ID: 954036651

View in Genome Browser
Species Human (GRCh38)
Location 3:47854492-47854514
Sequence GGCTGCTGCTGCTCGGGTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 369
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 328}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954036651_954036659 14 Left 954036651 3:47854492-47854514 CCTGAACCCGAGCAGCAGCAGCC 0: 1
1: 0
2: 2
3: 38
4: 328
Right 954036659 3:47854529-47854551 GGTCTGCAAGATGCCCCTCATGG 0: 1
1: 0
2: 1
3: 12
4: 120
954036651_954036654 -9 Left 954036651 3:47854492-47854514 CCTGAACCCGAGCAGCAGCAGCC 0: 1
1: 0
2: 2
3: 38
4: 328
Right 954036654 3:47854506-47854528 GCAGCAGCCATCCTTGTGCTCGG 0: 1
1: 0
2: 1
3: 25
4: 184
954036651_954036660 15 Left 954036651 3:47854492-47854514 CCTGAACCCGAGCAGCAGCAGCC 0: 1
1: 0
2: 2
3: 38
4: 328
Right 954036660 3:47854530-47854552 GTCTGCAAGATGCCCCTCATGGG 0: 1
1: 0
2: 0
3: 5
4: 96
954036651_954036655 -8 Left 954036651 3:47854492-47854514 CCTGAACCCGAGCAGCAGCAGCC 0: 1
1: 0
2: 2
3: 38
4: 328
Right 954036655 3:47854507-47854529 CAGCAGCCATCCTTGTGCTCGGG 0: 1
1: 0
2: 2
3: 14
4: 216
954036651_954036656 -7 Left 954036651 3:47854492-47854514 CCTGAACCCGAGCAGCAGCAGCC 0: 1
1: 0
2: 2
3: 38
4: 328
Right 954036656 3:47854508-47854530 AGCAGCCATCCTTGTGCTCGGGG 0: 1
1: 0
2: 0
3: 9
4: 100
954036651_954036664 29 Left 954036651 3:47854492-47854514 CCTGAACCCGAGCAGCAGCAGCC 0: 1
1: 0
2: 2
3: 38
4: 328
Right 954036664 3:47854544-47854566 CCTCATGGGCCCCCCACCCACGG 0: 1
1: 0
2: 3
3: 17
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954036651 Original CRISPR GGCTGCTGCTGCTCGGGTTC AGG (reversed) Intronic
900033780 1:390187-390209 GTCTGTTGCTGCTGGGGATCAGG - Intergenic
900054615 1:620077-620099 GTCTGTTGCTGCTGGGGATCAGG - Intergenic
900119231 1:1041497-1041519 GGCAGCTGCGGCTCGGGTCAGGG - Exonic
900164729 1:1240143-1240165 AGCTGCTGTTGCTTGGGGTCTGG - Intergenic
900181577 1:1313373-1313395 GGCTGCTGCTGCTGGGGAACGGG - Intronic
900385067 1:2406776-2406798 GGCTGCAGCTGTACGGTTTCAGG - Exonic
900394027 1:2445735-2445757 CACTGCTGCTGCTGGAGTTCAGG + Intronic
900447472 1:2688544-2688566 GGGTGCTGCTCCGTGGGTTCAGG - Intronic
900450324 1:2746324-2746346 GGGTGCTGCTCCGTGGGTTCAGG - Intronic
900718713 1:4161405-4161427 GGGTGCTGTTGTCCGGGTTCCGG + Intergenic
901534441 1:9873109-9873131 GGAGGCTGCTGCCCGGGCTCTGG - Intronic
902437933 1:16409991-16410013 GGCTGCTGCTGCGCACGGTCTGG + Exonic
902601208 1:17540848-17540870 ATCTGCTCCTCCTCGGGTTCTGG + Intronic
903036569 1:20496767-20496789 AGCAGCTGCTGCTCCGCTTCTGG - Intergenic
903911642 1:26731227-26731249 GGCTGCTGCTGCTGAGGGTGAGG - Exonic
904548580 1:31296636-31296658 GCCTGCTGCTGCCCGGCTCCTGG + Exonic
904810442 1:33160169-33160191 TGCTGCTGCTCCTCTAGTTCAGG - Intronic
905202144 1:36322576-36322598 GGGTGCTGCTGCGGGGGTCCCGG + Exonic
905381005 1:37561599-37561621 GGCTGCTGCTGCTGCGAGTCCGG + Exonic
905664276 1:39753171-39753193 GGCTGCTGCTGCCCAGGTTCCGG + Intronic
906082513 1:43102500-43102522 GGCTGCAGCTGCTCAAGTTGTGG - Intergenic
906231650 1:44169666-44169688 TGCTGCAGCTGCTTGGGTTTCGG + Intergenic
906365517 1:45206379-45206401 GGCGGCGGCTGCTCGGGCTGCGG + Exonic
906797850 1:48711806-48711828 GGGTGCTGCTTCTGGGGTCCAGG - Intronic
909450935 1:75797171-75797193 GGCTGCTGCTGCTGCTGCTCCGG - Exonic
909697485 1:78484003-78484025 GGCAGCTGCAGCTCTGGTGCTGG - Intronic
911208561 1:95117327-95117349 GGCCGCGGCCGCTCGGGCTCCGG - Exonic
