ID: 954034089

View in Genome Browser
Species Human (GRCh38)
Location 3:47841173-47841195
Sequence CTCAAGGTACAGATGGAGGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 4, 3: 23, 4: 264}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954034079_954034089 8 Left 954034079 3:47841142-47841164 CCCAGCAGGATTCCCACGCTCCA 0: 1
1: 0
2: 1
3: 13
4: 135
Right 954034089 3:47841173-47841195 CTCAAGGTACAGATGGAGGATGG 0: 1
1: 0
2: 4
3: 23
4: 264
954034083_954034089 -4 Left 954034083 3:47841154-47841176 CCCACGCTCCACTCAGGGACTCA 0: 1
1: 0
2: 0
3: 11
4: 101
Right 954034089 3:47841173-47841195 CTCAAGGTACAGATGGAGGATGG 0: 1
1: 0
2: 4
3: 23
4: 264
954034080_954034089 7 Left 954034080 3:47841143-47841165 CCAGCAGGATTCCCACGCTCCAC 0: 1
1: 0
2: 0
3: 11
4: 135
Right 954034089 3:47841173-47841195 CTCAAGGTACAGATGGAGGATGG 0: 1
1: 0
2: 4
3: 23
4: 264
954034076_954034089 26 Left 954034076 3:47841124-47841146 CCGACTTCTTGTCCATGACCCAG 0: 1
1: 0
2: 0
3: 17
4: 250
Right 954034089 3:47841173-47841195 CTCAAGGTACAGATGGAGGATGG 0: 1
1: 0
2: 4
3: 23
4: 264
954034078_954034089 14 Left 954034078 3:47841136-47841158 CCATGACCCAGCAGGATTCCCAC 0: 1
1: 1
2: 3
3: 25
4: 317
Right 954034089 3:47841173-47841195 CTCAAGGTACAGATGGAGGATGG 0: 1
1: 0
2: 4
3: 23
4: 264
954034084_954034089 -5 Left 954034084 3:47841155-47841177 CCACGCTCCACTCAGGGACTCAA 0: 1
1: 1
2: 1
3: 9
4: 109
Right 954034089 3:47841173-47841195 CTCAAGGTACAGATGGAGGATGG 0: 1
1: 0
2: 4
3: 23
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954034089 Original CRISPR CTCAAGGTACAGATGGAGGA TGG Exonic
900534975 1:3172277-3172299 CCCAAGGTACAGAGGCTGGAAGG + Intronic
900731384 1:4263673-4263695 ATCAGGGTACAGAGGGAGGCAGG + Intergenic
900787198 1:4656162-4656184 CTCCAGGGCCAGATGGAAGAGGG + Intronic
901539968 1:9909679-9909701 ATCAAACTACAGAGGGAGGAAGG + Intronic
903126548 1:21252128-21252150 ATCAAGGTACAGATATAAGACGG + Intronic
904999188 1:34654951-34654973 CACAAGGTAGAGAAGCAGGATGG + Intergenic
909921128 1:81381466-81381488 CTCAAGGGACAGAGGCGGGAAGG + Intronic
911458857 1:98162977-98162999 CTCCAGGTGCAGAGGGAGTAAGG + Intergenic
911671199 1:100610195-100610217 CTCAAAGCAGTGATGGAGGAAGG - Intergenic
912944814 1:114076120-114076142 CTCCCGGTAGAGGTGGAGGAAGG - Intergenic
915350071 1:155218715-155218737 AGCAAGGCACAGATGGAGGGAGG - Intergenic
915353469 1:155240953-155240975 AGCAAGGCACAGATGGAGGGAGG - Intronic
915827912 1:159098761-159098783 CACATGGTACATATGGAGTATGG - Intronic
915895343 1:159807576-159807598 CTGAGGGTAGAGATGGAGGCTGG + Intronic
915932111 1:160067258-160067280 TTCAAGGTTCTGATGGGGGAGGG + Intronic
919051085 1:192512399-192512421 CACAAATTAGAGATGGAGGAAGG - Intergenic
920496317 1:206457402-206457424 CTGAAGGTACAGAGGAGGGAGGG + Intronic
