ID: 954012521

View in Genome Browser
Species Human (GRCh38)
Location 3:47654603-47654625
Sequence CCCTTGAACTTCTAAGTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 172}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954012521_954012524 1 Left 954012521 3:47654603-47654625 CCACAGACTTAGAAGTTCAAGGG 0: 1
1: 0
2: 0
3: 18
4: 172
Right 954012524 3:47654627-47654649 ATGGCCCCGATTCCTAGCAAAGG 0: 1
1: 0
2: 0
3: 5
4: 51
954012521_954012529 25 Left 954012521 3:47654603-47654625 CCACAGACTTAGAAGTTCAAGGG 0: 1
1: 0
2: 0
3: 18
4: 172
Right 954012529 3:47654651-47654673 TTTTGTTCTGTGTCGCAACATGG 0: 1
1: 0
2: 7
3: 44
4: 476

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954012521 Original CRISPR CCCTTGAACTTCTAAGTCTG TGG (reversed) Intronic
901605236 1:10454097-10454119 CCCCTGAGCTTCCCAGTCTGAGG - Intergenic
903555884 1:24193147-24193169 TCCTTGAACTTCTCAATCTGGGG - Intergenic
905503742 1:38459893-38459915 TCCTTGAACTCCAAAATCTGAGG + Intergenic
907180460 1:52565207-52565229 CCCTTGAACTTAGGAGTTTGAGG + Intergenic
908869421 1:68591687-68591709 CAATTGGATTTCTAAGTCTGAGG - Intergenic
910479468 1:87642569-87642591 CCCCTGGTCTTTTAAGTCTGAGG + Intergenic
910777295 1:90889736-90889758 GCCTTGACCTCCTAAGTGTGGGG + Intergenic
912497697 1:110102065-110102087 CACTTGGCCTCCTAAGTCTGGGG + Intergenic
916023651 1:160815468-160815490 CCCTTGAACTTGGTAGTCAGAGG - Intronic
916975329 1:170071481-170071503 CCCTTGAACTTCCCAGCCTGCGG - Intronic
917062241 1:171053415-171053437 GCCTTGAACATCTAAATCTCTGG + Intronic
917687775 1:177434964-177434986 CCCTGAAACTTCCGAGTCTGAGG + Intergenic
919930259 1:202216761-202216783 CCCTTTAACTTCTCTGCCTGTGG + Intronic
920086967 1:203424487-203424509 CCCTGGAAAGTCTAAGCCTGGGG - Intergenic
921163680 1:212490879-212490901 CCCCTGAGCTGCCAAGTCTGGGG + Intergenic
921259346 1:213371856-213371878 CATTTGAACTTGTGAGTCTGGGG + Intergenic
923020915 1:230163074-230163096 CCCCTGCATTTCTAAGTCAGTGG + Intronic
1065716806 10:28578393-28578415 CACTAAGACTTCTAAGTCTGTGG + Intronic
1068626026 10:59248591-59248613 CCCTTGAATTTCAAAGTCGTGGG - Intronic
1069065336 10:63936624-63936646 ACCTTGGACTTCTCAGTCTCCGG + Intergenic
1069694067 10:70374030-70374052 CCCCTGAACTTCAACCTCTGTGG - Intronic
1072739282 10:97900044-97900066 CCCCTGAGATTCTAAGTCAGGGG + Intronic
1074315751 10:112360300-112360322 CCCTTCAATTTCTAAATCAGTGG + Intergenic
1074410513 10:113224132-113224154 CCCTTCACCTCCTAAGTCTTGGG - Intergenic
1077130734 11:971215-971237 CCTTTCAACTTCTATGTCTGTGG - Intronic
1077770061 11:5207585-5207607 TCCTAGAATTTCTAAATCTGTGG + Intergenic
1078519027 11:12048697-12048719 CCCTTGAATACCAAAGTCTGCGG - Intergenic
1081929670 11:46860149-46860171 CCCTTGAACTCCGGAGGCTGAGG + Intronic
1083744590 11:64728360-64728382 CCCTGGACCTTCTGAGGCTGAGG - Intronic