913578087 1:120197254-120197276 GGCCGCTGCTGCTCAGCTCCCGG - Intergenic
915009950 1:152676199-152676221 GGCTGCTGCAGCTCTGGGGCTGG + Exonic
915012317 1:152699049-152699071 GGCTGCTGCGGCTCCAGCTCTGG + Exonic
915033470 1:152903486-152903508 GTCTGCTGCTGCTGGGCCTCAGG - Intergenic
915902374 1:159855970-159855992 TGCTGCTGCTGCGGGGGCTCCGG - Exonic
916240587 1:162634956-162634978 GGCTGCTGCTCCTGGGGTGGGGG + Intronic
917834673 1:178931953-178931975 AGCCGCTGCTGGTGGGGTTCGGG - Intergenic
919565598 1:199181419-199181441 GGCTGATGCTGTTCAGGTGCTGG + Intergenic
922074519 1:222230148-222230170 GGATGCTGCAGCTGGGGTTGGGG + Intergenic
922144460 1:222925713-222925735 TGCTGCTGCTGCTGCTGTTCTGG - Intronic
922256137 1:223894343-223894365 GTCTGTTGCTGCTGGGGATCAGG - Intergenic
922843642 1:228665423-228665445 GGCTCCTACTGCTCTGGTTCTGG + Intergenic
923044332 1:230344536-230344558 GGCAGCTGCTTCTGGCGTTCAGG - Intronic
923855191 1:237838660-237838682 GTCTCCTTCTGCTGGGGTTCTGG - Intergenic
924337343 1:242997209-242997231 GTCTGTTGCTGCTGGGGATCAGG - Intergenic
1064728178 10:18302222-18302244 GACTGCTGCTATTCAGGTTCTGG - Intronic
1067187542 10:44043528-44043550 GGCTCCTGCCTCTCGGGCTCTGG + Intergenic
1067293304 10:44959756-44959778 GGCTTCAGCTGCTCGGGGCCAGG - Intronic
1067369739 10:45672471-45672493 GGCCGCTGCTGCCCGGGGACCGG - Intronic
1068296796 10:55080977-55080999 TGCTGCTGCTGCTGGGGGTGGGG + Intronic
1068820874 10:61376733-61376755 GTCTCCTGCAGCTAGGGTTCTGG + Intergenic
1070161178 10:73867590-73867612 GGCTGCTGCTGATAGGGCCCAGG + Intronic
1070280246 10:75043492-75043514 GCGTGCTGCTGGTGGGGTTCGGG - Intronic
1072039047 10:91590436-91590458 GGCTGCTGCTGCTCCGGGGAAGG - Intergenic
1072102320 10:92240289-92240311 CGCTGCTGCTGCTGGGGCTGGGG + Exonic
1072532549 10:96332803-96332825 GGTTGCTGCTGCTGGTGTTGGGG - Intronic
1073082590 10:100869326-100869348 GGCCTCAGCTGCTTGGGTTCTGG - Intergenic
1073200684 10:101732729-101732751 TGCTGCTTCTGCTTGGGCTCAGG + Intergenic
1073899570 10:108204201-108204223 GGCTCCTGCAGCTAGGATTCTGG + Intergenic
1073911015 10:108344608-108344630 GGCTGCTGCTAGTAGGGCTCTGG - Intergenic
1074516359 10:114174050-114174072 GGCTGCTGGAGCTCTGGCTCAGG + Exonic
1075724856 10:124605994-124606016 GGGTCCTGCTGCCCGGGTTTCGG - Intronic
1075746597 10:124732327-124732349 GGCTGATCCTGCCCGGTTTCTGG - Intronic
1077043756 11:535518-535540 GGCGGGTGCGGCTCGGGTTGCGG + Exonic
1077170481 11:1163807-1163829 GGGCTCTGCTGCTCGGGTGCTGG + Intronic
1077214840 11:1390919-1390941 CGCTGCTCCGGCTCGGGCTCGGG + Intronic
1077229173 11:1450936-1450958 GGCTGCTGCTGGGCGCTTTCGGG - Intronic
1077407991 11:2391182-2391204 GGCTGGTGCTGGTGGGGCTCTGG + Intronic
1077558402 11:3239509-3239531 GGAAGCTGCTGCTCTGGTTCAGG - Intergenic
1078319636 11:10322635-10322657 AGCTGCTGCAGCTTGGGCTCAGG - Intronic
1078432475 11:11298537-11298559 GGCAGCTGCAGCTGAGGTTCGGG - Intronic
1079380614 11:19934128-19934150 GGCTGCTGATGCTGTGGTTCAGG - Exonic
1079626137 11:22619089-22619111 GGCTGCTGCTGCCTGGGGTGAGG + Intergenic
1080304944 11:30826055-30826077 TGCTGCTGCTGCTCTGAGTCTGG + Intergenic
1080318165 11:30973392-30973414 GGCAGCTTCTGCTTGGCTTCTGG - Intronic
1081574298 11:44309728-44309750 GGCTGCTGCTGCTGCGGCTGCGG + Exonic
1082810434 11:57476268-57476290 GGCTGCTGCTGCACGGGAACCGG + Exonic
1083436554 11:62647239-62647261 GTCTGCTGCTGCTCAGTGTCTGG - Exonic
