ID: 954042849

View in Genome Browser
Species Human (GRCh38)
Location 3:47902706-47902728
Sequence CAGTTGAATCAGAGGGCAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 178}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954042849 Original CRISPR CAGTTGAATCAGAGGGCAAG TGG Intronic
906065424 1:42977169-42977191 CAGTTGAACCAGAGAGGCAGAGG - Intergenic
906295749 1:44648078-44648100 CAGCAGAAACAGAGGCCAAGAGG - Intronic
906430381 1:45750959-45750981 CACAAGAATCAGAGTGCAAGCGG - Intergenic
906453483 1:45972849-45972871 TAGTGGAATCATAGGGGAAGAGG + Intronic
906733803 1:48105299-48105321 CAAATCAAGCAGAGGGCAAGTGG - Intergenic
908583273 1:65540503-65540525 CAGGTGCATCACATGGCAAGGGG - Intronic
909839791 1:80305669-80305691 CAGTGGAAGCAGAATGCAAGAGG + Intergenic
909970904 1:81987979-81988001 AAGTAGACTCAGCGGGCAAGTGG + Intronic
910280472 1:85495037-85495059 CAGTTCCAGCAGAGGGCAGGCGG + Intronic
913454265 1:119015010-119015032 CAGGTAAATGAGAGGGAAAGTGG - Intergenic
913457383 1:119047370-119047392 CATTTGAATCAGAGTTAAAGAGG - Intronic
913597196 1:120389542-120389564 CAGGTCAAACAGAAGGCAAGCGG - Intergenic
914090128 1:144489764-144489786 CAGGTCAAACAGAAGGCAAGCGG + Intergenic
914308480 1:146444458-146444480 CAGGTCAAACAGAAGGCAAGCGG - Intergenic
914514277 1:148361035-148361057 CAGGTCAAACAGAAGGCAAGCGG + Intergenic
914593629 1:149128675-149128697 CAGGTCAAACAGAAGGCAAGCGG + Intergenic
917504216 1:175613567-175613589 CTCTGGAATCAGAGGGCAGGAGG - Intronic
918400024 1:184153963-184153985 CCTGTGAATCAGAGGGCAAGGGG - Intergenic
918668049 1:187177291-187177313 CAGGAGAAACAGAGAGCAAGGGG + Intergenic
920279281 1:204830545-204830567 CAGTTGAATCCAAAGACAAGGGG - Intronic
921273013 1:213489586-213489608 CAGTTGAATGAGAGAGATAGAGG + Intergenic
922717575 1:227885292-227885314 CAGGTGCAGCAGAGGGCAGGCGG + Intergenic
922869627 1:228891665-228891687 CTGTTGAAGCACAGAGCAAGGGG + Intergenic
923954505 1:239000275-239000297 GAGTAGAATTAGAGGGCAGGAGG + Intergenic
1065042890 10:21715748-21715770 CAGTTGAGTCACATGTCAAGTGG - Intronic
1067546015 10:47193172-47193194 CAGGGGAAACAGAGGGCAGGAGG + Intergenic
1069329635 10:67277245-67277267 CAGTTGCATCAGAAGGCAGTGGG - Intronic
1072327477 10:94312639-94312661 CAGTTGAATGAGATAGCTAGAGG - Intronic
1072773995 10:98170815-98170837 AAGCAGAATCAGAGAGCAAGAGG - Intronic
1074050930 10:109880851-109880873 CAGCTGAGTCAGAAGGCATGAGG - Exonic
1074454562 10:113586081-113586103 CAGATGCACCAGAGGGCCAGGGG - Intronic
1075153519 10:119955825-119955847 CAGTTGCAGCAGAGGCCCAGTGG + Intergenic
1075510268 10:123066827-123066849 GAAGTGCATCAGAGGGCAAGAGG + Intergenic
1077228182 11:1447372-1447394 GAGTTGCAGCAGAGGCCAAGAGG - Intronic
1078430948 11:11288057-11288079 CAGGTGGATCAGAAGGAAAGAGG - Intronic
1080109492 11:28549409-28549431 CAGTTGAATAAAAGGGGAAGAGG - Intergenic
1080193402 11:29578794-29578816 CAGTGGAATGAGAGAGGAAGTGG - Intergenic
1080876687 11:36281163-36281185 CAGCTGAAGAAGAGGGCAACAGG + Intronic
1080958134 11:37125488-37125510 TAGTGGAATCAGATGGCAGGAGG - Intergenic
1081120521 11:39259777-39259799 CACTTGAATCCGAGGGGCAGAGG + Intergenic
