ID: 954011229

View in Genome Browser
Species Human (GRCh38)
Location 3:47640744-47640766
Sequence TTTGATTCACAAATCAAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 327}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954011223_954011229 8 Left 954011223 3:47640713-47640735 CCCCTACCTCAGTCTATGATACC 0: 1
1: 0
2: 1
3: 7
4: 123
Right 954011229 3:47640744-47640766 TTTGATTCACAAATCAAACAGGG 0: 1
1: 0
2: 2
3: 23
4: 327
954011224_954011229 7 Left 954011224 3:47640714-47640736 CCCTACCTCAGTCTATGATACCA 0: 1
1: 0
2: 2
3: 120
4: 1302
Right 954011229 3:47640744-47640766 TTTGATTCACAAATCAAACAGGG 0: 1
1: 0
2: 2
3: 23
4: 327
954011225_954011229 6 Left 954011225 3:47640715-47640737 CCTACCTCAGTCTATGATACCAG 0: 1
1: 0
2: 7
3: 202
4: 1874
Right 954011229 3:47640744-47640766 TTTGATTCACAAATCAAACAGGG 0: 1
1: 0
2: 2
3: 23
4: 327
954011226_954011229 2 Left 954011226 3:47640719-47640741 CCTCAGTCTATGATACCAGTATA 0: 1
1: 0
2: 1
3: 10
4: 112
Right 954011229 3:47640744-47640766 TTTGATTCACAAATCAAACAGGG 0: 1
1: 0
2: 2
3: 23
4: 327

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954011229 Original CRISPR TTTGATTCACAAATCAAACA GGG Intronic
901063063 1:6482338-6482360 CTTAATTCATAAATGAAACAAGG - Intronic
901935858 1:12626254-12626276 TTTGTCTCAAAAAACAAACAAGG + Intergenic
904804395 1:33120546-33120568 TTTGATTCACAAAGCAGCCTGGG + Intergenic
905269177 1:36775731-36775753 TTTTATTCACAAATTAAGAAAGG - Intergenic
908364606 1:63407005-63407027 TCTGTTACACAAATCAAGCAGGG - Intronic
909403955 1:75265270-75265292 TTTGATACCAAAACCAAACAAGG + Intronic
909829420 1:80167637-80167659 CTTGTTTCACAAACCAATCATGG - Intergenic
910621150 1:89256208-89256230 TTTTATTAACAAATGAAGCAAGG + Intergenic
911038539 1:93574323-93574345 TTTGATTCTCAAATGCAAGAAGG + Intronic
912197495 1:107415649-107415671 TTTTTTTCACAAATCAACTAGGG - Intronic
913184398 1:116355891-116355913 TTTGATTCAGAAAACACACAAGG - Intergenic
916894538 1:169148857-169148879 TTTGATCCACATATCAAGTAAGG - Intronic
918025831 1:180744975-180744997 TTGAAATCACAAATCACACAAGG - Intronic
918563305 1:185895607-185895629 TTTCATTTACAAAACAAGCAAGG + Intronic
918668532 1:187182546-187182568 CTTGATACTCAAATCAAACAAGG + Intergenic
918760547 1:188399380-188399402 TCTGATTCCCAAACCAGACAAGG + Intergenic
919314796 1:195958091-195958113 TTTTTTTCAGAAATCACACATGG + Intergenic
921643108 1:217580186-217580208 TTTGATGCACAAATTTAACTTGG + Intronic
921662320 1:217819387-217819409 TTTGAGTCAGAAATGAAAGAAGG - Intronic
922641910 1:227242335-227242357 CCTGATTCACAAACCAGACAAGG + Intronic
923444732 1:234059020-234059042 TTAGAATCAGAAATGAAACAAGG - Intronic
924084137 1:240431536-240431558 TTTAGTTCAGAAATAAAACAAGG - Intronic
924244671 1:242072720-242072742 TGAGACTCACAAATCATACATGG - Intergenic
1064094157 10:12410613-12410635 TTTGTTTCACAGATCAATGAAGG + Intronic
1066990290 10:42506593-42506615 ATTGATTTGCAAATCAAAGAAGG - Intergenic
1067410230 10:46058065-46058087 CTTTATTTACAAAACAAACAGGG - Intergenic
1068166244 10:53336119-53336141 ATTGATTTGCAAATCAAAGAAGG - Intergenic
1068177893 10:53485650-53485672 ATTGATTTGCAAATCAAAGAAGG - Intergenic
1068177894 10:53485655-53485677 TTTGATTTGCAAATCAATAAAGG + Intergenic
1068559002 10:58491796-58491818 ATACATTGACAAATCAAACAAGG + Intergenic