922215936 1:223520027-223520049 CTAAAGGTACACATGGAGGAAGG - Intergenic
922352802 1:224748098-224748120 TTCCAGGTACAGGAGGAGGAGGG - Intergenic
1063688359 10:8259926-8259948 CTTATGGTTCAGCTGGAGGAGGG + Intergenic
1063953437 10:11244892-11244914 CACCAGACACAGATGGAGGAAGG - Intronic
1065441858 10:25761316-25761338 CTGAAATTACAGATGGAGGCTGG + Intergenic
1065806536 10:29398369-29398391 CTCAGAGCACAGAAGGAGGACGG - Intergenic
1066262834 10:33745765-33745787 CTCAGGAAACAGATGGAAGAGGG + Intergenic
1067519560 10:46986840-46986862 CTCATGGTACAGAAGAATGATGG + Intronic
1067642687 10:48064999-48065021 CTCATGGTACAGAAGAATGATGG - Intergenic
1067771655 10:49131023-49131045 CTCAAGGTAGAGCAGGAGGCTGG - Intergenic
1068518826 10:58057010-58057032 CTCAAGGTACACTTGGAAGAGGG + Intergenic
1068667790 10:59695835-59695857 CTTTAGGTACATATGGAGGAAGG + Intronic
1068876100 10:61998523-61998545 CTCAAGCTTAAGATGAAGGAAGG + Intronic
1070171007 10:73932604-73932626 CTCAAGGTAGTGACGGGGGAAGG + Intergenic
1071849994 10:89558877-89558899 CTCCCCGTACAGAGGGAGGAGGG + Intergenic
1074207535 10:111297005-111297027 CTCAAGGTAGAGATGAAGGCAGG + Intergenic
1076172162 10:128328565-128328587 CTCAAGGTACAGATGATCGCGGG - Intergenic
1077266306 11:1652417-1652439 CTCAAGGTCCAGACGGGGGCAGG - Intergenic
1078335828 11:10462511-10462533 CCCAAGGCAGAGATGGAGGCAGG + Intronic
1078520842 11:12061696-12061718 CTCAGGGTTCAGAGGGAGCATGG + Intergenic
1079008589 11:16810273-16810295 TTCAAGATCCAGATGAAGGAAGG - Intronic
1079920420 11:26427285-26427307 ATCAAGGTGCAGGTGGAGGGAGG - Intronic
1081098610 11:38972073-38972095 CTCCAGATACAGATGGGAGATGG + Intergenic
1083383171 11:62285360-62285382 CTCAAAGTACAGATAGAGTCTGG + Intergenic
1083824078 11:65188457-65188479 CTCCGGGTCAAGATGGAGGACGG + Exonic
1083957424 11:65992644-65992666 CTAAGGGTACTGATGGAGGTAGG - Intergenic
1084914497 11:72418202-72418224 CACATGGTACAGATGGAGTCTGG - Intronic
1085265541 11:75235961-75235983 AGCAAGGTACAGATGTAGTAAGG + Intergenic
1085508607 11:77074071-77074093 CTTAGGGAGCAGATGGAGGATGG + Intronic
1086212304 11:84335247-84335269 ATGAAGGAACAGAGGGAGGAAGG + Intronic
1086918339 11:92557140-92557162 CAGAAGGTGAAGATGGAGGAGGG - Intronic
1087180129 11:95133817-95133839 CTGAAGGTACAGATGAGGGTTGG + Intergenic
1087424517 11:97970515-97970537 CTGAAGGTGCAGTTGGAGGAAGG + Intergenic
1090716509 11:129436616-129436638 AAGGAGGTACAGATGGAGGAAGG - Intronic
1090758072 11:129812541-129812563 CTCAAGGGAAAGTGGGAGGAGGG + Intergenic
1091301818 11:134512772-134512794 GAAGAGGTACAGATGGAGGAGGG - Intergenic
1091344886 11:134845963-134845985 CTCCAGGTACAGATGGGGAGGGG - Intergenic
1091949310 12:4580016-4580038 CTCATTTTACAGATGGAGAAAGG - Intronic
1092139423 12:6172506-6172528 CTGAAGTTCCAGAGGGAGGAAGG + Intergenic