1085446229 11:76602989-76603011 CTCTTGAACTTCCCAGTCTTTGG - Intergenic
1085703201 11:78763456-78763478 CCCTTGAACTTGAAGCTCTGTGG + Intronic
1088047908 11:105475777-105475799 TCATTGAAATTCTAAGTATGTGG + Intergenic
1091381276 12:62774-62796 CACTTGAACTCCAAAGGCTGAGG + Intergenic
1092523951 12:9298210-9298232 CCCTTGAACTTCTGGAGCTGTGG + Intergenic
1092543319 12:9433604-9433626 CCCTTGAACTTCTGGAGCTGTGG - Intergenic
1094182060 12:27602501-27602523 CCCCAGAACTTCAAGGTCTGAGG + Intronic
1094226272 12:28049570-28049592 CCCTAGAAATTCTAAGGATGAGG + Intergenic
1094509706 12:31088833-31088855 CCCTTGAACTTCTGGAGCTGTGG + Intronic
1095273099 12:40244703-40244725 CCCTTGAACATCACACTCTGGGG + Intronic
1099210287 12:79777921-79777943 ATCTTGAACTTCTAATTCTGTGG + Intronic
1101498383 12:105277839-105277861 CCATGGAACTTCTCAGTGTGAGG + Intronic
1104063993 12:125291419-125291441 CCCTCTAACTTCTCAGTCTCTGG - Intronic
1108470145 13:50759378-50759400 CTCATAAACTTCTAAATCTGTGG - Intronic
1110256637 13:73440571-73440593 TCCTTGGACTTCTGAGGCTGGGG + Intergenic
1111408825 13:87846625-87846647 CACTTGAACTTGGAAGGCTGAGG + Intergenic
1113931271 13:113970206-113970228 CCCTTGATCTTCGGACTCTGGGG + Intergenic
1114330055 14:21627643-21627665 GACTTGACCTTCCAAGTCTGTGG + Intergenic
1115254599 14:31385801-31385823 CACTTCAACTTCCACGTCTGGGG + Intronic
1115538648 14:34397752-34397774 CACTTGAACTTGTAAGGCGGAGG + Intronic
1118504751 14:66399085-66399107 CTGTTTAACTTCTGAGTCTGGGG - Intergenic
1119658154 14:76432110-76432132 CCCTCATACTTCTAAGTCAGTGG + Intronic
1119851817 14:77871673-77871695 CCCTGGGACTTCCAAGTCTCAGG - Intronic
1120230080 14:81832592-81832614 CCCTTGAACATTTAAAACTGTGG - Intergenic
1124161500 15:27274342-27274364 CCCTCGAACTTCTCAGCCTGTGG - Intronic
1124449453 15:29772846-29772868 CCCTTGAACTTAAGAATCTGAGG - Intronic
1125159820 15:36630134-36630156 TCCTTGATCTTCTCACTCTGTGG + Intronic
1125636440 15:41192696-41192718 CCCTTGAACTTGGAAGATTGAGG - Intronic
1126619721 15:50625490-50625512 CCCTTGAACCCCTGAGTTTGAGG - Intronic
1127019657 15:54732053-54732075 CCCTTGAACCACAAAGTCTGCGG + Intergenic
1129403681 15:75300785-75300807 CCCTTAGACTTATAAGTCTATGG - Intergenic
1129940892 15:79495558-79495580 CCCCTGTACCTCTGAGTCTGAGG - Intergenic
1130973695 15:88756383-88756405 CCCCCGAACTTCTGAGTCTAAGG - Intergenic
1130978768 15:88798073-88798095 CCCTTCAATTTCTATGTCTTTGG + Intergenic
1134850661 16:17476054-17476076 TCCTTGAACTTCTAAGCATGGGG - Intergenic
1137459482 16:48647435-48647457 CCCTTGAACTTTTATTTCTAAGG + Intergenic
1138412174 16:56849410-56849432 CCCTTGAGCTTCTATTTCTTGGG + Intronic
1139965472 16:70742682-70742704 CCCTTGAACTTCTCAGGCACTGG + Intronic
1143737161 17:8919971-8919993 CCCTTGAACCTCGGAGGCTGAGG - Intronic
1144327451 17:14195740-14195762 CCCTGGAACTTCTGATTCAGTGG + Intronic
1145230952 17:21172791-21172813 ACCATGAGCTTCTAAGTCTCAGG + Intronic