1071426937 10:85566723-85566745 TTTAAATAACACATCAAACAGGG + Intergenic
1071586403 10:86826387-86826409 TTTGATCCAGAAACCAATCAAGG + Intronic
1073873823 10:107898361-107898383 TTGGATTCATGAATGAAACAGGG - Intergenic
1073930094 10:108566164-108566186 TATGATTGACACATAAAACATGG - Intergenic
1074752860 10:116603567-116603589 GTTAATCTACAAATCAAACAAGG - Intronic
1075165636 10:120065776-120065798 TTTGAATCATGATTCAAACAAGG + Intergenic
1075643893 10:124085023-124085045 TTCCATGCACAAAGCAAACAGGG + Intronic
1076184719 10:128437395-128437417 TGTGATTCACAGATCAGTCAAGG - Intergenic
1078424320 11:11237018-11237040 CTTGCTTCATAAATAAAACAAGG + Intergenic
1078808478 11:14732607-14732629 TGTGTTTGCCAAATCAAACAGGG + Intronic
1080197685 11:29631354-29631376 TTTGATTCTCAAAACAACCGTGG - Intergenic
1080727726 11:34915101-34915123 TAGGATTCTCAAACCAAACATGG - Intronic
1081714569 11:45239707-45239729 TTTGATTCAGTACTCAAGCAAGG + Intergenic
1082301709 11:50513899-50513921 ATTGATTTGCAAATCAAAGAAGG + Intergenic
1082308477 11:50614589-50614611 TTGAATTCACACATCAGACAGGG + Intergenic
1085968429 11:81557086-81557108 TTTTATTCTCACATGAAACAGGG + Intergenic
1087311077 11:96544763-96544785 TTTGATTCACAAAGAAAATATGG - Intergenic
1087935766 11:104033182-104033204 TTTGAATCACAAATCATGCTGGG + Intronic
1088090935 11:106038618-106038640 TTTGATTTACATTTCTAACATGG + Intergenic
1088142635 11:106635849-106635871 TTTAATTCTCAAACCAAGCAGGG + Intergenic
1088162966 11:106895857-106895879 ATAGATTCACAAATCAAGCCGGG + Intronic
1089985757 11:122811678-122811700 TTTGAGAAACAAATCAATCATGG + Exonic
1091004138 11:131937104-131937126 TTTGATACACAATACAGACAGGG - Intronic
1092729625 12:11517313-11517335 TTTCATTTAAAAATGAAACAAGG + Intergenic
1092804098 12:12203216-12203238 TTTCATCCACAAATCAAATCTGG - Exonic
1093841170 12:23902961-23902983 TTTGTGTCATAAATAAAACACGG + Intronic
1094049881 12:26207439-26207461 TTTGATTAAGAAATGAAACATGG - Intronic
1095540880 12:43307418-43307440 TTTGCTTCACACTTCCAACATGG + Intergenic
1095608026 12:44093572-44093594 TTGGATTGAGAAATCAAACATGG - Intronic
1095851937 12:46819262-46819284 TTTGAATCAGAATCCAAACAGGG - Intronic
1097475080 12:60044019-60044041 TTTAATTCATATTTCAAACAAGG + Intergenic
1097999929 12:65930210-65930232 TTTTATTTACACACCAAACAAGG - Intronic
1098344151 12:69483792-69483814 TTTGACTCAAAAATCATACCTGG - Intronic
1098656572 12:73038591-73038613 TTTGATTTGCAAATAACACAAGG + Intergenic
1098683228 12:73384700-73384722 TATAATTCACCATTCAAACATGG + Intergenic
1099092506 12:78330851-78330873 TTTGAGGCACAAAACAAACAGGG - Intergenic
1099988681 12:89699377-89699399 TTATCTTCATAAATCAAACACGG + Intronic
1100137729 12:91574434-91574456 TTTGATTGATAAAACAAATAGGG - Intergenic
1100409190 12:94297765-94297787 TTTTATTCGCAATTCAAAAAGGG - Intronic
1100763567 12:97836719-97836741 TTTGATGTTCAAATAAAACACGG + Intergenic
1101098264 12:101366305-101366327 TTATTTTCAGAAATCAAACAAGG + Intronic
1104193365 12:126505700-126505722 TATTTTTCAAAAATCAAACAAGG - Intergenic
1104380394 12:128302316-128302338 TCTGTCTCACAAATCAAATATGG + Intronic
1105238684 13:18588843-18588865 TTTGATACTCAAACCAGACAAGG - Intergenic
1105354198 13:19643630-19643652 TTTTATTCAGAAAACAAATATGG + Intronic