1092747727 12:11689321-11689343 GTCAGGGTCCAGATGGAGGTGGG + Intronic
1092883904 12:12909166-12909188 CTCAAGGTACAGATGCAGCCTGG + Exonic
1093585229 12:20827961-20827983 CTCAAGGTACAGAGAGAGAGTGG + Intronic
1096975545 12:55697516-55697538 CTCATGGGAGACATGGAGGATGG + Exonic
1097861608 12:64523634-64523656 CTCCAGTTACAGGAGGAGGAAGG - Intergenic
1097945892 12:65366958-65366980 CTTAAGGGACAGGAGGAGGAGGG + Intronic
1098052340 12:66467699-66467721 CTTAAGGAACAGAAGGATGATGG - Intronic
1098292392 12:68968889-68968911 CTAAAGCTCCAGATTGAGGATGG - Intronic
1101557198 12:105821474-105821496 ATCAAGGTACAAGTGTAGGAGGG - Intergenic
1102756344 12:115344149-115344171 CACAAGGTACAGATCTCGGAAGG - Intergenic
1103915100 12:124372136-124372158 CTCAAGGCAGAGAAGAAGGAGGG - Exonic
1106576042 13:30976639-30976661 CTCAAGGCCCTGATGGAGTATGG - Intergenic
1106887948 13:34210446-34210468 CACATGGTACAGAAGAAGGAAGG - Intergenic
1107462412 13:40616845-40616867 CAAAAGGGACAGATGGAGAAAGG + Intronic
1107710102 13:43142939-43142961 CTGAAGGCAGAGATGTAGGAAGG + Intergenic
1111166583 13:84465118-84465140 CTTAAGGTAAGCATGGAGGATGG + Intergenic
1116318980 14:43435578-43435600 CACAAGGTACAGAAAGAGGGAGG + Intergenic
1117872816 14:60218632-60218654 CTCAAGGTACATAAGCAGGTGGG + Intergenic
1121955742 14:98210908-98210930 ATCAGAGTTCAGATGGAGGATGG + Intergenic
1123197698 14:106632017-106632039 GTCAACCTACACATGGAGGAGGG + Intergenic
1123845746 15:24300175-24300197 CTCATGGTACAAATGCAGTAAGG + Intergenic
1123864780 15:24507884-24507906 CTCATGGTACAAATGCAGTAAGG + Intergenic
1124653981 15:31493970-31493992 CTCAAAGCAGAGAGGGAGGAGGG + Intronic
1125097352 15:35870256-35870278 GTCAAAGCACAGATGGGGGAGGG - Intergenic
1125200072 15:37095431-37095453 CTCTAGGGAGAGAGGGAGGAAGG - Intronic
1126108470 15:45162208-45162230 ATCAAGGTACAGCTGTAGGGAGG - Exonic
1127217044 15:56834207-56834229 CTCAAGGTACAGAGGCTAGAAGG + Intronic
1129295808 15:74599457-74599479 CTGAAGGCGCAGATGGAGGGAGG + Intronic
1130059853 15:80561417-80561439 GTCAAGGCACAAATGGAAGAAGG - Intronic
1130102783 15:80906517-80906539 CTCATGTTACAGAAGGATGAAGG - Intronic
1134337641 16:13316057-13316079 CCCAAGCTAAAGATGAAGGATGG + Intergenic
1134890523 16:17837729-17837751 CTCAAGGTTTGGCTGGAGGAGGG + Intergenic
1136104775 16:28022163-28022185 CTCAGGGTAAAGATGGGGGTAGG + Intronic
1137694141 16:50449904-50449926 CTCAAGCTACAGACTGACGAGGG + Intergenic
1138426684 16:56938787-56938809 CTATAGATTCAGATGGAGGATGG + Intronic
1140292512 16:73673876-73673898 CTCCAGATACAGATCCAGGAAGG + Intergenic
1141017597 16:80465213-80465235 CTCAAGGAAGGGATGGAGGAAGG - Intergenic
1142174909 16:88640686-88640708 CTCAAGGCACTGCTTGAGGAAGG - Intergenic
