ID: 954015739

View in Genome Browser
Species Human (GRCh38)
Location 3:47688887-47688909
Sequence GACCCCAAGATTTTACTTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 72}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954015739_954015741 10 Left 954015739 3:47688887-47688909 CCTCTAAGTAAAATCTTGGGGTC 0: 1
1: 0
2: 0
3: 8
4: 72
Right 954015741 3:47688920-47688942 AAGTATTTTGCCGAGCGCAGTGG 0: 1
1: 0
2: 4
3: 43
4: 523

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954015739 Original CRISPR GACCCCAAGATTTTACTTAG AGG (reversed) Intronic
902785974 1:18732994-18733016 GACTCCAAGAATAGACTTAGAGG - Intronic
906721566 1:48009278-48009300 GACACAAAGAATTTTCTTAGTGG - Intergenic
908962127 1:69710695-69710717 AACCCCTAGATTGTACTGAGTGG + Intronic
916608553 1:166366986-166367008 GACCTCAACATTTTATTCAGTGG - Intergenic
918365819 1:183806703-183806725 GACCTCAAGATGTTTCTAAGAGG - Intronic
921828609 1:219701978-219702000 ATCCCCAAGATTTTAGTTAGTGG + Intronic
1065951375 10:30654742-30654764 GGCCCCAAAATTTTAATTTGAGG - Intergenic
1071874412 10:89829302-89829324 GACCTCCAAATTTTACTTTGAGG - Intergenic
1074957380 10:118405554-118405576 GTCCCCAAGATTATCCTTCGAGG - Intergenic
1075850932 10:125586296-125586318 GACCCAATGATTTTACTTCTAGG - Intronic
1079712867 11:23708332-23708354 GACCCCAAGAGCCTGCTTAGTGG - Intergenic
1084927033 11:72522238-72522260 GAGTGCAAGATTTTACTGAGTGG + Intergenic
1087258008 11:95978741-95978763 GATCCCAATATTTTACTTTCAGG + Exonic
1089701279 11:120245616-120245638 GACCCCAAGAGGAGACTTAGGGG + Intronic
1089892547 11:121895933-121895955 TACCCCCAGACTTTGCTTAGTGG + Intergenic
1098153826 12:67576270-67576292 GACCCCAACATTTCACTTCTAGG + Intergenic
1100881084 12:99017474-99017496 GAACCCAAGATTGTATTTTGTGG + Intronic
1105594952 13:21828371-21828393 GAGCCCAAGGTTTTATTGAGAGG - Intergenic
1106863435 13:33936288-33936310 AACCCCTAGATTGGACTTAGAGG + Intronic
1107007916 13:35635529-35635551 AACCCCTACATTTTAATTAGTGG + Intronic
1111443260 13:88309369-88309391 GACCTTAAGAATATACTTAGAGG - Intergenic
1116076619 14:40119303-40119325 TACCCCAATATTTTATTTACTGG + Intergenic
1116385136 14:44320757-44320779 GATCCTAAGATTTGACTGAGAGG - Intergenic
1131449180 15:92525098-92525120 GACACCAAGATTTGTCTTTGTGG + Intergenic
1133909741 16:10054522-10054544 GACCCAGAAATTTTACTTACAGG + Intronic
1135003711 16:18800617-18800639 GAACCAAAGAATTTACTTAGGGG - Intronic
1140180029 16:72706476-72706498 GAGCCTAAGATTTGAGTTAGGGG - Intergenic
1141367712 16:83458547-83458569 GACCACAAGATTTTTTGTAGTGG - Intronic
1151144342 17:72026997-72027019 GACTCCAAAATTTTACTTCCAGG - Intergenic
1156898063 18:42269508-42269530 AACCCCAAGATTTTAATTCATGG + Intergenic
1162177409 19:8841331-8841353 GACCTCAATATTTCCCTTAGAGG - Intronic
1167677338 19:50895445-50895467 GAGATTAAGATTTTACTTAGTGG + Intergenic
930331363 2:49989216-49989238 GACCCCAAGGTTTCACTTGGTGG - Intronic
931104772 2:59043287-59043309 GACCCCAAGATTTTTCAGACAGG - Intergenic
931995694 2:67837213-67837235 GACCCCAAGTTTTTCCCTATAGG - Intergenic
935068439 2:99673280-99673302 GTCCCCAAGATCCTACCTAGTGG + Intronic