1105993249 13:25644536-25644558 TCTGATGCAAAAACCAAACATGG - Intronic
1106133237 13:26956471-26956493 TTGGTTTCACAAATGATACAAGG + Intergenic
1106298947 13:28445174-28445196 CTAGATTCAGAAATGAAACAGGG + Intronic
1106331927 13:28747416-28747438 TTTAAGTCTCAAACCAAACAAGG - Intergenic
1107005641 13:35607632-35607654 TTTGAATCAGAATTCAAATAAGG + Intronic
1107595385 13:41958575-41958597 TTTGAATCAGAGATCATACATGG - Intronic
1107789214 13:43983932-43983954 GTGGACTCACAAATTAAACAGGG + Intergenic
1108165696 13:47690700-47690722 ATTGACACACAAAACAAACAGGG - Intergenic
1109151348 13:58852231-58852253 TTTGATACACAAAAGTAACATGG + Intergenic
1109554289 13:63951157-63951179 TCTGAGTCACAAAGCAAAGAAGG + Intergenic
1109744596 13:66606946-66606968 TTTGAATCACAAAACACAGAAGG - Intronic
1110194859 13:72777129-72777151 CTTTATTCACAAATCAGCCATGG + Intronic
1110933924 13:81259145-81259167 TCTTATTCACACATCAAATAGGG + Intergenic
1111598542 13:90442218-90442240 TTTGGTTCAAAAAGAAAACATGG - Intergenic
1111907702 13:94274404-94274426 TCAGATTCAAAAATAAAACAGGG - Intronic
1112523302 13:100118336-100118358 TTTGATCCACAGTTCAATCAAGG + Intronic
1112645114 13:101322007-101322029 TTTACTTTACAAGTCAAACATGG + Intronic
1113064760 13:106361439-106361461 TTTGAATCAAAAATCACATATGG - Intergenic
1113164702 13:107426233-107426255 CTTGATTCAAAAGTCAAAGAAGG - Intronic
1114127511 14:19746938-19746960 TTTGATTCTCAAAACAATCTTGG + Intronic
1114539976 14:23447984-23448006 TTATGTTCACAAATCAAGCAAGG + Intergenic
1115874878 14:37849483-37849505 TTTAATTCACTAAACCAACAAGG + Intronic
1116667304 14:47794821-47794843 TTTGATTCCAAAACCAGACAAGG + Intergenic
1116832973 14:49740675-49740697 TTGGATTTACAAATCAAAATAGG + Intronic
1118078680 14:62331593-62331615 TGTAATTCACATAGCAAACATGG - Intergenic
1119084918 14:71730855-71730877 GTTGGGTCACAAAGCAAACAAGG - Intronic
1120046511 14:79813539-79813561 ATAGATATACAAATCAAACAAGG + Intronic
1120069571 14:80088001-80088023 TTTCATACTCAACTCAAACAAGG - Intergenic
1121003653 14:90471910-90471932 TTTGAATTAGAATTCAAACAAGG + Intergenic
1121797413 14:96746624-96746646 TGTGATTCACAAACCCAAGACGG - Intergenic
1123773342 15:23551991-23552013 TTAGATACACAAATAAAAAAAGG - Intergenic
1123799424 15:23804833-23804855 TTTAATTTACTAATCATACAAGG + Intergenic
1124472885 15:30003831-30003853 TTTGAATCAAAAATCAGAAAAGG + Intergenic
1125463680 15:39930058-39930080 TTTGAATCAAAATTCAAACAAGG - Intergenic
1125900857 15:43345564-43345586 TTTGATTCAGGATCCAAACAAGG - Intronic
1126330203 15:47523379-47523401 TTTGATTCACAGCTGAAACTTGG - Intronic
1127420363 15:58799265-58799287 TTTGAGTTAAAAAGCAAACACGG + Intronic
1128884944 15:71278108-71278130 AATGATTCAGAAATAAAACAGGG + Intronic
1128956594 15:71953769-71953791 TTTGGTACATAAAACAAACAGGG - Intronic
1129730793 15:77931359-77931381 TTTCATTCAAATATCAAAAATGG + Intergenic
1129779173 15:78258571-78258593 TTAGATTCAGAAATGAACCATGG - Intergenic
1130240961 15:82190509-82190531 TATGACTCACAAAACAAACATGG - Intronic
1130324374 15:82867569-82867591 TTTGATTTACATTTCCAACAAGG - Intronic
1130520051 15:84655148-84655170 TTTTATTCACCAATTCAACAGGG + Exonic
1131158454 15:90089381-90089403 TATGATTCCCACATCACACATGG + Intronic
1131442219 15:92467656-92467678 TTTGATTGACAAAGGAATCAAGG + Exonic