1142201984 16:88765452-88765474 CTCAAGGCACAGAGAGGGGAGGG - Intronic
1143284912 17:5781744-5781766 CTGCAGGTACAGGTGGAGGATGG + Intronic
1143284935 17:5781868-5781890 ATGCAGGTACAGGTGGAGGATGG + Intronic
1143284952 17:5781958-5781980 ATGCAGGTACAGGTGGAGGATGG + Intronic
1143520554 17:7441923-7441945 CTCAAGGGACAAATTGAGGAAGG - Intronic
1144865111 17:18330610-18330632 CCAAAGGCACAGATGGTGGAAGG - Exonic
1145416493 17:22717501-22717523 GGCAAGGGACAGAGGGAGGAAGG - Intergenic
1146271935 17:31490285-31490307 CTACGGGTACAGATGAAGGAGGG - Intronic
1146667837 17:34716587-34716609 CCCAAGTAACAGATGGAAGAAGG - Intergenic
1146730989 17:35193858-35193880 CTCAAGGCAGAGAGTGAGGACGG + Exonic
1148119117 17:45197445-45197467 CTCAGGGTAGAGCTGGAGAAGGG - Intergenic
1148204371 17:45770708-45770730 ACCAAGGTCCAGAGGGAGGAAGG + Intergenic
1148463032 17:47848905-47848927 CTCAGGATACAGATGGGAGAGGG + Intronic
1150501613 17:65656334-65656356 CTCTAGGTACAGATTGATAAAGG - Intronic
1150639903 17:66942518-66942540 CTGGAGGGACAGAGGGAGGAGGG + Intergenic
1151140444 17:71986405-71986427 ATCAAAGTACAGATGGAGAGTGG - Intergenic
1151750186 17:76032746-76032768 CTCTAGGCCCAGCTGGAGGAGGG - Intergenic
1152251609 17:79215473-79215495 CTCAAGGAACAGATGGAGAAAGG - Intronic
1152469606 17:80483354-80483376 CTGAGGGTGCAGAGGGAGGACGG + Intergenic
1153723760 18:7935597-7935619 CTCAAGGTTGCTATGGAGGAAGG - Intronic
1154371090 18:13763809-13763831 CTCAAGCTGCAGGTGGTGGATGG - Exonic
1154506914 18:15050118-15050140 CACAAAGTACAGATGGAGCATGG + Intergenic
1156305265 18:35873345-35873367 CTGATGGCACAGTTGGAGGAGGG - Intergenic
1156585197 18:38424283-38424305 TTCAAGAAAGAGATGGAGGAGGG - Intergenic
1157511174 18:48275987-48276009 CTCAAGATACAGAGGGAGGAGGG + Intronic
1157649221 18:49311176-49311198 CACAAGGCACAGCTGGAGAAGGG + Intronic
1159274014 18:66192307-66192329 ATGAAGCCACAGATGGAGGAAGG - Intergenic
1161465731 19:4429255-4429277 CTGAAGGGACAGATGGAGGAGGG - Intronic
1161682726 19:5687985-5688007 CTCCAGGGACAGTTGGAGGGAGG - Exonic
1162204749 19:9047328-9047350 CTCAAGCTACTGGTGGATGAAGG + Intergenic
1163435540 19:17292973-17292995 CTCAAGGGGGAGCTGGAGGATGG + Intronic
1163821637 19:19499541-19499563 CCCAGGATACAGAGGGAGGAGGG + Intronic
1164500712 19:28817657-28817679 CTGAAGGTAGACATAGAGGAGGG - Intergenic
1166488194 19:43232576-43232598 CAAAAGGCACAGCTGGAGGATGG - Intronic
1166494861 19:43293056-43293078 CAAAAGGCACAGCTGGAGGATGG - Intergenic
1167192976 19:48004589-48004611 CTGGAGGAACAGATGGAGGAGGG - Intronic
1168217878 19:54939680-54939702 CTGAAGCTGCAGATGGAGAAGGG - Exonic
1168224240 19:54982920-54982942 CTGAAGCTGCAGATGGAGAAGGG + Exonic
1168254414 19:55157878-55157900 CTCCAGGATCAGAGGGAGGAGGG - Intronic
926808758 2:16737857-16737879 CTTGATGTATAGATGGAGGAAGG - Intergenic