1083551463 11:63593291-63593313 GGCTGCTGTTGCTCAGGCTGGGG + Intronic
1084925935 11:72511240-72511262 GTCTCCTGCTGCTAGGATTCTGG + Intergenic
1084970612 11:72769791-72769813 GGCTGCTGCTGGTAGTGTTCAGG - Intronic
1087177077 11:95105982-95106004 GGCTGCTGTGGCTCTGGCTCTGG - Intronic
1089043534 11:115477776-115477798 TGCTGCTGCAGCTGGGGTCCAGG + Intronic
1089169367 11:116501408-116501430 GGCTGCAGCTGCTTGGGTGGGGG - Intergenic
1089543721 11:119206463-119206485 GGCTCCGGGGGCTCGGGTTCGGG + Exonic
1090136495 11:124204475-124204497 GGCTGCAGCTGCTGGGGGTGGGG + Intergenic
1090863553 11:130675488-130675510 GGCTGCTGCTGCTCTAGCCCAGG - Intronic
1091321833 11:134657315-134657337 CGCTGCTGCTGCTCAAGCTCCGG - Intergenic
1091795262 12:3294389-3294411 GCCTGCTGCTGCCGGGGCTCTGG - Intergenic
1092231548 12:6778364-6778386 AGCTGCTCCGGCTCGGGCTCGGG - Exonic
1092656479 12:10690098-10690120 GGCTGCTGCTTCTGGAGTTGAGG + Intergenic
1092995638 12:13947913-13947935 GGGGGCTGCTTCTCTGGTTCTGG - Intronic
1095945130 12:47749369-47749391 AGGTGCTGCTGCTGGGGTTGGGG - Exonic
1096053190 12:48629006-48629028 GGCTGCTGTCGCTGGGGTTGGGG - Intergenic
1096577304 12:52560758-52560780 TTCTCCTGCTGCTCAGGTTCTGG + Intergenic
1103534739 12:121626760-121626782 GACTGCTGCGGCTCGGGGGCGGG - Exonic
1105927136 13:25018484-25018506 GGCAGCTGCAGCTCGGGCTCCGG + Intergenic
1110440711 13:75522215-75522237 GGCAGCTTCTCCTCGGCTTCTGG - Intergenic
1111201969 13:84950031-84950053 GGCTGCTGCTGCTGTTTTTCTGG + Intergenic
1111701288 13:91693266-91693288 GGAGGCTGCTGCTTCGGTTCAGG + Exonic
1112176431 13:97029970-97029992 GGCAGCATCTGCTCGGCTTCTGG + Intergenic
1112638156 13:101241339-101241361 GGCTGCTGTTTCTCAGATTCTGG + Intronic
1112720402 13:102237302-102237324 GCCTCCTGCTGCTCGGATGCAGG - Intronic
1114664532 14:24369902-24369924 GGCTGCTGCTGCCAGGGCTTGGG - Exonic
1114697913 14:24644675-24644697 TGCTGCTGCGGCTCTGGATCTGG - Intergenic
1116725270 14:48554779-48554801 TGCTGCTGCTGCTGGGGGTGTGG + Intergenic
1117478498 14:56119408-56119430 GGATGCGGCTGCTCGGGGCCTGG + Intronic
1118849467 14:69573055-69573077 TGCTGCTGCTGCCCGCGCTCGGG + Exonic
1118893860 14:69930087-69930109 TGCTTCTGCTGCTTGGCTTCTGG + Intronic
1122975266 14:105168361-105168383 TGCTGCTGCTGCTGGCGCTCTGG - Exonic
1123126955 14:105953708-105953730 GTCTCCTGCTGCTAGGATTCTGG - Intergenic
1123407418 15:20029528-20029550 GTCTCCTGCTGCTAGGATTCTGG - Intergenic
1123516745 15:21036184-21036206 GTCTCCTGCTGCTAGGATTCTGG - Intergenic
1123689322 15:22823761-22823783 TGCTGCTGCTGCTCATCTTCTGG + Exonic
1124595580 15:31089143-31089165 GGCTGCTGCTGTTTGCCTTCTGG + Intronic
1126999116 15:54481624-54481646 TGCTGCAGCTGCTTGGGTTTTGG + Intronic
1127606517 15:60592498-60592520 GGCAGCTGCTGCTGTGGCTCGGG - Intronic
1128388946 15:67170032-67170054 GGCTGCAGCAGCTCAGGTGCTGG - Intronic
1128728311 15:70004238-70004260 GGCTGCTTCTACTCTGGGTCAGG + Intergenic
1128767463 15:70259911-70259933 GGTTGGTGCTGCTCAGGTCCCGG - Intergenic
1129082492 15:73052734-73052756 GCCTGCTGCTGCTCGGGCGCCGG + Exonic
1130928442 15:88402430-88402452 AGCTGCTGCTGCTGGGGTAGGGG + Intergenic
1131311262 15:91292477-91292499 GGCTGCTGCTTCTCTGGTTGGGG + Exonic
1131465977 15:92655315-92655337 GCCTGCTGCTGCGCGTCTTCAGG - Exonic
1132170666 15:99650794-99650816 GGCTGCTGCTGCTGCTGGTCAGG - Intronic
1132500609 16:283107-283129 GGCAGCTGCTGCTTGGCTTCTGG + Intergenic
1132872675 16:2122756-2122778 GGCTCCTGCGCCTCGGGTCCCGG - Intronic
