAAGGAATGGAGATGG + Intronic
1001514334 5:172344948-172344970 ATGGAGGAAAGGAAGGAAGGAGG + Intronic
1001788954 5:174437952-174437974 ATGGACAAATTGACAGAAGAAGG + Intergenic
1001853999 5:174995041-174995063 ATGGAGAATAAGTATAAAGATGG + Intergenic
1001918590 5:175582516-175582538 ATTGAGGAAATGAAGGATGATGG - Intergenic
1002139403 5:177129829-177129851 ATGGAATTAATGAATGAAAAGGG + Intergenic
1002811315 6:632528-632550 ATGGATAAAATGAAGGAAAAGGG + Intronic
1002831722 6:827785-827807 AAGGAGAAATAAAATGAAGAAGG - Intergenic
1002852686 6:1010553-1010575 AGGGAGGAAATGAGGGAAGAAGG - Intergenic
1002999834 6:2320450-2320472 ATGGAGAAAAGGAAAAAAGTAGG + Intergenic
1003376534 6:5583413-5583435 ATTTATAAAATGAATAAAGACGG + Intronic
1003797074 6:9616398-9616420 AGGGAGAAAAAGAAGGAAGCAGG + Intronic
1004005296 6:11632531-11632553 GGGGAGAACATGAATGAGGATGG - Intergenic
1004062065 6:12207324-12207346 ATTTAAAAAATGAATAAAGATGG - Intergenic
1004126701 6:12881228-12881250 ATGGTGAATATTAAGGAAGAGGG + Intronic
1004605113 6:17187265-17187287 AATGAGAAAATGAAAGAAAAAGG - Intergenic
1004701411 6:18082949-18082971 CTGGAGAAAAAGAAGGAAAAAGG - Intergenic
1004737863 6:18426059-18426081 GTGGAAAAAATGAGTAAAGATGG + Intronic
1005025550 6:21459746-21459768 AGGGAGAAAAGGAAGGAGGATGG - Intergenic
1005210292 6:23452927-23452949 ATGAAAAGAATGAAAGAAGATGG + Intergenic
1005213665 6:23499145-23499167 ATGTAGAAAAAGAATGGACAAGG - Intergenic
1005233245 6:23729211-23729233 ATATAGAAAATGTATCAAGATGG + Intergenic
1005327123 6:24712997-24713019 AGGGAGAAAATGAATATAAAAGG - Intronic
1005444844 6:25911666-25911688 ATGGATAAAATGAAAGGAGATGG - Intergenic
1006044730 6:31285037-31285059 ATTCAGATAATAAATGAAGAAGG - Intronic
1006205853 6:32342127-32342149 CTGGAAAAAATGAATGGAGAAGG - Intronic
1006763959 6:36488413-36488435 ATGGAGAACAGGAGGGAAGATGG - Exonic
1006961065 6:37930810-37930832 TTTGACAAAATGAATAAAGAAGG - Intronic
1007099042 6:39231940-39231962 ATGGAGAGCAAGAAGGAAGAAGG - Intergenic
1007308652 6:40927252-40927274 CTGGGGAAAGTGACTGAAGAGGG + Intergenic
1007346451 6:41233215-41233237 ATGGAAAAAATGAAATAAAAAGG + Intronic
1007582970 6:42970109-42970131 GTGGGGAAAAGGAATGCAGATGG + Intronic
1008161527 6:48082206-48082228 AGTCAGGAAATGAATGAAGAAGG + Intergenic
1008396670 6:51016797-51016819 TTGAAGTAAATGAATTAAGATGG + Intergenic
1008551041 6:52631018-52631040 ATGGAGAATATGAGGGAATACGG - Intergenic
1008896273 6:56559681-56559703 ATGTAGAAAATGAGTGTAAAGGG - Intronic
1009270775 6:61610706-61610728 ATTGGGAAAATTAAGGAAGAGGG - Intergenic
1009433854 6:63595720-63595742 ATGGTGAAAGTGAAGGAACATGG + Intergenic
1009609974 6:65929254-65929276 ATGGAGGATATGAATAAAAATGG + Intergenic
1009654125 6:66518002-66518024 ATAGAGATAATGAGTGAAGAAGG - Intergenic
1010186677 6:73152331-73152353 AGGTAGAAAATGAAAGAGGAAGG - Intronic
1010711513 6:79180630-79180652 ATGGAAAAAAAGAACTAAGATGG - Intergenic