930234487 2:48875668-48875690 CTTTAGGTAGAGATGGGGGAAGG + Intergenic
930713044 2:54567212-54567234 CTTAAAGTACAGAGTGAGGATGG + Intronic
931202073 2:60106993-60107015 TTCAGGATACAGATGGAGGGAGG + Intergenic
932111312 2:69003708-69003730 ATCAAGGTGAAGATGGTGGATGG - Intergenic
932844243 2:75119078-75119100 CTCATGGAACAGATGCAGCAGGG + Intronic
934525499 2:95049320-95049342 GTCAAGGGAGAGGTGGAGGAAGG - Intronic
938234248 2:129690210-129690232 CTCAAAGTACAGAAGTAAGAAGG - Intergenic
939814216 2:146874108-146874130 CTCAGTGTACAGATGGAGCAAGG - Intergenic
939936178 2:148296648-148296670 CTCGTGGTCCAGATGGAGGCAGG + Intronic
940805936 2:158186479-158186501 CTCAAGTCACAGATTGAGTAAGG - Intronic
942145635 2:173023768-173023790 CTCAAGGAAAAGAAGGAGCAAGG + Intronic
942922240 2:181389577-181389599 CTGAAGAAACAGATGCAGGAAGG - Intergenic
943325458 2:186492121-186492143 CTGTAGTTACAGATGGAGCATGG + Intronic
943808209 2:192150728-192150750 CTCAGGGAACAAATGGAGGATGG + Intronic
944839144 2:203608657-203608679 GTCAAGGTGCAGAGGGAGTATGG - Intergenic
947324931 2:228963579-228963601 CCCAAGGACCAGATGGAGTATGG - Intronic
948870571 2:240795835-240795857 CTCAAGGTTCAGGGGCAGGAGGG + Intronic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1170585946 20:17734123-17734145 CACAAGGACCACATGGAGGAAGG - Intronic
1170781050 20:19425688-19425710 GTCAAGCTACAAATGGAGAATGG - Intronic
1174569274 20:51489629-51489651 CTCAAGGTACAAATGGCACATGG + Intronic
1176185448 20:63775881-63775903 CTCTATGCACAGGTGGAGGAGGG - Exonic
1176790957 21:13318983-13319005 CACAAAGTACAGATGGAGCGTGG - Intergenic
1177963895 21:27703310-27703332 TTCAGTGTACAGATAGAGGAAGG - Intergenic
1178408725 21:32346993-32347015 CTGGAGGTACACATGGATGAGGG + Exonic
1179081882 21:38178977-38178999 CTGAAAGGAAAGATGGAGGATGG - Intronic
1181948774 22:26539397-26539419 AGCAAGGGACAGAGGGAGGAAGG + Intronic
1182100769 22:27655915-27655937 CTAGAGGGACAGATGGATGAGGG + Intergenic
1182294237 22:29303736-29303758 CTCATGGGAGAGAAGGAGGAAGG + Intergenic
1182869255 22:33632026-33632048 CACAAAGTCCAGATGGAGGATGG + Intronic
1183774421 22:39954265-39954287 CTCAAAGTCCAGAAGTAGGAAGG + Intronic
1184034316 22:41911248-41911270 GTCCAGGTGCAGATGGGGGACGG - Exonic
1184457324 22:44618569-44618591 CTCCAGGTGCAGAGGGAGAAGGG + Intergenic
1184629615 22:45765540-45765562 GCCAAGGTGCAGGTGGAGGAGGG - Intronic
1184882119 22:47314356-47314378 CACAAAGGACAGAAGGAGGAAGG - Intergenic
1185157564 22:49203356-49203378 CTCAAGATGCAGAGGAAGGAAGG + Intergenic
952439960 3:33316697-33316719 CTCAAAATACAGGTGGATGAGGG - Intronic
954034089 3:47841173-47841195 CTCAAGGTACAGATGGAGGATGG + Exonic
955294534 3:57722824-57722846 CTCAAAGTAAAGATGGAAGCTGG - Intergenic
955914844 3:63896550-63896572 CTGAAGAAACAGATTGAGGAAGG - Intronic