1133756663 16:8767269-8767291 GGCAGCTGCGCCTTGGGTTCAGG - Intronic
1134551768 16:15141955-15141977 GGCTGCTGCGCCTCAGGTCCTGG - Intergenic
1135716751 16:24777112-24777134 GGCTGCTGCTGCTGCGGCTGCGG - Exonic
1136284420 16:29232813-29232835 GGCTGCTCTGGCTCGGGCTCAGG + Intergenic
1137958051 16:52852894-52852916 GGTTGCTGCTGCCGGGGTTGAGG - Intergenic
1138121542 16:54404379-54404401 GCCTCCTGCTGCTCTGGTTGGGG + Intergenic
1138660423 16:58513483-58513505 TGCTGGTGCTGCTTGGGTTTTGG + Exonic
1141454002 16:84126315-84126337 TGCTGATGCTGCTCTGCTTCAGG + Intronic
1142376742 16:89710621-89710643 AGCTGCTGCAGCTGGGGCTCCGG + Exonic
1142718842 17:1763010-1763032 GGCTGCTGCTTCTGGGGTGTGGG + Intronic
1143731309 17:8884457-8884479 GGCTGCTGCTGAGCGCATTCGGG + Intronic
1144678295 17:17175728-17175750 GGCTGCTGCAGCTCAGGTCAGGG + Intronic
1144723838 17:17491385-17491407 AGCTGCTGCTGCTGCTGTTCGGG - Exonic
1144728689 17:17514601-17514623 TCCTGCTGCTGCCCGGGCTCAGG + Intronic
1145062428 17:19741592-19741614 GGCCACCGCTGCTCGGGGTCTGG - Intronic
1146667613 17:34715467-34715489 GGCTGCTGTTGCTGGGGTGTGGG - Intergenic
1147116946 17:38307764-38307786 GGCTGCTGTGGCTAGGCTTCAGG + Intronic
1147961492 17:44170478-44170500 GGATGCAGATGCTGGGGTTCGGG + Intronic
1147988594 17:44320227-44320249 GGCTGCTGCTGCGGAGGATCCGG - Exonic
1148412727 17:47481833-47481855 GGCTGCTGTGGCTAGGCTTCAGG - Intergenic
1148678734 17:49460510-49460532 GGCTCCTGCTGCTGGGGATCCGG + Intronic
1150289443 17:63973033-63973055 TGCTGCTGCTGCACAGGTGCTGG + Intergenic
1150311082 17:64129976-64129998 CGCTGCTGCTGCCCGGCCTCGGG - Exonic
1150488199 17:65558569-65558591 GGAAGCTGCTGCTGGGGTCCGGG + Exonic
1151651799 17:75474894-75474916 GGTTCCTGCTGCTTGGGTGCAGG + Intronic
1151783980 17:76266142-76266164 GGCTGCTGCTGCTTGGCCTCGGG + Intronic
1152016197 17:77752224-77752246 GGCAGCTGCTTCCAGGGTTCTGG - Intergenic
1152084856 17:78211772-78211794 TGCAGCTGCTGCTCGGGCTCGGG + Intergenic
1152661703 17:81545424-81545446 GGCTGCTGCTCCTGGGGTAGAGG + Intronic
1152739659 17:82013365-82013387 GGGTGCTGCTGCCCTGTTTCTGG + Intronic
1153006855 18:504761-504783 GGCTGCTGCTTCTGGGGGTGGGG - Intergenic
1153218964 18:2846391-2846413 GGCTGCTGCAGCTCAGCGTCCGG - Intergenic
1154032415 18:10765442-10765464 GGCAGCTGCTGCAAGGTTTCAGG + Intronic
1155800911 18:30102374-30102396 TGCTGGTGCTGGTCGGCTTCTGG - Intergenic
1157794265 18:50560085-50560107 CGCTGCTCCAGCTCGGGCTCCGG - Exonic
1160680696 19:410681-410703 GGCAGCTGGAGCTGGGGTTCGGG - Intergenic
1160991908 19:1863562-1863584 GGCGGCGGCTGCTCGAGTGCGGG + Exonic
1161010099 19:1955751-1955773 GGAGGCTGCTGCTCGGCTCCGGG + Intronic
1161358195 19:3831454-3831476 GGCAGCTGCTGCGGGGGTCCCGG + Exonic
1161398540 19:4057840-4057862 GGGTGCTGCCGGTGGGGTTCGGG - Intronic
1161734773 19:5984868-5984890 GGCTTCTGCAGCTGGGCTTCAGG + Intergenic
1161948783 19:7455561-7455583 CGCTGCTGTGGCTCGGGTCCTGG + Intronic
1162088318 19:8261774-8261796 TGCAGCTGCTGCACGTGTTCTGG + Exonic
1162861017 19:13505898-13505920 CGCAGCTGCTGCTGGGGTTCGGG + Intronic
1163182742 19:15615672-15615694 GGCTGCTCCTGCTGGTGGTCGGG + Exonic
1164433470 19:28208218-28208240 GGCTTCTCTTGCTCGGGCTCTGG - Intergenic
1165058693 19:33194630-33194652 GGCTGCTGCGGCCCGGGTGCAGG - Exonic
1165796518 19:38523142-38523164 GGCTGCGGCTCCTCTGGTTGTGG - Intronic
1165867274 19:38946431-38946453 GCCTGCTGCTGCTCTGGGGCAGG + Intronic