1131765608 15:95672426-95672448 TTTGACTCAGAAATCATATAAGG - Intergenic
1131770541 15:95732167-95732189 TTTGGGTCACAAATTAAATATGG + Intergenic
1132782726 16:1636983-1637005 TTTGCCTCCCAAATAAAACAGGG + Intronic
1134814709 16:17196262-17196284 TTTGAATCAGAACCCAAACAAGG - Intronic
1137740299 16:50764174-50764196 TTTGATTCCAAAACCAGACAAGG - Intronic
1140723766 16:77793601-77793623 TTTGAACCACAAACCAGACAAGG - Intronic
1146926046 17:36746149-36746171 TTTGATTTACAAATCTAATCTGG - Intergenic
1149006144 17:51807695-51807717 ACTGCTTCACAAAACAAACATGG + Intronic
1151063043 17:71118939-71118961 ATTTATTCACAAATCAACTATGG + Intergenic
1151783339 17:76262252-76262274 CTTGAATCACAAATAAAACATGG - Intergenic
1153384793 18:4479883-4479905 TTTGTTTCATAAATTAACCATGG - Intergenic
1153986390 18:10354572-10354594 TTTCCTTCACAAGACAAACAAGG + Intergenic
1154258858 18:12810960-12810982 ATTGAGTAACAAAACAAACAAGG - Intronic
1154397847 18:14008101-14008123 TTTAATAAACAAATAAAACATGG - Intergenic
1154512077 18:15116677-15116699 TTTGATACCCAAACCAGACAAGG - Intergenic
1155490018 18:26391885-26391907 TTTGATTCACAAAGAAAGCTAGG + Intergenic
1158237997 18:55340722-55340744 TTTGAGAAACAAATCTAACATGG - Intronic
1159894791 18:73985908-73985930 TTTGGTCCACATATCACACAGGG - Intergenic
1160285999 18:77544023-77544045 TTTACTTCACAAATAAATCAAGG + Intergenic
1164031681 19:21412536-21412558 TTTGATTTGCAAATCAATAAAGG + Intronic
1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG + Intronic
1167923134 19:52800146-52800168 TTTCAGTCGCAAATCACACATGG - Exonic
1167928245 19:52841015-52841037 TTTCAGTCGCAAATCAAACCTGG - Exonic
925164378 2:1706343-1706365 TTTAAGTCACAAATCGGACACGG + Intronic
925229260 2:2217801-2217823 TGTGATTTACAAATCAGAAATGG - Intronic
925288795 2:2732769-2732791 TTTGATTCACAAATAAACTTAGG - Intergenic
925740388 2:7000408-7000430 TCTGATTGACAAAACGAACACGG - Intronic
926858309 2:17281178-17281200 TTTGACTCAGAAATCAATTAAGG + Intergenic
926974438 2:18499563-18499585 TTTGATTCTCACAGCAATCATGG - Intergenic
927436742 2:23073033-23073055 TTAGATTTATACATCAAACATGG - Intergenic
928819991 2:35350057-35350079 TGTCATTCTCAAATAAAACACGG - Intergenic
930144227 2:47984961-47984983 TTTGACTCAGAAACAAAACAAGG + Intergenic
931801824 2:65766057-65766079 TTTGACTCACAACACAGACAAGG + Intergenic
931919651 2:66999857-66999879 TGTGATTCACTAATCAACTAAGG + Intergenic
932014828 2:68014677-68014699 TTTTCTTAACAAATAAAACAAGG + Intergenic
932445237 2:71776838-71776860 TTTGATTCCCAACTCTACCATGG - Intergenic
933275810 2:80283229-80283251 TTTGAGTCAAAATCCAAACAGGG - Intronic
933845714 2:86325528-86325550 ATTTAATCACAAATCAAATAGGG - Intronic
933985001 2:87583640-87583662 TTTAATCCATAAATCAATCATGG + Intergenic
934889138 2:98050955-98050977 TTTGGTACAAAAATCATACAGGG + Intergenic
936308846 2:111367171-111367193 TTTAATCCATAAATCAATCATGG - Intergenic
937124208 2:119462854-119462876 TTAGACTCACAAGTCAACCATGG - Intronic
938100851 2:128497277-128497299 TTTGCTTCAAAAAACAAAAAAGG - Intergenic
938736382 2:134190311-134190333 CTTGCTACAAAAATCAAACATGG - Intronic
939426453 2:142044201-142044223 TTTAATGCACAAATAAAGCAAGG - Intronic
939709093 2:145492988-145493010 TTTGTTCCACAAATGAAAAAAGG + Intergenic
940205714 2:151199234-151199256 TTTGCTTCAAAAATCAAAGTAGG + Intergenic