1146505171 17:33398661-33398683 CCCTTGAACCTCAGAGTCTATGG + Intronic
1151493381 17:74445579-74445601 CCCTGGAACATCTACATCTGTGG - Intronic
1153543071 18:6177910-6177932 CCCTTCCCCTTTTAAGTCTGGGG + Intronic
1154205332 18:12331402-12331424 GCTCTGAACTTCTAATTCTGAGG + Intronic
1155380731 18:25219436-25219458 CCCTTGAACTTCAAACTCAGTGG - Intronic
1156475420 18:37402820-37402842 ACCTTGAACTTGTTAGGCTGTGG - Intronic
1158482175 18:57831527-57831549 CACTTGAACTTGGAAGGCTGAGG + Intergenic
1160066270 18:75576952-75576974 CTCTTGAACTTCTCAGTCATTGG - Intergenic
1161624571 19:5318879-5318901 CCCTTGAATTGCTAAGTGAGAGG + Intronic
1161743906 19:6043059-6043081 CCCTGGAACTTGTGATTCTGGGG - Intronic
1161831806 19:6611297-6611319 GCATCGAACCTCTAAGTCTGAGG + Intergenic
1161930650 19:7337262-7337284 TCCCTGGACTTCCAAGTCTGGGG + Intergenic
1162950223 19:14067670-14067692 CCCTTGAACTTGTGAGGCAGAGG - Intergenic
1163319747 19:16567421-16567443 CACTTGAGCTTCGAAGACTGAGG + Intronic
1164999683 19:32750951-32750973 TCCTTCAGCTTCTAAGTTTGGGG + Intronic
1165149259 19:33751345-33751367 CCCTTGGATGTCTACGTCTGAGG - Intronic
1167303748 19:48695461-48695483 CCCTTGAACTTGTGAGGCGGCGG + Intergenic
1168266248 19:55225270-55225292 GCCCTGGACTTCTGAGTCTGAGG - Intergenic
929183706 2:39070807-39070829 CCTTTTAACTCTTAAGTCTGTGG - Intronic
931922593 2:67037419-67037441 CCCTTAAACTTCTAAGAAAGAGG - Intergenic
932414440 2:71565162-71565184 CCCTTGAACTTGTGAGGCGGAGG - Intronic
932668035 2:73712813-73712835 CACTTGAACCTGTAAGTTTGAGG - Intergenic
933657184 2:84898698-84898720 CCCTTGGATTTCTCATTCTGGGG - Intronic
933869645 2:86553182-86553204 CCCTTGAACTTAAAAGTTGGAGG + Intronic
934913523 2:98279670-98279692 CCCTTGCCCCTTTAAGTCTGGGG - Intronic
936386564 2:112034932-112034954 CCCTTGAACTGCTCAGACTGTGG - Intergenic
940424852 2:153519052-153519074 CCCATTAACTTCTTAGTCTATGG - Intergenic
941564719 2:167092376-167092398 CCAATGAACTTCTATGTCTCTGG + Intronic
941925423 2:170889483-170889505 CCACAGAAATTCTAAGTCTGTGG - Intergenic
941927036 2:170906141-170906163 CCCTTCAGCTTCTCTGTCTGGGG - Intergenic
945855069 2:215059153-215059175 CCCATGTAATTCTAATTCTGGGG - Intronic
947293210 2:228600490-228600512 CTCTTGAACTCCTTGGTCTGAGG + Intergenic
1169015000 20:2284585-2284607 TCCTTGCACTTTTAAGTCTTAGG - Intergenic
1169817698 20:9675123-9675145 GCCTTGCAATTCTCAGTCTGAGG - Intronic
1172071838 20:32263094-32263116 CCCTTGAACCTGGAAGTCAGAGG + Intergenic
1174011022 20:47449731-47449753 CCCTTGAACTTGGGAGTTTGAGG - Intergenic
1176283932 20:64332060-64332082 CACTTGAACTCCAAAGGCTGAGG - Intergenic
1178283967 21:31309372-31309394 CACTTGAACCTCCAAGGCTGAGG + Intronic
1183432610 22:37774791-37774813 CACGTGACCTTCAAAGTCTGAGG + Exonic
952259895 3:31729723-31729745 ACCTTGAACTTAAAAGTCTAAGG - Intronic