1010720728 6:79280491-79280513 ATGAAAAAAATGAATAAATATGG + Intergenic
1010947222 6:81989768-81989790 TTGTAGATATTGAATGAAGATGG - Intergenic
1010966327 6:82213545-82213567 ATTGAGAAACTGAAGTAAGAAGG + Intronic
1011018091 6:82781319-82781341 ATGAAGAAAATGATTAAAGATGG + Intergenic
1011312534 6:85996019-85996041 TTGGAGATAATGAATCAAAATGG - Intergenic
1011692151 6:89879987-89880009 AAGGAGAAAATAAATAAAGGAGG - Intergenic
1011872566 6:91914522-91914544 ATGGAGAAAATGAATAAGAGTGG + Intergenic
1012089410 6:94873009-94873031 ATGAATAAAATGAAGCAAGAAGG - Intergenic
1012872833 6:104692115-104692137 AGGGAGAAAAGGAAGGAAGGGGG + Intergenic
1012957724 6:105589200-105589222 CTGGGGAAAATGAGGGAAGAAGG + Intergenic
1013533374 6:111040719-111040741 AGAGAGAAAATGAAAAAAGAAGG + Intergenic
1013673197 6:112428192-112428214 AAGAAGAAAATGTATGGAGATGG + Intergenic
1013709832 6:112883887-112883909 CCTGAGAGAATGAATGAAGAGGG - Intergenic
1013776724 6:113687156-113687178 AATGTGAAAATGAAGGAAGATGG - Intergenic
1014050078 6:116942041-116942063 ATGGAGAAACTGATTGAATTGGG - Intergenic
1014358432 6:120442807-120442829 GGGGAGAAAATGAATAAAGGAGG + Intergenic
1014465595 6:121752812-121752834 AGGTAGAAATTGAATGAAAAAGG + Intergenic
1014552617 6:122806660-122806682 CTGGAGAAGAAGAATGAACATGG - Intronic
1014625889 6:123724159-123724181 ATGGAGAAAATGAAATAGGCAGG - Intergenic
1015085094 6:129281005-129281027 ATGCATAAAATTAATGAAGCAGG + Intronic
1015478025 6:133675319-133675341 AAGGAGGAAATGAAGGAAGAAGG + Intergenic
1015617588 6:135093565-135093587 ATGGGGAAAATGTACGAAAAGGG + Intronic
1015666524 6:135636118-135636140 AGGGAGAAGAAGAAGGAAGAAGG - Intergenic
1015797915 6:137031737-137031759 ATCAAGAAAATGAAAGAGGATGG + Intronic
1016159839 6:140865305-140865327 ATGTAGAAAATAATTTAAGAAGG - Intergenic
1016259641 6:142152250-142152272 ATTGAGAAAATGAGTAATGATGG + Intronic
1016607879 6:145954200-145954222 ATGGAGAAAATAAATCAATTTGG + Intronic
1016623007 6:146134294-146134316 AAGGAGATAATGAATGTAAAGGG + Intronic
1016701944 6:147064300-147064322 ATGGAGAAAATAAGATAAGATGG + Intergenic
1016917813 6:149261059-149261081 TTGGAGAAAGTGGATGAAAAAGG - Intronic
1017112846 6:150948939-150948961 ATGGAGAAAATAAAATTAGAGGG + Intronic
1017275128 6:152557270-152557292 ATGGAAAAAAAGGATGAAAAGGG + Intronic
1017506843 6:155076330-155076352 AATGAGAAAATGACTGTAGATGG - Intronic
1018185348 6:161261751-161261773 AAAGAGAAAAGGAATAAAGAGGG - Intronic
1018214566 6:161514446-161514468 ATGGGGAAAAAGGGTGAAGAAGG + Intronic
1018403563 6:163452008-163452030 ATGGAGAAAAAGAATAAATGGGG + Intronic
1020050324 7:5077024-5077046 AGGAAGAAAAGGAAGGAAGAAGG - Intergenic
1020462071 7:8437247-8437269 GGGGTGAAAATGATTGAAGATGG - Intronic
1020985834 7:15133364-15133386 GTGGAGACAATAAAGGAAGATGG + Intergenic
1021123256 7:16820883-16820905 ATGGGGAAAATGATAGATGATGG - Intronic
