ID: 954037977

View in Genome Browser
Species Human (GRCh38)
Location 3:47863342-47863364
Sequence TACAGCTCTCCCTCCTTAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 113}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954037973_954037977 -8 Left 954037973 3:47863327-47863349 CCACCACCTCTAGGCTACAGCTC 0: 1
1: 0
2: 1
3: 23
4: 223
Right 954037977 3:47863342-47863364 TACAGCTCTCCCTCCTTAGGTGG 0: 1
1: 0
2: 0
3: 9
4: 113
954037971_954037977 13 Left 954037971 3:47863306-47863328 CCTCACTCACTTTAATAAAGTCC 0: 1
1: 0
2: 1
3: 15
4: 159
Right 954037977 3:47863342-47863364 TACAGCTCTCCCTCCTTAGGTGG 0: 1
1: 0
2: 0
3: 9
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954037977 Original CRISPR TACAGCTCTCCCTCCTTAGG TGG Intronic
903209688 1:21810501-21810523 AACAGCTCTCCCTCCTGGAGCGG - Intergenic
903432102 1:23312865-23312887 TTCATCTCTCCTTCCTTGGGGGG - Intronic
903938015 1:26910039-26910061 CACAGGTCTGCCTACTTAGGGGG + Intronic
905219789 1:36437156-36437178 TGTAACTCCCCCTCCTTAGGTGG - Intronic
906661097 1:47582896-47582918 TCCAGTTGTCCCTCCATAGGTGG + Intergenic
908584710 1:65555016-65555038 TTCAGCTCACCCTCCGTGGGCGG + Intronic
918413423 1:184284110-184284132 TATAGCTATCCCTCCCTTGGAGG + Intergenic
1064139801 10:12780934-12780956 TACAAGTCTCCCCACTTAGGGGG - Intronic
1065907711 10:30272754-30272776 TCCAGCTCTGCCTCCTCAAGTGG + Intergenic
1067451219 10:46383231-46383253 CTCAGCTCTCCCTCCTTAGCTGG - Intronic
1067586023 10:47476520-47476542 CTCAGCTCTCCCTCCTTAGCTGG + Intronic
1068908913 10:62357692-62357714 TACAGCTGTCCCTTTTCAGGTGG - Intergenic
1074969196 10:118521688-118521710 TACAGCTCTCTTTCCTTTGATGG - Intergenic
1078417895 11:11180659-11180681 TACTGGGCTCCCTCCTCAGGAGG - Intergenic
1088858667 11:113779836-113779858 TACTTCTCTCCCTCCTTGGCTGG + Exonic
1091887507 12:4027325-4027347 CACAGCACTCCCTTTTTAGGTGG + Intergenic
1092918487 12:13209352-13209374 TAGAGGTCTCCCCCCTTAAGGGG + Intronic
1095038953 12:37421803-37421825 TGAAGCTCCCCCTCCTTTGGTGG - Intergenic
1095049470 12:37543570-37543592 TTGAGCTCTCCCTCCATCGGTGG + Intergenic
1095975535 12:47938636-47938658 TACAGCCCTCACTCCTCTGGAGG - Intronic
1096853006 12:54454771-54454793 AACAGCTCTGCTTCATTAGGGGG + Intergenic
1100134483 12:91538255-91538277 TACATCTCTGCCTCTTTTGGTGG - Intergenic
1100168215 12:91942572-91942594 TATAGCTCTCTCTCCTCAAGTGG - Intergenic
1100690463 12:97033856-97033878 GACAGCTCTCCCTCACTATGGGG + Intergenic
1104058969 12:125252002-125252024 TACAACTCTCCCCAGTTAGGTGG - Intronic
1106042252 13:26104187-26104209 TCAAGCTCTGCCTCCTTAAGTGG + Intergenic
1106455845 13:29925890-29925912 TCCAGTTCTCCTTCATTAGGGGG - Intergenic
1109112211 13:58335663-58335685 TACAGCTAGCCATCCTTAGCTGG - Intergenic
1112185615 13:97125369-97125391 TGCAGCACTGCCTCTTTAGGAGG - Intergenic
1112963720 13:105161023-105161045 TACAGATCCCCCTTCTTAGTAGG - Intergenic
1113634551 13:111910595-111910617 ACCAGCTCTCCCTCCCTGGGTGG - Intergenic
1113662388 13:112116588-112116610 TACAGCTCTCCCCGCATAGCAGG - Intergenic
1114666568 14:24380807-24380829 TCCAGCCCTCCCTCCCAAGGAGG - Intergenic
1118353543 14:64991780-64991802 AACAGCTCTCCCTCCTTGAATGG - Intronic