953603907 3:44395506-44395528 ACCTTGGAATTCTAATTCTGTGG - Intronic
954012521 3:47654603-47654625 CCCTTGAACTTCTAAGTCTGTGG - Intronic
959091048 3:101903154-101903176 CCCTTGAAGTTGTAAGTTTTAGG - Intergenic
963893916 3:150665302-150665324 GCCTTCAACTTTTAAGTATGTGG - Intronic
965075694 3:163972501-163972523 CCCTTGATCATATAAGCCTGCGG - Intergenic
965639200 3:170814935-170814957 CTCTTGCACATCTGAGTCTGTGG + Intronic
966134831 3:176686435-176686457 CCCTGGCACTTCCCAGTCTGAGG + Intergenic
966385688 3:179395294-179395316 CCCTTAAACTTATGAGTCCGTGG - Intergenic
966413102 3:179663512-179663534 CCCTTGCACTGCTAAGGCTCGGG + Intronic
967426775 3:189336623-189336645 CCCCTGCCCTTCTCAGTCTGTGG + Intergenic
967653530 3:192016780-192016802 CCCTGGGACTTCTCAGTCTTTGG - Intergenic
969060924 4:4433791-4433813 GCCTTGAGCTTCTCAGACTGAGG - Intronic
971142515 4:23939651-23939673 CTCTATAACTTCTAAGTTTGTGG - Intergenic
972581859 4:40402424-40402446 CCCTTGAACCCCTAAGGCGGAGG - Intergenic
974092124 4:57322330-57322352 CCCTGCACCTTCTAAGTTTGAGG - Intergenic
976146551 4:82046848-82046870 TCCTTGAAGCTGTAAGTCTGAGG + Intergenic
981790452 4:148530445-148530467 TCCTTCAACTTTTAAGTTTGGGG + Intergenic
982159840 4:152557039-152557061 CCCTTGAACTTCAGAGGCAGAGG - Intergenic
984298740 4:177888115-177888137 GCTTTGAACTTCTATTTCTGAGG + Intronic
988390979 5:30630711-30630733 TCCTTGAACATCTGAGTCTGTGG - Intergenic
988563839 5:32304636-32304658 ACTTTAAACTTCTAAGTGTGGGG + Intronic
989084972 5:37666280-37666302 ATCTTTAACTCCTAAGTCTGGGG - Intronic
994185614 5:96811741-96811763 CCCTTGAACTTCTAGAATTGTGG + Intergenic
995347034 5:111133186-111133208 CCCTTTTACTTCTAGATCTGGGG - Intergenic
996473493 5:123887589-123887611 CTCTTGAACATCAAAGACTGAGG - Intergenic
999007062 5:147993924-147993946 ACCTTGAATTTTTAAGTCAGAGG - Intergenic
1002434031 5:179220461-179220483 CCCTGGACCTTCTGAGTGTGAGG - Intronic
1003297864 6:4849760-4849782 CCCTTGAACTTTTAAGTGCCTGG - Intronic
1003512646 6:6794165-6794187 CCCTTGAGCTGCTACGTGTGTGG + Intergenic
1004048997 6:12055387-12055409 CCCTTGAACTAGGAAGTCAGAGG + Intronic
1005142563 6:22650027-22650049 CCCTCGAATTTCTCAGTCTGTGG + Intergenic
1007764146 6:44151102-44151124 CTCTTGACCTTATAACTCTGGGG + Intronic
1014609204 6:123520322-123520344 ACCCTGAACTTCTTTGTCTGTGG + Intronic
1015636479 6:135279741-135279763 CCCTTGAGCTACTCAGTTTGGGG + Intergenic
1016891333 6:149010361-149010383 CCCTTGAACCTCAAAGACCGCGG + Intronic
1017325478 6:153136646-153136668 CCCTTGAATTTCCCAGCCTGTGG + Intergenic
1018476903 6:164151367-164151389 CACTTGAAGTTCTACTTCTGTGG + Intergenic
1018478518 6:164167231-164167253 CCCTTCAAGTCCCAAGTCTGAGG - Intergenic
1020020810 7:4867069-4867091 CCCTGGAACTTCTCAGCCTGTGG + Intronic
1021510925 7:21431246-21431268 CTGTTGAACTTTTAATTCTGTGG + Intronic
1021770158 7:23991637-23991659 CGCTTGAGCTTGTAAGGCTGAGG + Intergenic