1021243319 7:18231710-18231732 ATGCAGAAAATTGATGCAGAAGG + Intronic
1021280259 7:18708282-18708304 ATGGAGAAAAAGAGGGAGGAAGG + Intronic
1021300847 7:18971282-18971304 ATAGAGGATATGACTGAAGAGGG + Intronic
1021352907 7:19617175-19617197 ATTAAGAAAATTATTGAAGAGGG - Intergenic
1021595464 7:22311925-22311947 TTTGAGAATATGAATTAAGATGG - Intronic
1021741817 7:23694212-23694234 ATGGAGAATATGACAGAATATGG - Intronic
1021882480 7:25108112-25108134 AAGGACAAAATGACTGAAAACGG + Intergenic
1022081730 7:27029199-27029221 ATGGAGAAAAAAAAAGAACAAGG - Intergenic
1023353993 7:39349310-39349332 GTGAAGAAAAGGAAGGAAGAAGG - Intronic
1024157625 7:46640679-46640701 AAGGAGGAAAAGAGTGAAGAGGG + Intergenic
1024341200 7:48262576-48262598 ATAGATAAAATGAATGGAAAAGG - Intronic
1024431624 7:49294945-49294967 AAGGAGAATCTGAAAGAAGAAGG + Intergenic
1024502471 7:50125825-50125847 GTGGAGAAAATGAAAGATGTTGG + Intronic
1025832296 7:65063062-65063084 ATGGGCAAAATGCATGAGGATGG + Intergenic
1025902065 7:65752579-65752601 ATGGGCAAAATGCATGAGGATGG + Intergenic
1026002962 7:66577054-66577076 AAGGAGGGAATGAATGAGGAAGG + Intergenic
1026533048 7:71216872-71216894 AAGGAGAAAATAAATGACTAAGG - Intronic
1026540510 7:71275976-71275998 ATGAAGAAAATGAAACAAGTAGG - Intronic
1026680224 7:72461027-72461049 ATGGAGAGAAGGAAGGAGGAAGG - Intergenic
1027400763 7:77803971-77803993 ATGAAAAAAATAAATGAAGTAGG + Intronic
1027636362 7:80680293-80680315 ATATAGAAAGTGAATGAGGAAGG + Intergenic
1027807820 7:82852024-82852046 ATGGAAGAAAGGAAAGAAGAAGG + Intronic
1027865194 7:83637535-83637557 ATGGAGGTAATGAATTATGAAGG + Intronic
1028161741 7:87493592-87493614 ATGGAGACATGGAATAAAGAAGG + Intergenic
1028270971 7:88788548-88788570 ATAGAGAAAATGACTTCAGATGG - Intronic
1028290588 7:89059909-89059931 CTGGAGAGAATGAATACAGAAGG + Intronic
1028387224 7:90269756-90269778 GTGAAGAAAAAGAAAGAAGATGG + Intronic
1028460824 7:91090191-91090213 ATTGAGAAAATCAATGAATGTGG - Intronic
1028765233 7:94549498-94549520 ATCCAGAAAATAAATTAAGATGG - Intronic
1029165277 7:98584864-98584886 AAGGAGAAAAGGAAGGAAGGAGG - Intergenic
1029446193 7:100614066-100614088 AGAGAGAAAATGAATGCTGAGGG + Intronic
1029815211 7:103086890-103086912 ATGGAGAATAAGACAGAAGAGGG + Intronic
1029853638 7:103490523-103490545 AGGGAGAAAAGGAGGGAAGATGG + Intronic
1030254316 7:107490903-107490925 ATGGAAAAAATTTATGAATACGG + Intronic
1030324160 7:108202586-108202608 ATGGAATAAGTAAATGAAGAGGG - Intronic
1030671662 7:112344976-112344998 ATGGAGACAATGAATGATAATGG - Intergenic
1030804807 7:113902937-113902959 CTGGAAGAAATGAATGATGAAGG - Intronic
1030955696 7:115849245-115849267 ATGGACAAAATTAATGACTAGGG + Intergenic
1030957884 7:115877806-115877828 ATGCAGAAAAACAATGAAGTCGG + Intergenic
1031044217 7:116869445-116869467 ATTTAGTAAATGAATGAAGATGG - Intronic
1031062525 7:117067939-117067961 ATGGAGAAATTTCATGAAGCTGG + Intronic