1168712891 19:58511902-58511924 TGCTGCTGCTGCTCCTGCTCTGG - Exonic
925191954 2:1892246-1892268 TGCTGCTGCTGCTGGGGCTGGGG + Exonic
925731145 2:6920061-6920083 GGCTGAAGCTGCTGAGGTTCAGG + Intronic
927472340 2:23385654-23385676 GGCTGGGGCCGCTCGGGTCCTGG - Exonic
929192342 2:39151110-39151132 GGCTGCTGCAGCTCTGCTCCAGG - Intergenic
932209443 2:69915099-69915121 GGCGGCTGCTGCTCTGCTCCGGG + Exonic
933064202 2:77773206-77773228 GGCTGAAGCTGCTGGGATTCAGG + Intergenic
934113764 2:88765399-88765421 GGCAGCTGCAGCTCGGGCTCCGG - Intergenic
934662514 2:96150622-96150644 GGCTGCTGCTGCTGCTGTGCTGG - Intergenic
934766690 2:96883768-96883790 GTCTGCTGGTGCTGGGATTCTGG + Intronic
936045998 2:109188388-109188410 GGCTGCTGCTCAGCGGGGTCTGG + Intronic
936376790 2:111947821-111947843 GGCTCCTGCTGCCTGGGCTCAGG - Intronic
937726485 2:125173501-125173523 GGCAGCATCTGCTCAGGTTCTGG - Intergenic
939262756 2:139831358-139831380 GGCTGCGAATGCTAGGGTTCTGG - Intergenic
940135904 2:150435762-150435784 GGCTGCAGCAGCTGGGATTCAGG - Intergenic
942315548 2:174693563-174693585 GGCTGGTGCTGCCTGGATTCAGG - Intergenic
945988179 2:216371496-216371518 GGCGACTGCTGCTCGGCGTCCGG + Exonic
948284781 2:236775094-236775116 TGGTGCTGATGCTCGGGTCCTGG + Intergenic
948479034 2:238239233-238239255 GCCTGCAGCTGCTCGCGCTCTGG + Exonic
948489844 2:238305505-238305527 GGCTGTTGCTGCTCTGGGCCTGG - Intergenic
948597607 2:239090233-239090255 GGCTGCAGCTGCCCTGGCTCTGG - Intronic
948708106 2:239807672-239807694 GGCTGCGGCTGCCCTGGCTCGGG + Intergenic
948807684 2:240460024-240460046 GGCAGCTGCTGCTGGGGCCCTGG + Intronic
1168830089 20:841142-841164 GGCGGCCGGGGCTCGGGTTCTGG + Intronic
1168961736 20:1874682-1874704 GGAGGCTGCTGCTCGGGGCCCGG - Intergenic
1170850147 20:19997274-19997296 TGCTGCTGCTGCTGAGATTCTGG - Intronic
1172118509 20:32584855-32584877 CGCTGCTGCTGCGCGGGGGCTGG - Intronic
1172127600 20:32634183-32634205 GGCTGCTGGGGCTTGAGTTCAGG + Intergenic
1172155386 20:32820254-32820276 GGCTGCTGCTACGCGGGGTGGGG + Intronic
1172182778 20:33013771-33013793 GGGCGGTGCTGCTCGGGCTCAGG + Intronic
1173728375 20:45312291-45312313 GGCTGGTGCTGCGCGGGGGCCGG + Exonic
1173800468 20:45891612-45891634 TGCTGCTGCTGCTAGTGTCCTGG + Exonic
1173895289 20:46546178-46546200 GGCTGCTGCTGCTGCAGGTCTGG - Exonic
1176047853 20:63101973-63101995 GGCTGCTGCTCCGCGGGCTCTGG + Intergenic
1176255781 20:64152183-64152205 GGCTGCTGCAGGTCGGGGCCTGG + Intronic
1177225177 21:18244829-18244851 GGCTGCTGCTGCTGTGATCCAGG + Exonic
1177730816 21:25025079-25025101 GGCTGCTGCTGCTGGGGCCAAGG - Intergenic
1178092084 21:29174757-29174779 GGATGCTGCTGAGCTGGTTCGGG + Exonic
1178773649 21:35528672-35528694 GGCGCCTGCAGCTCCGGTTCGGG + Intronic
1178998880 21:37435325-37435347 AGCCGCTGTTGCTGGGGTTCAGG + Intronic
1179438649 21:41378798-41378820 TGCTGCTCCTTCTTGGGTTCTGG - Intronic
1180232351 21:46434696-46434718 GGCTGCTGCTCCTTGAGGTCTGG + Intronic
1181147385 22:20858658-20858680 GGCGGCGGCTGCTCCGGCTCCGG - Exonic
1181986126 22:26800897-26800919 GGCTGCTGCTGCTCTGTGGCTGG + Intergenic
1182270422 22:29149832-29149854 GGCTGGTGCTGCCCTGGTGCTGG - Intronic
1183420209 22:37707441-37707463 AGATGCTGCTGCTGGGGTTGGGG + Intronic
1184231163 22:43159216-43159238 GGCTGCTGCAGCTGCTGTTCAGG - Exonic
950316303 3:12004636-12004658 GGCGGCGGCTGCTGGGGCTCGGG - Exonic
950345356 3:12287934-12287956 GGCGGCTGCGGCTCGGGCTCGGG - Intronic
950576349 3:13834365-13834387 GGCTGCTGATGCTGGGGGTCGGG + Intronic
