ID: 954028664

View in Genome Browser
Species Human (GRCh38)
Location 3:47802974-47802996
Sequence GAGCGGCTACGACGAGTCCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 23
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 20}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954028659_954028664 -5 Left 954028659 3:47802956-47802978 CCGGGCGCTGGGTGCCCCGAGCG 0: 1
1: 0
2: 0
3: 12
4: 131
Right 954028664 3:47802974-47802996 GAGCGGCTACGACGAGTCCCAGG 0: 1
1: 0
2: 0
3: 2
4: 20
954028651_954028664 21 Left 954028651 3:47802930-47802952 CCCATTGGGCCGGGTGCTGGGGC 0: 1
1: 0
2: 2
3: 61
4: 433
Right 954028664 3:47802974-47802996 GAGCGGCTACGACGAGTCCCAGG 0: 1
1: 0
2: 0
3: 2
4: 20
954028646_954028664 27 Left 954028646 3:47802924-47802946 CCGCGCCCCATTGGGCCGGGTGC 0: 1
1: 0
2: 0
3: 6
4: 71
Right 954028664 3:47802974-47802996 GAGCGGCTACGACGAGTCCCAGG 0: 1
1: 0
2: 0
3: 2
4: 20
954028658_954028664 -4 Left 954028658 3:47802955-47802977 CCCGGGCGCTGGGTGCCCCGAGC 0: 1
1: 0
2: 2
3: 17
4: 191
Right 954028664 3:47802974-47802996 GAGCGGCTACGACGAGTCCCAGG 0: 1
1: 0
2: 0
3: 2
4: 20
954028652_954028664 20 Left 954028652 3:47802931-47802953 CCATTGGGCCGGGTGCTGGGGCA 0: 1
1: 0
2: 3
3: 32
4: 373
Right 954028664 3:47802974-47802996 GAGCGGCTACGACGAGTCCCAGG 0: 1
1: 0
2: 0
3: 2
4: 20
954028649_954028664 22 Left 954028649 3:47802929-47802951 CCCCATTGGGCCGGGTGCTGGGG 0: 1
1: 0
2: 2
3: 29
4: 362
Right 954028664 3:47802974-47802996 GAGCGGCTACGACGAGTCCCAGG 0: 1
1: 0
2: 0
3: 2
4: 20
954028644_954028664 30 Left 954028644 3:47802921-47802943 CCGCCGCGCCCCATTGGGCCGGG 0: 1
1: 0
2: 0
3: 9
4: 83
Right 954028664 3:47802974-47802996 GAGCGGCTACGACGAGTCCCAGG 0: 1
1: 0
2: 0
3: 2
4: 20
954028655_954028664 12 Left 954028655 3:47802939-47802961 CCGGGTGCTGGGGCATCCCGGGC 0: 1
1: 0
2: 2
3: 20
4: 242
Right 954028664 3:47802974-47802996 GAGCGGCTACGACGAGTCCCAGG 0: 1
1: 0
2: 0
3: 2
4: 20

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954028664 Original CRISPR GAGCGGCTACGACGAGTCCC AGG Exonic
903071625 1:20729651-20729673 GGGCAGCAACGACGGGTCCCGGG + Intronic
907974159 1:59414706-59414728 GAGGGGCTACGAGCAGGCCCTGG + Intronic
911498897 1:98661916-98661938 GGGCGGCGGCGGCGAGTCCCGGG + Intronic
921945659 1:220884368-220884390 GAGCAGCGACTCCGAGTCCCTGG + Exonic
924415279 1:243850671-243850693 GAGCGGCTTCCCCGCGTCCCCGG + Intronic
1077459048 11:2699703-2699725 GAACGGCGCCGAGGAGTCCCCGG + Intronic
1083276616 11:61600514-61600536 GCGCGGCTAGGATGAGTGCCAGG + Intergenic
1114529637 14:23387800-23387822 GAACGCCTACGAGGAGTCCCTGG - Exonic
1114535001 14:23417195-23417217 GAACGCCTATGAGGAGTCCCTGG - Exonic
1139295775 16:65899303-65899325 GAGTGGCTATGACGAGTCAATGG + Intergenic
1153681195 18:7502441-7502463 GGCTGGCTACCACGAGTCCCGGG + Intergenic
1166762554 19:45234281-45234303 GCGCGGCTACCACGGGGCCCTGG - Intronic
934803346 2:97191256-97191278 GTGCAGCTTCGACGAGCCCCAGG - Intronic
1172702693 20:36862903-36862925 GAGCAGCGACGCCGAGTCCGCGG - Exonic
1176135903 20:63521883-63521905 GAGCGGTTACCACCAGCCCCAGG + Exonic
1183702251 22:39457320-39457342 GAGCGGCCGCGCCGGGTCCCCGG + Intergenic
954028664 3:47802974-47802996 GAGCGGCTACGACGAGTCCCAGG + Exonic
999297085 5:150466396-150466418 GAGGGGCTATGACTTGTCCCAGG - Intergenic
1010974618 6:82297939-82297961 CAGCGGGTACCCCGAGTCCCGGG + Intergenic
1034222009 7:149454120-149454142 GAGGGGCAACTACGAGTCCCTGG - Exonic
1036397429 8:8381252-8381274 GAGCAGCTACAGCGAATCCCAGG + Intronic
1049690112 8:143954567-143954589 GAGCAGCTGCGAAGGGTCCCTGG - Intronic
1189282418 X:39828135-39828157 GAGACGCGATGACGAGTCCCTGG + Intergenic