1031097659 7:117440754-117440776 ATAAAGAAAGTGAATGATGATGG - Intergenic
1031494299 7:122427297-122427319 ATGTAGAAAATGAACTAAAATGG + Intronic
1031949042 7:127872838-127872860 ATTGGGAAAATGAATGTAGTTGG + Intronic
1032030607 7:128480163-128480185 ATGGAGATAATGTATGTAAAAGG + Intronic
1032183984 7:129707328-129707350 CTGGAGAAAATGAAATGAGAAGG - Intronic
1033107605 7:138543157-138543179 ATGGAGAAAATAAAAATAGATGG + Intronic
1033603111 7:142903460-142903482 AGGGAAAAAATGAAAGAAAAAGG + Intergenic
1033895237 7:146061061-146061083 ATGGAGAAAGACAGTGAAGATGG + Intergenic
1033907360 7:146222007-146222029 AAAGAGAAAAGGAAGGAAGAAGG + Intronic
1034312875 7:150105066-150105088 AAAGAAAAAAAGAATGAAGAAGG - Intergenic
1035122701 7:156581615-156581637 ATGGAGATAAAGCATCAAGATGG - Intergenic
1035743593 8:1946177-1946199 ATGGAGGAAAGAAATGAGGAGGG + Intronic
1036111478 8:5907586-5907608 AGGGAGAAAGTGAAGGAGGAAGG + Intergenic
1036652768 8:10655587-10655609 GTGGAGAAAATGGCTGAGGACGG - Intronic
1037147131 8:15585990-15586012 CTGAAGAAAATCAGTGAAGAAGG + Intronic
1037151718 8:15643586-15643608 ATGAAGAAAATGGATGCACAGGG + Intronic
1037193832 8:16162326-16162348 ATAGAGAAAATGAAATCAGAAGG + Intronic
1037338885 8:17820712-17820734 ATTGAGTAAGGGAATGAAGACGG - Intergenic
1037485479 8:19342848-19342870 ATGGAGAAAGGGAAAGAGGAGGG + Intronic
1038151720 8:24947361-24947383 ACAGAATAAATGAATGAAGAAGG - Intergenic
1038712373 8:29959389-29959411 AAAGAGAAGATGAAGGAAGAGGG + Intergenic
1038730669 8:30124177-30124199 ATGAAGAAAATGCCAGAAGAGGG + Intronic
1039685790 8:39801003-39801025 ATGGAGTAATTGACAGAAGATGG - Intronic
1039703912 8:39988266-39988288 ATGGATACAGTGGATGAAGATGG + Intronic
1039871690 8:41551150-41551172 AAAGAAAAAATGAATGAACAGGG + Intergenic
1040764069 8:50885349-50885371 TTGGAGGAAATGATTGAAAATGG - Intergenic
1040897540 8:52384436-52384458 ATGGAGAGGATGAGTGAAGTGGG - Intronic
1041050320 8:53927804-53927826 AAGGAGAAGATGTATGAAGCTGG + Intronic
1041097173 8:54361598-54361620 AAGGAGAAAAGGAAGGAAGAAGG - Intergenic
1042819709 8:72916671-72916693 ATGAATGAATTGAATGAAGATGG + Intronic
1043035770 8:75196998-75197020 ATGGACAAAATGAAGAAAGGAGG - Intergenic
1043223232 8:77692784-77692806 ATGAAGAAAATGGAAGAAAAAGG + Intergenic
1043271312 8:78337467-78337489 ATGAAAAAAATCAATGAATATGG + Intergenic
1043322175 8:79001299-79001321 ATGAAGAAAATCCATGGAGACGG - Intergenic
1043322223 8:79002304-79002326 TTAGTGAAAATGAATGAAGCAGG - Intergenic
1043722040 8:83557350-83557372 ATGGAAATAAAGAATGAAGTTGG - Intergenic
1043799651 8:84591771-84591793 ATGGGGAAAAAGAAAGAACACGG + Intronic
1044386310 8:91592775-91592797 ATAGAAAGAATGAAAGAAGATGG - Intergenic
1044471592 8:92575511-92575533 ATGGAGACAATGAAGGAAGAAGG - Intergenic
1044734686 8:95268060-95268082 ATGGAGAGAAGGAAGGTAGACGG + Intronic
1044785000 8:95783985-95784007 ATGGGGAGAACGAATGAAAAAGG + Intergenic