1121492751 14:94371855-94371877 TCCTGCTGTCCCTCCTCAGGAGG + Intergenic
1122806232 14:104260088-104260110 CTCAGATCCCCCTCCTTAGGTGG - Intergenic
1123007604 14:105331698-105331720 TTCAGCTCTCCTTCCTTTGGAGG - Intronic
1125759246 15:42085742-42085764 AACAGGTCTCCCTCCCTTGGAGG + Intronic
1128298691 15:66548489-66548511 CTCAGCTCTGCCTCCTCAGGAGG + Exonic
1128589221 15:68879914-68879936 AACAGCTCTCACTCCGTAGAGGG - Intronic
1130077674 15:80703794-80703816 TACAGCTATCCCCCCTTACCTGG + Intronic
1131815178 15:96214720-96214742 TTCAGCAACCCCTCCTTAGGAGG + Intergenic
1132082356 15:98877639-98877661 TCCAACGCTACCTCCTTAGGAGG - Intronic
1135592209 16:23712823-23712845 TACACCTCTCCCTGCTGAAGAGG + Intronic
1136076365 16:27820081-27820103 TCCATCTCTCCCTCCATAAGTGG - Intronic
1137359997 16:47805666-47805688 CACAGCTCTCCCTCCTTCTCTGG - Intergenic
1137698146 16:50476553-50476575 TACAGCCTTCCTTCCTCAGGAGG - Intergenic
1139642637 16:68303747-68303769 TATAGCTATCCATTCTTAGGGGG - Intronic
1141525807 16:84610704-84610726 TCCAGCATTCCCTCCTTTGGGGG - Intronic
1142174465 16:88638862-88638884 TACAGCCCTCCCTCTATAGATGG - Intronic
1142419530 16:89961889-89961911 TCCTGCTCTCCCTCCCCAGGGGG - Intronic
1142806282 17:2372747-2372769 TTCTGCTCTCCTTCCTTAAGGGG - Intronic
1145826054 17:27878056-27878078 TACAGCCCTGCCACCTGAGGAGG + Intronic
1147537081 17:41328060-41328082 TACAGCTTTCCCACCCCAGGCGG + Intergenic
1147729449 17:42589009-42589031 TATAGTTCTGCCTCCTTGGGGGG + Intronic
1151887199 17:76930081-76930103 GACAGCTCTCCCATCTCAGGAGG - Intronic
1152161736 17:78673020-78673042 TACAGCTCTCCCGGCTGGGGCGG + Intergenic
1153747026 18:8189690-8189712 CACAGGTCTCCCTCCTCAGCTGG + Intronic
1158472188 18:57746997-57747019 TGCAGCTCACCATCCTTAGGAGG - Intronic
1163894299 19:20044126-20044148 TAGAGCTCTCACACCTTAAGGGG - Intergenic
927307708 2:21592468-21592490 AACAGCACATCCTCCTTAGGGGG + Intergenic
930920425 2:56746777-56746799 TACAGCTCAGCCTCCCCAGGTGG - Intergenic
932084664 2:68747431-68747453 TACAGCACTCCATGCTTAGATGG - Intronic
937198838 2:120183664-120183686 TACAGCTCTCCCTCATGACTGGG + Intergenic
937223949 2:120357532-120357554 GACAGCTCTCCCTGCCTGGGAGG + Intergenic
937247355 2:120502278-120502300 TACAGTCCTAACTCCTTAGGAGG - Intergenic
941722429 2:168826207-168826229 TACACCCCTCATTCCTTAGGAGG - Intronic
945175725 2:207041468-207041490 GCCTGCTCCCCCTCCTTAGGAGG + Intergenic
946593828 2:221283310-221283332 TACACCTCTCCCTCTTTTTGGGG - Intergenic
1169754177 20:9025743-9025765 AATAGCTTTCCCTCCTTATGTGG + Intergenic
1170091647 20:12595666-12595688 CACAGCTCTGCCTCATTAGAAGG - Intergenic
1171531441 20:25856068-25856090 TGTAGCTCTCCCTCCCTTGGTGG - Intronic
1171544002 20:25987085-25987107 TCGAGCTCTCCCTCCATCGGTGG + Intergenic
1171573571 20:26276836-26276858 TGAAGCTCTCCCTCCCTTGGTGG + Intergenic
1173563097 20:44020308-44020330 TAATGCTCTCCCTCCCTTGGGGG - Intronic
1174552595 20:51372704-51372726 GACAGCTGTACCTACTTAGGGGG + Intergenic
1174642996 20:52061356-52061378 TCCAGATCCCCCTCCTTAGAGGG + Intronic
1176680299 21:9815748-9815770 TGAAGCTCTCCCTCCCTTGGTGG - Intergenic