940397456 2:153207121-153207143 TTTGAATCACAATCCAAATAAGG + Intergenic
941467795 2:165850708-165850730 TCTGATACACAAACCAGACAAGG - Intergenic
941530341 2:166662334-166662356 TTTAATTTACAAAACAAATATGG - Intergenic
942197281 2:173533725-173533747 TTTGATACCAAAACCAAACAAGG - Intergenic
943269994 2:185787826-185787848 TTTGATTCCCAAATCTAGCTTGG + Intronic
944266839 2:197736737-197736759 TTGAATTTACAAATCAAAAAAGG - Intronic
945630302 2:212266373-212266395 TCTGCATCAAAAATCAAACAAGG + Intronic
945636459 2:212358632-212358654 ATTGATTCATAATTTAAACAGGG - Intronic
945831942 2:214798305-214798327 TGTGATACAAAAATCAGACATGG - Intronic
945874319 2:215262522-215262544 GTCAATTCACTAATCAAACATGG + Intergenic
946876466 2:224134496-224134518 TTTGATTCTCATAGCCAACATGG - Intergenic
947805520 2:232965257-232965279 TTCTATGCACAAATCAAGCAAGG + Intronic
948337065 2:237217869-237217891 TTTGCTTCACATATCCAACTTGG + Intergenic
948457389 2:238111991-238112013 TTTGATACCAAAATCTAACAAGG - Intronic
1169470786 20:5883848-5883870 TTTGAATCAGGATTCAAACAAGG + Intergenic
1169738224 20:8860940-8860962 TTTGTCTGTCAAATCAAACATGG - Intronic
1170250659 20:14277562-14277584 TTTGATTAACTAATGAAACATGG + Intronic
1171032281 20:21688016-21688038 TTTGAATCAGAATTCAAACAAGG + Intergenic
1171193257 20:23176761-23176783 TATTATTCAAAAATAAAACAAGG + Intergenic
1173067403 20:39726601-39726623 ATTGATTTGCAAATCAAATAAGG + Intergenic
1175462920 20:59166974-59166996 ATTTCTTAACAAATCAAACATGG - Intergenic
1176782677 21:13217114-13217136 TTTGATACCCAAACCAGACAAGG - Intergenic
1176951421 21:15051520-15051542 TTTGATTCACAAGTCCATCTAGG + Intronic
1177682511 21:24390863-24390885 TTTGATTCATCAAGCCAACAGGG + Intergenic
1179417100 21:41207800-41207822 TTGGATGCAGAAACCAAACATGG - Intronic
1181118932 22:20652555-20652577 TGTGATTAAAAAACCAAACAAGG + Intergenic
1181982707 22:26777097-26777119 TTTTATGCACAAGTCACACATGG - Intergenic
1181990456 22:26832960-26832982 TTGGATTCAGAAATCAAGCCAGG + Intergenic
1182183267 22:28373844-28373866 TTTGCTTCTGAAAGCAAACATGG + Intronic
1183827768 22:40401815-40401837 GTTGATTCACACAGGAAACATGG - Intronic
949303692 3:2615152-2615174 TTTGCTTCATAAATCAAACAAGG + Intronic
951111018 3:18804394-18804416 TTTGATGCTCAAATAAAAGAAGG - Intergenic
951682828 3:25312313-25312335 TTTGATTCTCAAAACAACCCCGG + Intronic
952077086 3:29710187-29710209 TTCTATTCACAAATCCAAAAAGG - Intronic
954011229 3:47640744-47640766 TTTGATTCACAAATCAAACAGGG + Intronic
955555669 3:60134606-60134628 CTAGATTCACAAATCTTACAAGG + Intronic
956255230 3:67276178-67276200 TTTTTTTCACAAATACAACATGG - Intergenic
956431594 3:69191933-69191955 TATGATTTACAAAGCAGACATGG - Intronic
957231704 3:77526199-77526221 TATTATTCACAATTAAAACAGGG - Intronic
957991549 3:87633671-87633693 TTTGATTTACCAATCAGACATGG + Intergenic
958600511 3:96290146-96290168 TTTGGTTCACAAATGTGACAGGG - Intergenic
959571686 3:107891397-107891419 TTTGATCCACATATCACATAAGG + Intergenic
959620419 3:108393734-108393756 ATTGATTCACAAATGAAAAGTGG + Intronic
960138856 3:114132834-114132856 TTTGAATCAAAATTCAAATAAGG - Intronic
960176002 3:114518419-114518441 TTTGATTTAAAAATGAAACTTGG - Intronic
960409862 3:117309787-117309809 TTTGATTTACTAATCAAATTTGG + Intergenic