1045617731 8:103938121-103938143 ATGTGGAGAATGATTGAAGAGGG + Intronic
1045625459 8:104042977-104042999 ATGTTGAAAATGATTAAAGACGG + Intronic
1045718612 8:105078785-105078807 AGGGAGAAATTGATTAAAGAAGG + Intronic
1045833326 8:106490712-106490734 ATGGTGAGAAGGACTGAAGATGG + Intronic
1046106262 8:109670785-109670807 ATGGAAGAAATGAAGGGAGATGG - Intronic
1046506296 8:115142030-115142052 TTGGAGAAAATGGGGGAAGAAGG + Intergenic
1046690374 8:117277372-117277394 ATCCAGAAAATGATAGAAGATGG + Intergenic
1047099612 8:121662281-121662303 AGGGAGAAAATGAATTCTGATGG + Intergenic
1047530921 8:125674580-125674602 GAGGAGAAGATGTATGAAGATGG - Intergenic
1048039210 8:130709173-130709195 ATGGAGAATTAGAATGAGGAGGG + Intergenic
1048828364 8:138451954-138451976 AAGGTGAAAAAGAATGAAGGAGG - Intronic
1049186874 8:141259874-141259896 ATGAAGCGAATGAATGAATAAGG + Intronic
1050824406 9:9927375-9927397 ATGGTGAATTTGAATGTAGAGGG - Intronic
1050860134 9:10418510-10418532 ATGGAGAAAATTACAGCAGAAGG - Intronic
1051432586 9:16995262-16995284 ATGGAGAAAGTTAAAGAAGGTGG - Intergenic
1052231741 9:26162377-26162399 ATAGAGAATTTGACTGAAGATGG + Intergenic
1052358080 9:27527049-27527071 ATGGTGAAAATGAATGTAAAAGG - Intronic
1052650505 9:31295343-31295365 ATGAATAAAATGAATCGAGACGG + Intergenic
1053326419 9:37156258-37156280 CTGGAGAAAATTCATGAAAATGG - Intronic
1053508028 9:38661514-38661536 AGGGAGAAAAGGAAGGATGAAGG + Intergenic
1054925215 9:70581907-70581929 AAGGAGGGAAGGAATGAAGAAGG - Intronic
1055133336 9:72801080-72801102 TTGGAGAAAATCAAAGCAGAGGG - Intronic
1055177336 9:73336259-73336281 AGGGGGAAAAGGAAGGAAGATGG - Intergenic
1055235803 9:74121617-74121639 ATTGAAATATTGAATGAAGAAGG - Intergenic
1055648740 9:78386438-78386460 CGGGAGGAAAAGAATGAAGATGG - Intergenic
1055656126 9:78452091-78452113 ATGGAGAACATCACAGAAGAAGG - Intergenic
1055688796 9:78807949-78807971 AGGGAGAAAATAAATGGGGAGGG - Intergenic
1055767765 9:79683223-79683245 AAGGAGAATAGGAATGGAGAAGG - Intronic
1056575841 9:87855731-87855753 CTGGAGAATATGAATGTAGCCGG + Intergenic
1056710705 9:88990524-88990546 AAGGAGAAAATTAAAGAAAAAGG - Intergenic
1056801355 9:89694276-89694298 ATGCAGAAACTGGATGAACAGGG + Intergenic
1056998370 9:91484830-91484852 ATGGAGAAAATCAATCAGGGAGG + Intergenic
1057492360 9:95530923-95530945 GTGGAGATAATGAATGAGAATGG + Intergenic
1057761411 9:97877655-97877677 CTGGAGAAGAAGAAAGAAGATGG + Intergenic
1058805744 9:108589800-108589822 ATGGAGAACAAGAGTGAAGAAGG + Intergenic
1058978622 9:110148451-110148473 AAGGAGGAGATGAAAGAAGAAGG + Intronic
1059147679 9:111916325-111916347 ATGGGGAAAGTGAAAGAGGATGG - Intronic
1059187894 9:112293227-112293249 AAGGAGGAAATGAATGAAAAAGG + Intronic
1059521335 9:114944886-114944908 ATGAAGGAAATTTATGAAGAGGG + Intergenic
1059556333 9:115284320-115284342 AGGAAGAAAATGAAAGAACATGG + Intronic
1059669541 9:116479278-116479300 ATGAAGAAAGGAAATGAAGAGGG + Intronic