1082110196 11:48265559-48265581 TAGTTGATTCAGAAGGCAATGGG - Intergenic
1083488569 11:62998687-62998709 CAGCTGAAGAAGAGGGTAAGTGG - Intronic
1085284279 11:75349993-75350015 CAGAGGAACCAGAGGGCTAGAGG - Intronic
1085346567 11:75771884-75771906 CTGTTGAATTTGAGGGCAGGAGG - Intronic
1086887225 11:92220203-92220225 AGGTTTAATCAGAGGCCAAGAGG + Intergenic
1086989741 11:93289925-93289947 CAGTTATATCAAAGGGCAGGAGG + Intergenic
1087159745 11:94937024-94937046 CAGTAGAATGAGAAGGAAAGAGG - Intergenic
1089623303 11:119735227-119735249 CAGTTGAGGCTGAGAGCAAGGGG + Intergenic
1089982368 11:122782885-122782907 CAGTAGAATAAGGGGGTAAGGGG - Intronic
1092730284 12:11525847-11525869 CACTTGTATCATAGAGCAAGAGG + Intergenic
1093031486 12:14293170-14293192 CATTTGAATCAGTGGGCTGGGGG - Intergenic
1094058267 12:26287721-26287743 CAGCTGAATCAGAAGGGCAGCGG - Intronic
1095320554 12:40820529-40820551 CAGTGGAATCATAGAGCCAGTGG + Intronic
1097325477 12:58271637-58271659 CAGTTGCATCAAAGCGCCAGAGG - Intergenic
1098316338 12:69197457-69197479 CACTTGCAGCAGAAGGCAAGGGG + Intergenic
1098398548 12:70048901-70048923 CAGTTTAATGTGAGAGCAAGGGG + Intergenic
1099505927 12:83476010-83476032 CAGTCTAATCAGAGAACAAGTGG - Intergenic
1100555205 12:95686456-95686478 AAGTTGAAAAGGAGGGCAAGGGG + Intronic
1100565055 12:95787736-95787758 CACTTTAGGCAGAGGGCAAGAGG + Intronic
1102057942 12:109910793-109910815 CAGGTGTATCCGAGGGCATGTGG + Intronic
1104728237 12:131090813-131090835 CAGGTGAATCTGTGGGCAAAGGG + Intronic
1106005118 13:25762395-25762417 CTCTTGAATCACAGGACAAGTGG + Intronic
1106695079 13:32164222-32164244 CAATTGAATCCGAAGGCAACTGG - Intronic
1110980399 13:81890016-81890038 CAGTGCCAGCAGAGGGCAAGAGG - Intergenic
1112880846 13:104104716-104104738 CAGGGAAATCAGAGGGAAAGGGG - Intergenic
1119129621 14:72159450-72159472 CAATTGACTGAGAGGCCAAGAGG - Intronic
1119595618 14:75930621-75930643 CAAGTGGATCAGAGGTCAAGTGG + Intronic
1121113967 14:91330909-91330931 GAGGAGAAGCAGAGGGCAAGGGG + Intronic
1121402405 14:93691465-93691487 CAGTTTCATTAAAGGGCAAGGGG + Intronic
1121955122 14:98206486-98206508 CAGTGGCAACAGAGGGCCAGAGG - Intergenic
1125199041 15:37083177-37083199 TAGAATAATCAGAGGGCAAGGGG - Intronic
1126439782 15:48675014-48675036 CAGTTGAAGCAGAGTTCAAACGG - Intergenic
1129189650 15:73929952-73929974 CAGTTGATTGAGAGGGGAATGGG + Intronic
1130783367 15:87069130-87069152 CAGTTGTATCAGAGGCCTTGAGG + Intergenic
1131426868 15:92352852-92352874 CAGATGTTTCAGAGGGCAAAGGG - Intergenic
1133402764 16:5500786-5500808 CAGTTGACTCAGAGGCTAACTGG + Intergenic
1136481654 16:30545799-30545821 CAGTTAAATCAGAGAGAAAAAGG + Intronic
1136533117 16:30883065-30883087 CTGTTGATTCAAAGGGCAGGTGG + Intronic
1137405899 16:48189171-48189193 CAGAGGAATCAAAGGGCAAAAGG + Intronic
1138714285 16:59003913-59003935 CAGTTTAATCAGATGGCTATTGG + Intergenic
1139494135 16:67303629-67303651 CAGTTGAATCTGAGAGACAGAGG - Intronic
1140258785 16:73359337-73359359 GGGGTGAATAAGAGGGCAAGAGG + Intergenic
1140575007 16:76157582-76157604 CATTTGAATCACAGGGGAAAAGG - Intergenic