1178623403 21:34196048-34196070 TAGAGCTCTCCCACTTTGGGAGG + Intergenic
1182577791 22:31284873-31284895 TACAGCCCTCCCTCCCTAAGAGG + Intronic
1184638633 22:45856643-45856665 TACAGCTGTCCCACTTCAGGTGG + Intergenic
950694438 3:14687549-14687571 TAAAGATCTCCCTCATTTGGGGG + Intronic
954037977 3:47863342-47863364 TACAGCTCTCCCTCCTTAGGTGG + Intronic
955722604 3:61899496-61899518 GACAGCTCTCTCTCCTGAAGGGG - Intronic
961432378 3:126892142-126892164 TACAGCTCGTCCTCCTCTGGAGG + Intronic
962350352 3:134651567-134651589 GACAGCTCTCTCTCCCTAGGAGG + Intronic
965375943 3:167924151-167924173 TTCAGCTCTAGCTCCTTAGATGG - Intergenic
966196655 3:177320586-177320608 TAAAGCTCTAGTTCCTTAGGGGG + Intergenic
966355703 3:179076360-179076382 TACAGCTGTCCCTCAGTATGTGG - Intergenic
970694766 4:18664244-18664266 CAGAGCTCTCCCTCCTGATGGGG + Intergenic
970901894 4:21169272-21169294 TACAGTCCTCGCTACTTAGGAGG - Intronic
977665309 4:99640220-99640242 TACAGCACTTGCTCCTTATGAGG - Exonic
979207728 4:118060826-118060848 TAATGCTCTCTCTCCTTTGGCGG + Intronic
984879244 4:184396199-184396221 TTCTGCTCTGCCTCCTTTGGTGG + Intronic
992365693 5:76086874-76086896 TACTGCTGTCCCTAATTAGGAGG - Intronic
994328281 5:98475074-98475096 TCCAGCTGTCCTTCCTTAGTTGG + Intergenic
994819097 5:104625337-104625359 GAAAGCTCTGCCTTCTTAGGAGG - Intergenic
997447517 5:133952245-133952267 GACAGCACTCCCACCTGAGGAGG - Intergenic
1000621141 5:163488470-163488492 TACAGCTCCCCCTCCTTTTGGGG + Intronic
1000825269 5:166037133-166037155 TCCAGCTTTCCATCCTTTGGTGG + Intergenic
1001019997 5:168174725-168174747 AACAGCTCTGCATCCTGAGGCGG + Intronic
1003587621 6:7407364-7407386 TACACCTCACACTCATTAGGGGG - Intronic
1003796746 6:9613557-9613579 TACATCTCCACTTCCTTAGGTGG + Intronic
1005736879 6:28756197-28756219 AACAGCTCTTCCTCCTCAGCAGG + Intergenic
1007192304 6:40029936-40029958 TCCAGCTGTCCCTCATTTGGTGG + Intergenic
1018787162 6:167117018-167117040 GACAGCTCTCCCGCCACAGGAGG - Intergenic
1019810632 7:3162749-3162771 AACAGCACTCCCTCCTAAGGAGG - Intronic
1019999983 7:4750068-4750090 TCCAGCTCTCTCGCCTGAGGCGG + Intronic
1023620948 7:42071904-42071926 AACAGCTCTCCTTACTTAGGTGG + Intronic
1025295378 7:57772164-57772186 TCGAGCTCTCCCTCCATCGGTGG + Intergenic
1027870046 7:83695306-83695328 TGCAGCTCTCCCTCCATGGCAGG + Intergenic
1029402892 7:100356611-100356633 CACAGGGCTCCCTCCATAGGAGG - Intronic
1029405544 7:100372497-100372519 CACAGGGCTCCCTCCGTAGGAGG - Intronic
1030803010 7:113877458-113877480 TACAGCTGTTGCTCCTTAGCAGG - Exonic
1035033791 7:155882195-155882217 GACAGCGCTCCCTCCCGAGGCGG + Intergenic
1036805345 8:11828164-11828186 TATAGTTCTCGCTCCTTGGGAGG + Intronic
1039819132 8:41120774-41120796 CACAGCCTTCCTTCCTTAGGGGG - Intergenic
1041048826 8:53913586-53913608 TGAAGCTCTCCCTCCTTATAAGG - Intronic
1057452639 9:95178436-95178458 TGGAGCCCTCACTCCTTAGGAGG + Intronic
1058880524 9:109282179-109282201 TATAGATTTCCCTCCTTTGGAGG - Intronic
1060416700 9:123435752-123435774 TGCAGCTCTCCCTCCTTGCCAGG - Intronic
1191108707 X:56788668-56788690 TACAGCTTGCCCTCCTTGGCTGG - Intergenic
1202135102 Y:21653091-21653113 TACAGCTGTCCTTTCTCAGGTGG - Intergenic