1059701560 9:116779824-116779846 ATTTAAAAAATGAATGAAAATGG - Intronic
1060290716 9:122300056-122300078 GTGGAGAAAGGGAAGGAAGAGGG + Intronic
1203654033 Un_KI270752v1:6531-6553 AGGGAGAAAGTGAATAAGGATGG - Intergenic
1185765672 X:2723991-2724013 ATGGAGAGAAGGAAGGAAGGAGG + Intronic
1186312920 X:8339779-8339801 AAGAAGAAAAAGAAAGAAGAGGG + Intergenic
1186386019 X:9110855-9110877 ATGGAAAACATGGATGATGACGG + Intronic
1186470559 X:9818761-9818783 GTGAAGAAAAAGAAAGAAGAGGG - Intronic
1187019761 X:15368792-15368814 AGGAAGAAAGTGAATGAAGCAGG + Intronic
1187254514 X:17630051-17630073 ATGGAGCATATGAATGGATATGG + Intronic
1187264472 X:17718628-17718650 AAGGAAAAAAGGAAGGAAGAAGG + Intronic
1187268477 X:17759069-17759091 ATGGGGAAAAAGAATGAAAAAGG - Intergenic
1187521736 X:20020270-20020292 ATGGAAAACATGCATGCAGAAGG - Intronic
1187589379 X:20699740-20699762 ATGCAGAAATTGAAGGCAGATGG + Intergenic
1187638320 X:21258842-21258864 ATTGTGAAACTGAAGGAAGATGG + Intergenic
1187948626 X:24450752-24450774 AAGGAGGAAAGGAAAGAAGAAGG + Intergenic
1188042966 X:25391425-25391447 ATGGGGAAAATAAATTAAAAAGG + Intergenic
1188303045 X:28529027-28529049 AGGGAGAAAATGAAAGAGGGAGG + Intergenic
1188841526 X:35023725-35023747 AAGGTGTTAATGAATGAAGATGG - Intergenic
1188970497 X:36609533-36609555 ATGGAATCAATGAAGGAAGAAGG - Intergenic
1188992990 X:36846868-36846890 ATGGAGAAAATGCAAAAACATGG + Intergenic
1189824532 X:44904051-44904073 ATGTAGAAACTGAAAGCAGAAGG + Intronic
1189851378 X:45179524-45179546 AGAGACAAAATGAATGAAAAAGG + Intronic
1190154059 X:47973418-47973440 ATGACGCTAATGAATGAAGAGGG - Intronic
1190417446 X:50193953-50193975 ATGGACAGATTGAATGATGAAGG + Exonic
1190589011 X:51978408-51978430 ATGGAGAATATGTGTGAAAAGGG + Intergenic
1190637146 X:52446480-52446502 ATGGCAAAAAAAAATGAAGAGGG + Intergenic
1190981225 X:55458100-55458122 TTGGAGGAAAGAAATGAAGAAGG + Intergenic
1190987473 X:55515080-55515102 TTGGAGGAAAGAAATGAAGAAGG - Intergenic
1191146810 X:57175118-57175140 AAGCAGAAAGTCAATGAAGAAGG - Intergenic
1191811913 X:65197944-65197966 TTGGAGAAAAAGAGTGAACAGGG - Intergenic
1191997973 X:67116841-67116863 GTAAAGAAAATGAATTAAGAAGG - Intergenic
1192065318 X:67879224-67879246 ATGGAGACATGGCATGAAGACGG + Intergenic
1192439461 X:71164102-71164124 ATGAAGACAATGAAGGCAGAGGG - Intronic
1192502398 X:71662676-71662698 AGGGAGAAAAGCACTGAAGAAGG + Intergenic
1192838493 X:74828062-74828084 ATGGAAACAAGGGATGAAGATGG + Intronic
1192850902 X:74954657-74954679 ATGAATAAAATGAAGCAAGAAGG + Intergenic
1193365041 X:80622400-80622422 ATGGACAAACTGAAAGAAGTAGG - Intergenic
1193656678 X:84206748-84206770 CAGGAGAAAATAAAGGAAGAGGG - Intergenic
1193823095 X:86190467-86190489 TTAGTGGAAATGAATGAAGAAGG - Intronic
1194354156 X:92860142-92860164 ATGAAGGACATGAATGAAGCTGG + Intergenic
1194487479 X:94503251-94503273 ATGCAGAAAATGAATTACAAGGG - Intergenic