956656795 3:71560095-71560117 CTTCAGGTACAGATGGAGCCAGG - Intronic
959014897 3:101122681-101122703 CTCATGGTATAGTTGGAGAAGGG + Intergenic
959313452 3:104771493-104771515 CTCAAGGTTCAGTTGGAGCATGG + Intergenic
959392499 3:105793404-105793426 CATAAGGAACTGATGGAGGAAGG + Intronic
961751103 3:129095380-129095402 CCCCAGGGAAAGATGGAGGAAGG + Intronic
962870973 3:139492540-139492562 CACAAGGTACTGCTGGAGAATGG + Intergenic
966721965 3:183072382-183072404 CTCTAATTGCAGATGGAGGAGGG + Exonic
967864246 3:194177331-194177353 TGGAAGGCACAGATGGAGGAAGG + Intergenic
968487886 4:872684-872706 CTCAAGGGGCAGCTGGGGGAGGG - Intronic
968662075 4:1802815-1802837 CCCAAGGTACAGATCGAGGCTGG - Intronic
968730092 4:2265416-2265438 CTCTTGGGACATATGGAGGACGG + Intergenic
970199683 4:13590973-13590995 CTCAAGGGACTGAGGTAGGATGG + Intronic
972874317 4:43339591-43339613 CTCAAGGGTCAAATGCAGGAGGG - Intergenic
973759548 4:54103688-54103710 GTCAAGGGACATAGGGAGGAGGG + Intronic
975736733 4:77388689-77388711 CTGAGGGTAAAGATTGAGGATGG - Intronic
976278734 4:83305677-83305699 CACCAGATACAGTTGGAGGAAGG + Intronic
976639591 4:87323949-87323971 CTCAAGTGGCAGAAGGAGGAAGG + Intergenic
977362688 4:96026199-96026221 GTGAAGGTACAGGTGTAGGATGG - Intergenic
979385293 4:120057738-120057760 CTCAAGGTCTAGAAAGAGGATGG + Exonic
983647133 4:170003420-170003442 CTCAATACACAGATGAAGGAGGG + Intronic
984145141 4:176051293-176051315 CTCAAGGAACTGATATAGGAAGG - Intergenic
985115352 4:186584676-186584698 TTCCAGGTTCAGATGGCGGAGGG + Intergenic
985819869 5:2152331-2152353 CTCATTGCACAGATGGAAGATGG + Intergenic
985819872 5:2152366-2152388 CTCATTGCACAGATGGAAGATGG + Intergenic
985819875 5:2152401-2152423 CTCATTGCACAGATGGAAGATGG + Intergenic
985819878 5:2152436-2152458 CTCACTGCACAGATGGAAGATGG + Intergenic
985819881 5:2152471-2152493 CTCACTGCACAGATGGAAGATGG + Intergenic
985819884 5:2152506-2152528 CTCACTGCACAGATGGAAGATGG + Intergenic
985819887 5:2152541-2152563 CTCACTGCACAGATGGAAGATGG + Intergenic
985819890 5:2152576-2152598 CTCACTGCACAGATGGAAGATGG + Intergenic
986245893 5:6006437-6006459 CACAAGGTCTAGATGCAGGATGG - Intergenic
986539002 5:8824637-8824659 CTCAAGGAACTGATGTAAGAAGG + Intergenic
986759794 5:10869479-10869501 TTCAAGGTAGAGAGGAAGGAAGG - Intergenic
987324308 5:16798519-16798541 GTCCAGGCACTGATGGAGGATGG - Intronic
988882534 5:35518802-35518824 CTGAAGTTCCAGATGGAGGGAGG - Intergenic
989202065 5:38773549-38773571 CAGAAGGAACAGATGGAGGAAGG + Intergenic
991006831 5:61836167-61836189 CTCAAGAGAGAGATGGTGGAAGG + Intergenic
991139725 5:63226124-63226146 TTCAAGGTACAGATGTATGATGG - Intergenic
992085316 5:73273138-73273160 CTGAATCCACAGATGGAGGAGGG - Intergenic
992508387 5:77409868-77409890 CTCAAGTTCCAGGTGGAGAATGG - Intronic