1022440145 7:30426431-30426453 CCCTGGAACCTCTATGTCTTTGG + Intronic
1022873137 7:34500463-34500485 CTCTTGCACTTCACAGTCTGAGG - Intergenic
1026121935 7:67545380-67545402 CCCTCCAACTTCAAAGTCAGTGG - Intergenic
1028068037 7:86413008-86413030 CTCTGAAACTTCTAAGCCTGTGG + Intergenic
1028758344 7:94464427-94464449 GCCTTTAACTTCTTAGTCTGGGG - Intergenic
1030053844 7:105564169-105564191 CACTTGAACCTCTAAGGCAGAGG - Intronic
1032245483 7:130207742-130207764 TTCTTGGACTTCTAAGTTTGTGG - Intronic
1032315210 7:130831417-130831439 TCCTTAAGCTTCTAAGGCTGTGG + Intergenic
1033528345 7:142239444-142239466 CATTTGAACTTCTAATTCAGGGG + Intergenic
1035272322 7:157727853-157727875 CCCTTGGACCCCTGAGTCTGTGG + Intronic
1037286772 8:17309920-17309942 AACATGAATTTCTAAGTCTGAGG + Intronic
1039831010 8:41214850-41214872 CACTTGAGCTTCCAAGTTTGAGG - Intergenic
1040846333 8:51845894-51845916 CCATTCAACTTTTAAGTCTGAGG - Intronic
1041003734 8:53479212-53479234 CTCTTGAACTTCTCAGCCTGCGG + Intergenic
1042774909 8:72419540-72419562 TCCTTCATCTCCTAAGTCTGGGG + Intergenic
1043291377 8:78605729-78605751 GCCTTGAACTTCTAGATCAGTGG - Intergenic
1044235718 8:89827705-89827727 TTCTTGCACTTCCAAGTCTGAGG + Intergenic
1044949529 8:97421945-97421967 CCCTTCAATTTATAACTCTGGGG + Intergenic
1045499769 8:102736169-102736191 CCCTAGAAATTCTGAGTCTCTGG - Intergenic
1045868889 8:106902803-106902825 CCCTTGAAGTTGTTAGACTGAGG + Intergenic
1046962992 8:120129252-120129274 TCCTTGATCTTCCAAGTCTGGGG - Intronic
1057752094 9:97801389-97801411 CTCTTTTACTTCTAAGTATGTGG - Intergenic
1059202352 9:112429999-112430021 GCCTTGAACTCCTAAGGCTCAGG - Intronic
1061724889 9:132576792-132576814 TCCCTGGACTTCTAAATCTGTGG - Intergenic
1061728161 9:132592703-132592725 CCCGTCAACTGCTAAGGCTGTGG + Intergenic
1185704627 X:2257564-2257586 CCTATGAAGTTCTAACTCTGAGG + Intronic
1186539272 X:10383552-10383574 TCCTTGAACTTCTCAGTATGTGG - Intergenic
1187903243 X:24043878-24043900 CCCCTGAACTTAAAAGTCGGGGG + Intergenic
1187904485 X:24053427-24053449 CCCCTGAACTTAAAAGTCGGGGG + Intergenic
1188849855 X:35118154-35118176 CCCTGGAACTTCAAAGTCAAAGG + Intergenic
1189928074 X:45978193-45978215 TCCTTGAACTTCTCAGCCTGCGG - Intergenic
1191819301 X:65285366-65285388 CACTTGAAGTTCTATGCCTGGGG - Intergenic
1194203448 X:90983181-90983203 CCCTTGCACTTCCCAGCCTGAGG - Intergenic
1195895725 X:109744352-109744374 CTCTTGAAATTCTAAATTTGTGG - Intergenic
1195998359 X:110754604-110754626 ACCTTGAATATCTAAGACTGGGG + Intronic
1196617847 X:117787794-117787816 CCTTTGAATTTCTGAGACTGGGG - Intergenic
1197792083 X:130266325-130266347 CCCCTGAACTCCCAAGTCTCTGG - Intronic
1199457896 X:148049964-148049986 CCCTCAAGCTTCTAAGTTTGGGG - Intergenic
1200549279 Y:4558615-4558637 CCCTTGCACTTCCCAGCCTGAGG - Intergenic
1200760729 Y:7036551-7036573 CCCTTGCACTTTGAAATCTGGGG + Intronic