952250452 3:31648321-31648343 GGCTGCTGCTTCTAGGGTTTAGG + Intergenic
953754425 3:45634378-45634400 GGCTGCTACTGTAGGGGTTCTGG + Intronic
954035459 3:47848769-47848791 GGCTGCTGCTGAAGGGGTCCCGG - Exonic
954036651 3:47854492-47854514 GGCTGCTGCTGCTCGGGTTCAGG - Intronic
954926004 3:54235348-54235370 AGCTGCATCTGCTCGGCTTCTGG + Intronic
957048772 3:75396149-75396171 GGCAGCTGCAGCTCGGGCTCCGG + Intergenic
957346328 3:78965998-78966020 GGCTGCTGCAGCTGGGGATTGGG - Intronic
961599911 3:128052530-128052552 GGCGGCGGCTGCTCGGGCTCCGG - Exonic
962376654 3:134863951-134863973 GGCTGGTGATGGTGGGGTTCAGG + Intronic
962688257 3:137868218-137868240 TGCTGCTGCTGCTGGGGGTCAGG - Intergenic
962852768 3:139320070-139320092 AGCGGCTGCTGCTGGGGTGCAGG - Intronic
963706735 3:148697842-148697864 CGTTGCTGCTTCTTGGGTTCCGG - Exonic
964007811 3:151852276-151852298 GGCAGCTGCAGCTGTGGTTCTGG + Intergenic
964069458 3:152614062-152614084 GGCTGCTGCTGTTGTGTTTCTGG + Intergenic
964388785 3:156176793-156176815 GCCTGCTGCTGCCCGGCTCCAGG + Intronic
966432037 3:179842177-179842199 GCCTGCTGCTGCTAAGGTACAGG + Intronic
966886522 3:184380362-184380384 GGCTGCTGCTGCTCGGCTCCCGG + Exonic
967055428 3:185825411-185825433 GGCAGTGGCTGCTCGGGCTCCGG + Intergenic
968086584 3:195876688-195876710 GGCTGCTGCTGGTGGGGCTCTGG - Intronic
968353342 3:198080765-198080787 GGCGGCTGCGGCTCGGGCGCAGG + Intergenic
969601311 4:8178057-8178079 TGCTTCTGCTGCTTGGGGTCTGG + Intergenic
970456219 4:16226543-16226565 GGCGGCGGCGGCTCGGGCTCCGG - Intronic
970657132 4:18243581-18243603 GTCTGCTGCTACTCTAGTTCAGG - Intergenic
972740915 4:41885297-41885319 TGCAGCTCCTGCTCGGCTTCTGG - Intergenic
973563687 4:52162594-52162616 GACTCCTGCTGTTCTGGTTCAGG + Intergenic
973617274 4:52691604-52691626 GGCAGCTGCTGCTGGGGGTGGGG - Intergenic
975689470 4:76949827-76949849 TGCTGCTAGTGCTCGGGCTCCGG - Exonic
975689499 4:76949948-76949970 GCCTGCTGCTCCTCGGGCGCCGG + Intronic
977183143 4:93902679-93902701 AGCAGCTTCTGCTCGGCTTCTGG - Intergenic
978030499 4:103936546-103936568 TGCTGCTGCTGCCAGGGTTGAGG - Intergenic
979239790 4:118438099-118438121 GTCTGTTGCTGCTGGGGATCAGG + Intergenic
980920745 4:139083691-139083713 GGCCGCTGCTGCCCGCGTTCGGG - Intronic
980941567 4:139279960-139279982 GGCTTCTGCTGCTCTGGGTCGGG + Intronic
981752120 4:148102646-148102668 GGATGCTGGTGCTGTGGTTCAGG - Intronic
982554254 4:156840282-156840304 GGCTGGAGCTGCTGGGATTCAGG - Intronic
983037926 4:162890377-162890399 GGCGGCAGCTGCTCAGCTTCTGG - Intergenic
984962810 4:185114062-185114084 GGCAGCTTCTGCTCGGCTTCTGG + Intergenic
985665419 5:1179515-1179537 GGCTGCTCCTGCAGGGGCTCAGG + Intergenic
985829140 5:2215181-2215203 GTCAGCTGCTGCTCGGTTTCAGG + Intergenic
986590044 5:9359063-9359085 GGGTGCTGCTGCTGAGGATCTGG - Intronic
988264104 5:28928038-28928060 GGCAGCTGCAGCTCGGGCTCCGG + Intergenic
989041399 5:37233223-37233245 GGCTGCTACTGCACTGCTTCAGG + Intronic
990155644 5:52874127-52874149 GGCTGCAGCTGTTCAGCTTCTGG + Intronic
990499765 5:56384298-56384320 GGCTGTTGCTGCTCAGCTCCCGG + Intergenic
991591108 5:68252190-68252212 TTCTGCTGATCCTCGGGTTCAGG - Intronic
994189753 5:96856627-96856649 GGCTGCTTCTGCTCTGGCTTTGG + Intronic
995509387 5:112892959-112892981 GGCTCCTGCGGCTCTGGCTCCGG - Exonic
997021450 5:130007575-130007597 GTCTCCTGCTGCTAGGATTCTGG - Intronic
997329864 5:133052225-133052247 GCCGGCTACTGCTCGGGCTCGGG - Exonic