992762667 5:79964863-79964885 CTCAAGGAAGAGATTGAGGCTGG - Intergenic
992901018 5:81296417-81296439 CTCAAGGAGCAAATGAAGGAAGG - Intergenic
993077059 5:83245835-83245857 TTAAAAGTACAGATGGAGGGGGG - Intronic
993509888 5:88758041-88758063 CTCAAGGAAGGGAAGGAGGATGG - Intronic
994789723 5:104207717-104207739 CTCAAGGGGCATCTGGAGGAGGG + Intergenic
997507568 5:134430177-134430199 CCTAAGGGACAGATGGAGAAAGG + Intergenic
998038582 5:138936731-138936753 CACCAGGGGCAGATGGAGGATGG - Intergenic
998989085 5:147795252-147795274 CTGAAGGTGTGGATGGAGGAGGG - Intergenic
999833613 5:155344598-155344620 CTCAGGGTACAGCTGGAGATGGG + Intergenic
1002625599 5:180526304-180526326 CTGAAGGTAAAGATCCAGGAGGG + Intronic
1004743081 6:18482081-18482103 ATAGAGGTACAGATGGAGGCAGG - Intergenic
1007027351 6:38589886-38589908 CTTAAGGTAGAGAAGGAAGAAGG - Intronic
1007131937 6:39483364-39483386 CACAAGCAAGAGATGGAGGAAGG - Intronic
1007567399 6:42863002-42863024 TTGAGGGTACAGATGGAGGCAGG - Intronic
1008597748 6:53060354-53060376 ATCTAGGTTCAGATGGTGGAGGG - Intronic
1009306156 6:62091753-62091775 CTCATGGAGCAGATCGAGGATGG - Intronic
1010106388 6:72174117-72174139 CTCAAATCACAGATGGAGGAGGG - Intronic
1012988311 6:105898563-105898585 CCCAATGTACTGAGGGAGGATGG + Intergenic
1014241172 6:119019153-119019175 GTAAGGGAACAGATGGAGGAGGG + Intronic
1014397844 6:120948504-120948526 CTCAAGGTGGAGTAGGAGGAGGG - Intergenic
1015393832 6:132713522-132713544 TTTCTGGTACAGATGGAGGATGG - Intronic
1019272207 7:156638-156660 CAGAGGGTACAGATGGAGCAGGG - Intergenic
1019994056 7:4711907-4711929 CTCAAGGTTGAGATGGGGCAGGG + Intronic
1022027897 7:26465914-26465936 CTAAAGGAACAGAAGGAGCAAGG + Intergenic
1022033314 7:26512224-26512246 CTGAAGGTACTGAAGGAAGACGG + Intergenic
1022825666 7:34010252-34010274 CTCAAACTACATATAGAGGAAGG - Intronic
1022891244 7:34702130-34702152 CTCATGGTACAGATGGCGGTTGG + Intronic
1022959849 7:35416005-35416027 CTCTAGGAAGAGATGGAGGCTGG - Intergenic
1023060808 7:36323998-36324020 CTCATGGGACATATGGAGAAAGG - Intergenic
1023165463 7:37338974-37338996 CTCCAGGCACTGATGGAGGGTGG + Intronic
1024270955 7:47641119-47641141 CTCAGGTTACAGCTGGAGGCAGG - Intergenic
1024353909 7:48395229-48395251 CTCCAGTTGCAGGTGGAGGATGG + Intronic
1024678102 7:51656114-51656136 ATCGAGGTCCAGGTGGAGGAAGG + Intergenic
1029695866 7:102212813-102212835 CTCCATGTGCTGATGGAGGAAGG - Intronic
1030217256 7:107057121-107057143 TTCAAGCAACAGAGGGAGGAAGG - Intronic
1032314717 7:130825140-130825162 CTCCAGTTTTAGATGGAGGATGG + Intergenic
1032506212 7:132436486-132436508 GTGAAGGTGCAGGTGGAGGAAGG - Intronic
1033064862 7:138144957-138144979 CTCAAGGTTCAGAAGGATGCAGG - Intergenic
1033658176 7:143387225-143387247 CTCTGGGTACAGATGGGGGTCGG + Intronic
