ID: 954025787

View in Genome Browser
Species Human (GRCh38)
Location 3:47781984-47782006
Sequence TGCTACGCATGCGCGTGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 18
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 16}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954025787_954025792 14 Left 954025787 3:47781984-47782006 CCAGCGCACGCGCATGCGTAGCA 0: 1
1: 0
2: 0
3: 1
4: 16
Right 954025792 3:47782021-47782043 CCTTGGAATAGCACGTCCTGCGG 0: 1
1: 0
2: 1
3: 7
4: 62
954025787_954025789 -3 Left 954025787 3:47781984-47782006 CCAGCGCACGCGCATGCGTAGCA 0: 1
1: 0
2: 0
3: 1
4: 16
Right 954025789 3:47782004-47782026 GCACTCGTGCGGCCGTGCCTTGG 0: 1
1: 0
2: 2
3: 3
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954025787 Original CRISPR TGCTACGCATGCGCGTGCGC TGG (reversed) Intronic