963022965 3:140890228-140890250 TTTGAATCAGGAATAAAACAAGG + Intergenic
963389473 3:144640654-144640676 TTTGATTCAGAGATCACCCAGGG - Intergenic
963973607 3:151456357-151456379 TCTGATTTAAAAATCATACATGG + Intronic
964763193 3:160153617-160153639 TTTAATTCACAAATAAGACTTGG - Intergenic
964900432 3:161652849-161652871 TTTGATTTACAAAACAAAAGGGG + Intergenic
965414446 3:168375036-168375058 TTTAATTCAGAAACCAAACAGGG + Intergenic
965777541 3:172247664-172247686 TTTTATTCATAACTCACACACGG + Exonic
966016317 3:175142194-175142216 TTAGATGCACAAATGAAAAATGG - Intronic
967949365 3:194829019-194829041 TTTAAGCCACAAATCCAACAAGG - Intergenic
968203214 3:196774338-196774360 TTTTTTTCACATATAAAACAAGG + Intronic
968623817 4:1617155-1617177 TTATATTTACAAATCAAGCAAGG + Intergenic
970682132 4:18521753-18521775 TTTTTTTCACAAATTAAAAATGG + Intergenic
973060107 4:45713328-45713350 GTTCATTCATAAATCATACATGG - Intergenic
973313428 4:48733901-48733923 TATAATTCACATATCAAAAAAGG + Intronic
974715255 4:65661210-65661232 TTTGAATTAAAAAACAAACATGG - Intronic
974886086 4:67818832-67818854 GATGATTCAGAAAACAAACAGGG - Intergenic
975971425 4:80042858-80042880 TGTGATTCACAAATATAAGAGGG - Intronic
976809207 4:89082358-89082380 GTTGCTCCACAAATTAAACAAGG + Intronic
976963468 4:91007265-91007287 TTTGATTCCAAAATCAGACAAGG - Intronic
977682740 4:99813658-99813680 TTAGATCCAAAATTCAAACAGGG + Intergenic
978829095 4:113061200-113061222 CTACCTTCACAAATCAAACATGG - Intronic
979662251 4:123270506-123270528 CTTGATGCACAAAGCACACAAGG - Intronic
979962707 4:127039784-127039806 GTAGATTCACAAAGCAAAAAAGG + Intergenic
980170022 4:129277933-129277955 TTTTATTTACTAATCAAATATGG + Intergenic
981308960 4:143277158-143277180 TTTTATTAACATATTAAACATGG - Intergenic
982079286 4:151771972-151771994 ATTAATGCACAAATCAAAAAAGG + Intergenic
982973797 4:162026084-162026106 TTTTATTGGCAAATAAAACAGGG + Intronic
985285794 4:188335556-188335578 TTGGATACAGAAATCACACAAGG + Intergenic
985871593 5:2561790-2561812 TTTTATTAATAAAGCAAACATGG + Intergenic
987965983 5:24873307-24873329 TTTGATTCACATATGATAAATGG - Intergenic
991919520 5:71641863-71641885 TTTTGTTCACAAATCAAACTAGG - Intronic
992436940 5:76763470-76763492 TTTTATTTACAAGACAAACATGG - Intergenic
992732522 5:79687679-79687701 TTGAATTCACAAATCCTACATGG + Intergenic
993960017 5:94286509-94286531 GGTGCTTCACAAATCATACAGGG + Intronic
994110441 5:95997196-95997218 TTTGATTCACATATTTACCAGGG + Intergenic
996440084 5:123480292-123480314 TTTGATTAATACAACAAACATGG - Intergenic
996861923 5:128077234-128077256 TTTTATTCAAAAAACAAACAGGG - Intergenic
997011045 5:129877913-129877935 TTAGATTCACAAATGAACAATGG - Intergenic
1000494832 5:161968945-161968967 TTTCATTAAAAAATCAAACGTGG + Intergenic
1000517503 5:162257182-162257204 TTTAATTCATGAATCAAAAAGGG + Intergenic
1002485326 5:179531312-179531334 TTTAATTCTCAAATCAGATAAGG + Intergenic
1002870283 6:1160872-1160894 TAAGATTCTCAAATCACACATGG - Intergenic
1003350322 6:5311245-5311267 TTTGATTCTTAACACAAACAGGG - Intronic
1003424731 6:5990823-5990845 CTTGATTAACAAATCAAGGATGG + Intergenic
1004719273 6:18252087-18252109 TCTGATTAACAAATAAAATAAGG + Intronic
1005881577 6:30066512-30066534 TCAGATTTACAAATCAGACATGG + Intergenic
1006463228 6:34176245-34176267 TTTCATTCACTCAGCAAACAAGG + Intergenic