998172276 5:139879685-139879707 GGAGGCTGCTGCTCTGGTTCAGG + Intronic
998334076 5:141355428-141355450 AGGTGCCGCTGCGCGGGTTCAGG - Exonic
998335082 5:141364558-141364580 AGCTGCCGCTTCGCGGGTTCAGG - Exonic
998337117 5:141383127-141383149 AGCTGCCGCTGCGCTGGTTCAGG - Exonic
998342528 5:141430987-141431009 AGCTGCCGCTGCGCGGATTCAGG - Exonic
998588099 5:143449438-143449460 GACTGCTGCTGCTCGGGGTTTGG + Intergenic
999077338 5:148808869-148808891 GGCTGGTGCTGCTCCACTTCTGG - Intergenic
1000029528 5:157390043-157390065 GGCAGATGCTGCTGGGGTTGAGG - Intronic
1000369459 5:160520735-160520757 GGCAGCTGCTCCTCGGGGCCTGG + Intergenic
1002257742 5:177971202-177971224 GGCTGCCGCTCCTCGAGTTGGGG + Intergenic
1002740040 5:181428681-181428703 GTCTGTTGCTGCTGGGGATCAGG + Intergenic
1003879401 6:10466469-10466491 GGCTGCTGCTGATCTGTTTAGGG - Intergenic
1005929181 6:30468941-30468963 GCGGGCTGCTGCTCAGGTTCTGG + Intergenic
1006572495 6:35017474-35017496 GGCTGCTGCTGCTCCGCCTGTGG - Exonic
1007116335 6:39345716-39345738 TGCTGGTGCTGCTCTGTTTCTGG + Exonic
1007409431 6:41653432-41653454 TGCTGCTGCTGCTGTGGCTCTGG + Exonic
1009308884 6:62125154-62125176 TACTGCTGCTGCTAGGGTTTTGG - Intronic
1009703808 6:67219461-67219483 GACTCCTGCTGCTAGGATTCTGG - Intergenic
1013360372 6:109388288-109388310 TGCTGCTGCTGCTGCTGTTCTGG - Intergenic
1013925738 6:115469141-115469163 TGCTGCTGCTGCTGGGGTGAGGG + Intergenic
1015773648 6:136792677-136792699 GGCTGCCGCTGCTGCTGTTCCGG - Intergenic
1015843794 6:137497535-137497557 GCCTGCTCCTTCTCGGGTTCAGG - Intergenic
1016668841 6:146676681-146676703 GGCTTCTGCTGGTCGCTTTCAGG + Intronic
1017103171 6:150865987-150866009 GGCTGCAGCTGCTCCGGGCCTGG - Exonic
1017496494 6:154988306-154988328 GGCGGCTTCTGCTTGGCTTCTGG + Intronic
1017725447 6:157273710-157273732 GGCTGCAGCTGCCGGGCTTCAGG - Intergenic
1019192185 6:170258454-170258476 TTCTGCTGCTACTGGGGTTCTGG + Intergenic
1019245152 6:170704281-170704303 GTCTGTTGCTGCTGGGGATCAGG + Intergenic
1019294559 7:266971-266993 GGCTGCTGCTGTGTGGGGTCTGG + Intergenic
1022265517 7:28750211-28750233 GACTGGTGATGCTCTGGTTCTGG - Intronic
1023865413 7:44235978-44236000 TGCTGCTGCTGCTGGGGTTGGGG - Intronic
1024131819 7:46361019-46361041 GGCTGCTGCTGCTGCTGTCCAGG - Intergenic
1024375032 7:48627754-48627776 GGCTGCCTCTGGTCGGCTTCTGG + Intronic
1026300055 7:69089924-69089946 GGGGGCTGCTTCTGGGGTTCTGG - Intergenic
1026570216 7:71522871-71522893 GGATGCTTCTGCTGTGGTTCAGG - Intronic
1026847655 7:73706751-73706773 GGCTGTTCCTGCTCAGGGTCAGG - Intronic
1027505907 7:79016848-79016870 GGCAGCTGCTGCTGGGGTTGGGG - Intronic
1028522426 7:91747169-91747191 GGCTGCAGCAGCTTGGGTCCTGG - Intronic
1029495810 7:100895144-100895166 GGCAGCAGCTGCTACGGTTCCGG + Intronic
1030069355 7:105685652-105685674 TGCTGCTGATACTCAGGTTCTGG - Intronic
1031836568 7:126686612-126686634 GGCTGCTGCTGCTGCGGGGCAGG - Intronic
1032109821 7:129066463-129066485 GGCGGCGGCTGCTCAGGCTCTGG + Intergenic
1032525585 7:132576739-132576761 CGCCGCCGCTGCTCGGGCTCCGG - Exonic
1034174519 7:149090476-149090498 GGCTGCTTCTGCTGGGGATGTGG - Intronic
1034400792 7:150860330-150860352 GGCTGCTGTTAACCGGGTTCAGG - Intronic
1034478698 7:151303592-151303614 GGCTGCGGCTGGGCGGGCTCTGG + Intergenic
1034565492 7:151911206-151911228 CGCTGGTGCTGCTCAGCTTCTGG - Intergenic
1035184195 7:157112922-157112944 CCCTGCTGCTGCACAGGTTCTGG - Intergenic
1035502971 8:103921-103943 GTCTGTTGCTGCTGGGGATCAGG - Intergenic