935388671 2:102527594-102527616 GACCTCAAAATTTTACTTCTAGG - Intronic
935786907 2:106557740-106557762 AACACCAAGTTTTTACATAGGGG - Intergenic
937456001 2:122042222-122042244 GCCCCCCAGATTTTTCTGAGAGG - Intergenic
937589500 2:123595958-123595980 GACCTCAAAATTTTAATTTGGGG + Intergenic
940654189 2:156468579-156468601 AACCCCAAGATGTAACCTAGAGG - Intronic
946333935 2:219025289-219025311 CACCCCAAGATTCAGCTTAGAGG - Intronic
949202664 3:1397860-1397882 AACCCCATGCTGTTACTTAGAGG + Intronic
949588294 3:5465486-5465508 GACCCCATCATTTTACTGACAGG - Intergenic
954015739 3:47688887-47688909 GACCCCAAGATTTTACTTAGAGG - Intronic
956955979 3:74340506-74340528 GGCCCCAAAATTTTACTGATGGG - Intronic
959583442 3:108004496-108004518 GACTGCAAGGTTTTACTGAGTGG - Intergenic
965614200 3:170576515-170576537 GACCCCATTGTTTTACTTATTGG + Intronic
970782306 4:19752682-19752704 GACCCCAACATTTTAGTTCATGG - Intergenic
970991301 4:22216299-22216321 GGCCCTAAGAATTTATTTAGTGG + Intergenic
972636103 4:40885557-40885579 AACCCCAAGAATGGACTTAGAGG - Intronic
973978676 4:56287738-56287760 AACTCCAAGATTTTACCCAGAGG - Intronic
974340950 4:60614686-60614708 GACCCTAAGATTTTTGATAGAGG + Intergenic
974462042 4:62200825-62200847 GACCCTAAGATTTAAGATAGTGG - Intergenic
975108167 4:70592978-70593000 TAGACCAATATTTTACTTAGTGG + Intronic
977169832 4:93748600-93748622 GAAACCAAGATTTTACTTAAAGG + Intronic
983911910 4:173249364-173249386 GGACACAGGATTTTACTTAGCGG - Intronic
993738261 5:91504006-91504028 GACCCCAAGATGTTGCTCAGTGG - Intergenic
995671213 5:114605064-114605086 GACCCCATGCTTTTGCGTAGAGG - Intergenic
996761241 5:126987865-126987887 AAACCCATGATTTTACTTGGGGG + Intronic
999259912 5:150231860-150231882 TACCCTAAGATTTTTCTTAGTGG - Intronic
1006179819 6:32148144-32148166 GACCCCAAGGTCTTCCTTGGTGG + Intergenic
1006579040 6:35065986-35066008 GAACTCAAGAGTCTACTTAGTGG + Intronic
1007307583 6:40918949-40918971 GAGCACAAGGTTTTACTAAGTGG - Intergenic
1007960664 6:45956271-45956293 GCCCCCAACATAATACTTAGAGG + Intronic
1010166294 6:72918715-72918737 GACCCGAAAATTTTATTTGGTGG - Intronic
1011554203 6:88557580-88557602 GACCCCTAGATTTTTTTTATGGG - Intergenic
1014324905 6:119981627-119981649 GACCTCAAGATTTCACTTCTAGG - Intergenic
1020683829 7:11269203-11269225 AATTCCAAGATTTTGCTTAGAGG + Intergenic
1028299249 7:89176762-89176784 GATCCCAAGTTTTTCCTTGGTGG + Intronic
1032011088 7:128348524-128348546 GAGGCCAAGATTTTGTTTAGAGG - Intergenic
1039653165 8:39366259-39366281 GACCCTAAGATTTTTATTAGAGG + Intergenic
1039944257 8:42116413-42116435 GTCCCCAGGACTTAACTTAGAGG - Intergenic
1040799697 8:51326802-51326824 GACCTCAAGATTTGAATTTGGGG - Intronic
1042428195 8:68673318-68673340 GACCCCAAGAGTCCACTTAGGGG - Intronic
1046499796 8:115060760-115060782 GACCCCAGGAATTTACTATGAGG + Intergenic
1050202142 9:3156989-3157011 GAGTGCAAGATTTTACTGAGTGG + Intergenic
1061348616 9:130046019-130046041 GTTCCCTAGATTTTACTGAGAGG - Intergenic
1189727841 X:43986405-43986427 GAATCCAAGTTTTTACTAAGAGG - Intergenic
1200603236 Y:5232111-5232133 GACCCCAAGAGCTCACTTGGTGG + Intronic
1201460505 Y:14217545-14217567 GACCCCAAAATTTCACACAGAGG + Intergenic