1033718932 7:144036203-144036225 AGCAAGGTAAAGATGGAGGGTGG - Intergenic
1034851117 7:154494926-154494948 CTCGAGATACAGACAGAGGAGGG + Intronic
1034909797 7:154986359-154986381 CACCAGGTACAGAAGCAGGAGGG - Intronic
1034936203 7:155202568-155202590 CTCATGGTACAGGTGAGGGAGGG + Intergenic
1035070166 7:156138615-156138637 CTGAATGTGCTGATGGAGGAGGG + Intergenic
1035352047 7:158253908-158253930 CTGAACGTAGAGATGGAGGGCGG - Intronic
1035734250 8:1876311-1876333 CTCGGGGTACAGATGGGGCAGGG + Intronic
1035950792 8:4018474-4018496 CACAAGGAGCAGGTGGAGGAAGG + Intronic
1036076665 8:5509698-5509720 ATCAAGGTAGAGATGGATAATGG + Intergenic
1037089255 8:14893229-14893251 CTCATTTTAAAGATGGAGGAAGG + Intronic
1037101069 8:15047103-15047125 CCCAAGGTAAGGATGCAGGAGGG - Intronic
1039362526 8:36893960-36893982 GTCAAGTTAGAGATGAAGGAAGG - Intronic
1041116164 8:54539627-54539649 CTCTATTAACAGATGGAGGAAGG - Intergenic
1044230823 8:89775805-89775827 CTCAAAGGAAACATGGAGGATGG + Intronic
1044913230 8:97084380-97084402 CTCAAGAAAAAGATGGGGGAGGG - Intronic
1046822767 8:118652246-118652268 CTCGAGTTACAGATGCAAGACGG - Intergenic
1047487646 8:125346331-125346353 CTCAAGATAAAGATGGAGAATGG + Intronic
1047720944 8:127638511-127638533 GTCAAGATCCAGATGCAGGATGG - Intergenic
1047915754 8:129582252-129582274 CTCAAGGTGCAGAGGGAGATTGG + Intergenic
1048557466 8:135494576-135494598 CTCAAGAAACAAAAGGAGGAGGG - Intronic
1049328115 8:142034599-142034621 CTCAAGGTTCAGATGGTGGCTGG + Intergenic
1049398538 8:142413098-142413120 CTCAATGGAGAGATGGAGGCTGG - Intergenic
1053417054 9:37953475-37953497 CTGATGGTAATGATGGAGGAAGG + Intronic
1055323088 9:75100993-75101015 CTCAAATTAGGGATGGAGGAAGG - Intronic
1055865000 9:80802413-80802435 CTCACTGAACAGATGGAGGCAGG + Intergenic
1056286501 9:85092570-85092592 CTCAAGGTAGGTATGGAGTAAGG + Intergenic
1057219224 9:93247085-93247107 CCCGAGTTGCAGATGGAGGAAGG - Intronic
1057745133 9:97745363-97745385 CTAAAGGACCAGATGGAGCATGG - Intergenic
1059140413 9:111847652-111847674 CTAAAGGGGCAGTTGGAGGACGG + Intergenic
1059358520 9:113720072-113720094 CTCCAGCTGCAGATGGAGGCGGG - Intergenic
1060406656 9:123376219-123376241 CTGGAGGTACAGAGGGAGGCTGG + Intronic
1062076693 9:134593580-134593602 CTCCAGGCGCAGGTGGAGGATGG - Intergenic
1189424101 X:40882610-40882632 CTTCAGGTACAGATGGGGAAAGG + Intergenic
1190780555 X:53590595-53590617 CTCAAGCTAAAGAGAGAGGAAGG + Intronic
1198326394 X:135577994-135578016 CCCAACGTACACATGGAGGAGGG - Intronic
1200242197 X:154502810-154502832 CTGAAGGAACAAATGGAGGAAGG + Intergenic
1201756405 Y:17491204-17491226 TTCATGGGACAGATGAAGGAAGG + Intergenic
1201845147 Y:18414781-18414803 TTCATGGGACAGATGAAGGAAGG - Intergenic
1201951723 Y:19572264-19572286 GTCAAGGTACAGATTAGGGATGG + Intergenic