1194701672 X:97120833-97120855 ATGGGGGAAATGGATGGAGATGG - Intronic
1194773340 X:97931806-97931828 ATGGTGAATATAAATGATGATGG - Intergenic
1194852098 X:98881957-98881979 ATGGAGAAACTGATGGAAGTAGG + Intergenic
1194975168 X:100387727-100387749 AAGGACAAAAAGAATGAAAAAGG + Intronic
1195052037 X:101105929-101105951 AGGGAGAAAAGGAATTAAGGAGG - Intronic
1195530565 X:105950500-105950522 ATGGAGAAAATAAAGGAAAAAGG + Intronic
1195593601 X:106661544-106661566 AAGGAGAGAAGTAATGAAGAAGG + Intronic
1195718957 X:107847511-107847533 ATGAAGAGAATGAATTAAAAAGG + Intronic
1196205205 X:112931519-112931541 ATGGTGAACAAGAAAGAAGATGG - Intergenic
1196392787 X:115226162-115226184 AGTGAGAAAGTGAATAAAGATGG + Intronic
1196558386 X:117118772-117118794 ATGGAGGAGATGAGTGAAAACGG - Intergenic
1196733517 X:118964193-118964215 AGGGAAAAAATGACTGAGGAAGG - Intergenic
1197296628 X:124727121-124727143 ATGCTAAAAATCAATGAAGATGG + Intronic
1197711547 X:129674690-129674712 ATGGAGAAAAAGAAAGAAAAGGG - Intergenic
1197859658 X:130956800-130956822 TGAGAGAAAATGAATGAAGAGGG + Intergenic
1197903268 X:131395888-131395910 GTGGAGAAAATGGATGAATAAGG + Intronic
1198067909 X:133118278-133118300 ATGGAGGAATTGCATGAGGAAGG + Intergenic
1198140871 X:133802004-133802026 ATGGCGAACAGAAATGAAGAGGG - Intronic
1198175866 X:134153834-134153856 ATGAAGGAAATGAAAGAAAAGGG + Intergenic
1198520801 X:137450453-137450475 ATGGAGAAAAAAAGAGAAGAGGG - Intergenic
1198745463 X:139885573-139885595 ATGGATAAAAGAAATGAAGTAGG - Intronic
1198977886 X:142357788-142357810 AATGAGAAAATGCATGAACAAGG - Intergenic
1199028292 X:142965552-142965574 GTGCAGAAAATGAATTAGGAGGG - Intergenic
1199034393 X:143033230-143033252 CTGGAGAAAATGAGAGAATAAGG + Intronic
1199073939 X:143509520-143509542 CTGGAGAAGATGAAAGAATAAGG - Intronic
1199337248 X:146632713-146632735 AAGGAGAAAAGAAATAAAGATGG - Intergenic
1199387873 X:147243980-147244002 ATGGAGAAAAAGAAGAAGGAAGG - Intergenic
1199409748 X:147507470-147507492 AAGGAGAAAAGGAATTAAGTAGG - Intergenic
1200006285 X:153087128-153087150 ATGGAAAAAAAGAAAGAAAAAGG - Intergenic
1200374101 X:155760989-155761011 TGGGAAAAAATAAATGAAGAAGG - Intergenic
1200662509 Y:5977163-5977185 ATGAAGGACATGAATGAAGCTGG + Intergenic
1200735543 Y:6789851-6789873 TTGGAGAACATGGATGAAGTTGG + Intergenic
1200761108 Y:7039907-7039929 ATGGAGAAAATGTCAGAAGCAGG - Intronic
1200772137 Y:7136007-7136029 ATGAATAAAATGAAGCAAGAAGG + Intergenic
1201369287 Y:13243783-13243805 TTGGAGAAAATGAATGGAAGTGG + Intergenic
1201412539 Y:13714977-13714999 ATGGAGAGAATGAATGAATTAGG - Intergenic
1201467494 Y:14299547-14299569 CTGAAGAAAATAAAAGAAGATGG + Intergenic
1201490208 Y:14532809-14532831 ATAGAGAAAAAGAAGGAAGGAGG - Intronic
1201516497 Y:14824082-14824104 GTGGAGAGAGAGAATGAAGAAGG + Intronic
1202576619 Y:26333811-26333833 ATGGAGAAAACGAGAGAAAAGGG + Intergenic