1007046619 6:38782206-38782228 TTCGATTCACATGTCAAACAGGG - Intronic
1008359694 6:50600890-50600912 TTAATTTCCCAAATCAAACAAGG + Intergenic
1008441007 6:51531868-51531890 TTTCACTCACAGATCACACAGGG - Intergenic
1009394237 6:63178772-63178794 ATTGATTCCAACATCAAACAAGG + Intergenic
1009500114 6:64402339-64402361 TTTTATTAAGAAATCAAAGATGG - Intronic
1009546435 6:65026203-65026225 TTAGTTTCATAAATGAAACAGGG + Intronic
1009854041 6:69237507-69237529 TTTGTTTAAAAAATCTAACATGG + Intronic
1010339261 6:74728898-74728920 TTTGATTATCATTTCAAACAAGG + Intergenic
1011878844 6:91997599-91997621 TTTTATTCTGAAATGAAACAAGG + Intergenic
1012171272 6:96018923-96018945 TTTGATTAAAGAATCAAATAAGG - Intronic
1012171273 6:96018928-96018950 TTTGATTCTTTAATCAAATAAGG + Intronic
1012638612 6:101580383-101580405 TTTGACTAACAGATCACACATGG - Intronic
1012804063 6:103872811-103872833 TTTGAGTCACAATTCAGCCAAGG - Intergenic
1012934920 6:105357026-105357048 TATAATTCCCAAATCAAAGAAGG - Intronic
1013123358 6:107159896-107159918 CTTGATCCACAAAGCAAAGAAGG - Intronic
1015016588 6:128420400-128420422 GTTGATTCACAGATTAAAGAAGG - Intronic
1015142178 6:129947537-129947559 TTTCATGCACAAACCAAAAATGG + Intergenic
1016618488 6:146080224-146080246 TTACATTCACAATTCTAACATGG - Intronic
1017120559 6:151020062-151020084 TTTGCTTCTCAAAGCAAACTGGG + Intronic
1017443616 6:154487204-154487226 TTTCAATCTCAAATCAAACAAGG - Intronic
1019655015 7:2187746-2187768 TTCAGTTCACAACTCAAACATGG - Intronic
1020681306 7:11240471-11240493 TCTGTTTCACAAATAAAACCAGG - Intergenic
1020768745 7:12359610-12359632 TTGGGTCTACAAATCAAACAAGG + Exonic
1020859145 7:13466681-13466703 TTTTATTGGCATATCAAACAGGG + Intergenic
1021317594 7:19169223-19169245 TTTTATTCACTTATCTAACATGG - Intergenic
1021783047 7:24124912-24124934 TTTTATTCACAAAGGAATCAGGG + Intergenic
1022731529 7:33031285-33031307 TTTGATTAAAAAAGAAAACACGG + Intronic
1024087874 7:45911680-45911702 TTTCATCAACAAATCAGACATGG + Intergenic
1024410473 7:49035663-49035685 TTCAATTCACAAATCATGCACGG - Intergenic
1025162755 7:56678720-56678742 TTTGACTGACAAATCAAAATTGG - Intergenic
1026484370 7:70805374-70805396 TTTGATGCATGAATTAAACAGGG - Intergenic
1027469820 7:78559302-78559324 TTTAATACACAAGTCAACCAAGG - Intronic
1027480448 7:78689449-78689471 TTTGAAAAACAAATCAAACTTGG - Intronic
1027542895 7:79490574-79490596 CTAGTTTCACAAATCAAACTAGG - Intergenic
1027845365 7:83366492-83366514 TTTTTTTCACAAATAAAACACGG + Exonic
1028844824 7:95467966-95467988 TTAGATTCTCAAAGCAAAGAGGG + Intergenic
1030194754 7:106842566-106842588 TTATATTCACAAATCTCACAAGG + Intergenic
1030323594 7:108195665-108195687 TTTTATTCAAAAAACAAACAGGG - Intronic
1030622290 7:111803095-111803117 TTTCAATCACAATTCAAACAAGG + Intronic
1031194361 7:118592813-118592835 TTTAATTTATAAATTAAACATGG - Intergenic
1031281306 7:119804011-119804033 TTTGATTCAATATTAAAACATGG + Intergenic
1032311714 7:130793542-130793564 TTTAATCCACAAAACAAAAACGG - Intergenic
1032393034 7:131568895-131568917 TTTGATTCACAAATCAAGCCCGG + Intergenic
1033786398 7:144736519-144736541 TTTAATTCCCAGATCAAAGAGGG - Intronic
1034309963 7:150078818-150078840 TCTGTTTGATAAATCAAACAGGG + Intergenic
1036196189 8:6717135-6717157 TTTGATTCACAACTAAACCAAGG - Intronic