1036649660 8:10634291-10634313 TGCTGCTCCTTCTCGGGTCCTGG - Intronic
1036865312 8:12391445-12391467 TGCTGCTGCTTCTCTGGGTCTGG + Intergenic
1038575701 8:28701791-28701813 GGCTGCTGCTGCCCGGCGGCGGG + Intronic
1041304446 8:56445903-56445925 GGCTGCTGTTGCTCGGCCCCGGG - Exonic
1041830435 8:62147477-62147499 GGCTGCTGCTGGTCAGGGTTTGG - Intergenic
1043308190 8:78823386-78823408 GGCTGATGCAGCTGGGATTCAGG - Intergenic
1045803822 8:106133307-106133329 GCCTCCTTCTGCTCGGCTTCTGG - Intergenic
1047384270 8:124395050-124395072 TGCTGCTGCTCCTCTGGGTCTGG + Intergenic
1048572030 8:135664451-135664473 AGCAGCTGCTGCTCGGGGTGTGG + Intergenic
1049536919 8:143186703-143186725 GGCTGCAGGTGCTAGGGTTAGGG - Intergenic
1053624921 9:39859727-39859749 GGTTGCTGCTGCTGGGGTGGGGG + Intergenic
1053879949 9:42583501-42583523 GGTTGCTGCTGCTGGGGTGGGGG - Intergenic
1054076999 9:60546175-60546197 GGCAGCTGCAGCTCGGGCTCTGG - Intergenic
1054218976 9:62390971-62390993 GGTTGCTGCTGCTGGGGTGGGGG - Intergenic
1054231741 9:62518198-62518220 GGTTGCTGCTGCTGGGGTGGGGG + Intergenic
1057152779 9:92809222-92809244 GGCTGCTGCAGCTCGGGCGCAGG - Intergenic
1057489180 9:95508487-95508509 GGCTGCTCGGGCTCGGGCTCCGG + Exonic
1057684668 9:97221656-97221678 GGCGGCTGCAGCTCGGGCGCAGG + Intergenic
1058341231 9:103899478-103899500 GGCTGGTATTGCTAGGGTTCAGG - Intergenic
1059326159 9:113505135-113505157 GGCTGGGGCTGCTGGGGCTCAGG + Intronic
1061924747 9:133800449-133800471 GTCTGCTGCTGCTGGGGCTGGGG + Intronic
1062436200 9:136547603-136547625 GCCTGGTGCTGATCGGGTGCGGG + Intergenic
1062570424 9:137182603-137182625 GGCTCCTGCTGCTCGGCTCCTGG + Intronic
1203605347 Un_KI270748v1:53489-53511 GTCTGTTGCTGCTGGGGATCAGG + Intergenic
1185952439 X:4451788-4451810 GGCAGCTGCAGCTCTGGTGCTGG - Intergenic
1187064820 X:15823122-15823144 GGCTCCTGCGGCTCCGGCTCCGG - Exonic
1187274645 X:17806775-17806797 GGCTTCTGCTTCTGGGGATCAGG + Intronic
1187505606 X:19875877-19875899 AGCTGCTGCTTCTTGGGGTCCGG + Intronic
1187655267 X:21464316-21464338 GGCAGCTGCTGCCCAGGTTTGGG + Intronic
1188837672 X:34978407-34978429 GGCAGCTGCTGCTAGGGATGGGG - Intergenic
1190285204 X:48957131-48957153 GGCGGCTGCTGCTCCGGGCCTGG - Exonic
1190760086 X:53431703-53431725 GGCTGCTGCTGCTTAGGTGGTGG + Intronic
1191830125 X:65407263-65407285 GGCCGCTGCTCCTCGAGCTCGGG - Intronic
1192639588 X:72849132-72849154 GGCAGCTGCTGCTTGGCTCCAGG + Intergenic
1192642123 X:72871673-72871695 GGCAGCTGCTGCTTGGCTCCAGG - Intergenic
1193807982 X:86016467-86016489 GGCTGGAGCTGCTGGGGCTCAGG - Intronic
1193816227 X:86107615-86107637 GGCTGGTGCTGCTGGGATGCAGG + Intergenic
1195432663 X:104806734-104806756 GGCTGCTGCTGCTGAGGTTGGGG + Intronic
1196189408 X:112779243-112779265 TGCTGCTGCTGCTGCTGTTCAGG - Exonic
1197147421 X:123185151-123185173 GCCTGCTGCTGCCCGGGTCTGGG - Intronic
1197449606 X:126595017-126595039 TGCTGCTGTTGCTGGGGTTGGGG + Intergenic
1197796662 X:130305487-130305509 AGCTGCTGCTGCCCGGGTGTTGG + Intergenic
1197987313 X:132279506-132279528 CGCTGCTGCTGCTGGGGTGGGGG + Intergenic
1198841719 X:140864799-140864821 GTCTCCTGCTGCTAGGATTCTGG - Intergenic
1199358189 X:146885861-146885883 CACTGCTGCTGCTGGGGGTCGGG - Intergenic
1200215039 X:154364468-154364490 TGCTGCTCCTGCTTGGGGTCTGG - Intronic
1202387534 Y:24339929-24339951 GTCTGTTGCTGCTGGGGATCAGG + Intergenic
1202483252 Y:25330199-25330221 GTCTGTTGCTGCTGGGGATCAGG - Intergenic