1037420976 8:18702427-18702449 TATGATTCACAATACAAAAAGGG - Intronic
1040528456 8:48245034-48245056 ATTGATTTGCAAATCAAAGAAGG - Intergenic
1041640433 8:60194109-60194131 TTGCATTCACAAAAAAAACAGGG - Intronic
1041859623 8:62498172-62498194 TTTGTTTGACAAAACAACCAGGG - Intronic
1042738256 8:72012853-72012875 TTTGGTCCACAAAGCAATCAAGG - Intronic
1043079899 8:75753861-75753883 TTTGATCCACAAATAGATCATGG - Intergenic
1043641757 8:82460533-82460555 TTTGCTTATCAAATTAAACAGGG + Intergenic
1045664177 8:104467775-104467797 TTTGCTTCTCAAAGCAAATATGG - Intergenic
1049914198 9:300557-300579 TGTGATTCAAAAAAAAAACAAGG + Intronic
1050996213 9:12220971-12220993 TTGGATTTGAAAATCAAACATGG - Intergenic
1052109942 9:24569124-24569146 TTTGATCCACAAAAGAAACTAGG - Intergenic
1052515509 9:29474022-29474044 TTATATTCACAAAGCAAAAAAGG - Intergenic
1052674014 9:31595892-31595914 TTTTTTTAAAAAATCAAACAAGG + Intergenic
1053469209 9:38333807-38333829 ATTGATTCACAACTCACACTTGG - Intergenic
1055858401 9:80719636-80719658 TTTGATTAATAAAGCAAATATGG - Intergenic
1056034813 9:82593228-82593250 TTTTATTCACAGATCAAATTGGG + Intergenic
1057829259 9:98394476-98394498 TTTGCTTCACACCTCAAAGATGG + Intronic
1058054784 9:100438507-100438529 TCTGATTCACAAATGAAAAAAGG - Intronic
1058167517 9:101636866-101636888 TTTCATTCACAAGTCACACTCGG + Intronic
1058451709 9:105102865-105102887 TTAAATCCACAATTCAAACAGGG + Intergenic
1061115151 9:128605689-128605711 TTTAATTTAAAAATCAAAAACGG + Intronic
1061152056 9:128834397-128834419 TTAGAGTCACAGATCAAACCTGG + Intronic
1062154741 9:135040613-135040635 TATGATTAAAAAATCAAAAAAGG + Intergenic
1062215603 9:135387988-135388010 TTTGGTTTACAAATGAAACGTGG - Intergenic
1185977080 X:4733543-4733565 TTTGATTCATAAACCAAGAATGG - Intergenic
1186048848 X:5567444-5567466 TTTGATTCACAAACTTGACAAGG + Intergenic
1186718589 X:12279058-12279080 TTTATTTAACAGATCAAACAGGG - Intronic
1186926937 X:14343862-14343884 TTTGATCAAAAAATCAAACTAGG - Intergenic
1187595258 X:20764659-20764681 TTTGATTTAAAAATCATTCATGG - Intergenic
1189184480 X:39041403-39041425 TTTAATTCCCAAAGGAAACAGGG + Intergenic
1190182764 X:48207449-48207471 TTTGATTTACAAGTCCTACAAGG - Intronic
1192337425 X:70233893-70233915 TTTGAATCAGAATCCAAACAAGG - Intergenic
1192625360 X:72721581-72721603 TTTGATACTGAAATGAAACAAGG - Intergenic
1193237029 X:79119963-79119985 CTTGATACCAAAATCAAACAAGG - Intergenic
1196037543 X:111162844-111162866 TTTTCTTCAGAAATAAAACAAGG - Intronic
1197656831 X:129125920-129125942 TTTGATTCATAAAACAAATTAGG + Intergenic
1198399493 X:136255309-136255331 TTTGAATAAAAATTCAAACAAGG + Intronic
1198685719 X:139226127-139226149 TTTGATTCAGGATCCAAACAAGG - Intergenic
1199114490 X:143975051-143975073 TATTATTCACATATGAAACAGGG + Intergenic
1199949571 X:152697635-152697657 TCTGCTTCCCAAATCAAACCTGG + Intergenic
1199960104 X:152770812-152770834 TCTGCTTCCCAAATCAAACCTGG - Intergenic
1200017308 X:153177092-153177114 TCTGCTTCACAAATCAACCCTGG + Intergenic
1200863770 Y:8020655-8020677 GATGATTCACAATGCAAACATGG + Intergenic
1200874885 Y:8143496-8143518 TATAATTTACAAATCAAACCTGG - Intergenic
1201052968 Y:9958707-9958729 TGTAATTTACAAATCAAACCCGG - Intergenic
1202149778 Y:21834286-21834308 TATGAGGCAAAAATCAAACACGG - Intergenic