1142244681 16:88964556-88964578 CAGGTGATTCAGAGGGGACGAGG - Intronic
1143184583 17:5002653-5002675 CTGATGGAGCAGAGGGCAAGGGG + Intronic
1144699760 17:17329334-17329356 CAGTTGAAGCTGAGGGTTAGCGG + Intronic
1144807743 17:17978788-17978810 GAGGGGAAACAGAGGGCAAGCGG - Intronic
1146925279 17:36740177-36740199 CAGTTGACTGGGACGGCAAGGGG - Intergenic
1147188230 17:38724504-38724526 CACTGGAATCAGGAGGCAAGAGG - Intronic
1147439148 17:40436817-40436839 TTGTTGAGTCAGAGGGCAGGTGG - Intergenic
1150565324 17:66333880-66333902 TAGTATAATCAGAGGGTAAGGGG - Intronic
1154423553 18:14254885-14254907 CAGTTGTCTCACATGGCAAGGGG - Intergenic
1155503581 18:26511631-26511653 AAGTTGACTCTGAGGTCAAGTGG + Intronic
1155725113 18:29072050-29072072 CAGTTTGATCAGAGGTCATGTGG - Intergenic
1156201994 18:34843766-34843788 CAGTGGATTCAGTGGGGAAGTGG - Intronic
1157283408 18:46360738-46360760 CAGGCGTATTAGAGGGCAAGGGG - Intronic
1158392251 18:57053103-57053125 CAGCTGAGTCAGATTGCAAGGGG - Intergenic
1161747827 19:6072218-6072240 CAGTTGAATCAGAAGAGAAGCGG - Intronic
1163069187 19:14824027-14824049 CATGTGAATCAGAGGGGAAAAGG - Intronic
1164885765 19:31777215-31777237 CAGGTGACTCAGTGGGCATGGGG + Intergenic
1166131829 19:40750284-40750306 CCTTTGAGTCAGAGGTCAAGAGG + Intronic
925423082 2:3727248-3727270 CAGCTGAATCAGAGAGAAGGTGG - Intronic
929285011 2:40126058-40126080 CAGATGAATGTGAGGGCACGAGG + Intronic
936834019 2:116684813-116684835 CAGCTGAATAACAGGGCTAGGGG + Intergenic
937064137 2:119004516-119004538 GAGGGGAATCAGTGGGCAAGTGG + Intergenic
937847918 2:126601708-126601730 AAGGTGAGACAGAGGGCAAGTGG - Intergenic
939146987 2:138427055-138427077 AATTTCAAGCAGAGGGCAAGTGG - Intergenic
939464294 2:142537881-142537903 CAGTTGAAACAAAGGGCATTTGG - Intergenic
940739660 2:157492881-157492903 AAGTTGAATTAGTGGGCAGGAGG - Intergenic
940904270 2:159154556-159154578 CAGTTGAAACAAGGGGCAGGAGG - Intronic
941297212 2:163754778-163754800 CAGCTAAATGGGAGGGCAAGAGG - Intergenic
943760950 2:191608456-191608478 GAGTTGTAGCAGAGGGGAAGGGG + Intergenic
1171389035 20:24789499-24789521 GAGCTGAAGCAGAGGGCAGGGGG - Intergenic
1171885657 20:30650429-30650451 CAGTTGTCTCACATGGCAAGGGG + Intergenic
1176869704 21:14075040-14075062 CTGTTGTAGCAGAGGGCATGGGG + Intergenic
1182192539 22:28477782-28477804 CAGTTGTACGAGAGGGCAGGTGG - Intronic
1183211193 22:36452460-36452482 CAATTGATTCAGAGGGTAAAGGG - Intergenic
1183418209 22:37694933-37694955 CACTTGAACCCGAGGGCCAGAGG + Intronic
949911991 3:8918792-8918814 CAGTATTATCAGAGAGCAAGTGG + Intronic
950480984 3:13243578-13243600 CAGTAGAAGCTGAGGTCAAGCGG + Intergenic
951200191 3:19868007-19868029 CAGTTGTATAAGAGGACAACAGG - Intergenic
952558378 3:34559905-34559927 CAGGTGTCTCACAGGGCAAGAGG + Intergenic
952779627 3:37082975-37082997 CAGTTCAAGCAGAGGTCAAATGG - Intronic
954042849 3:47902706-47902728 CAGTTGAATCAGAGGGCAAGTGG + Intronic
957792689 3:84959897-84959919 CAGGTGAATGAGAAGGCAAAAGG - Intronic
959815535 3:110669820-110669842 CAGTTGTGGCAGAAGGCAAGAGG - Intergenic
959845374 3:111026534-111026556 CAGGTGAAACACAGGGCATGAGG - Intergenic
959938390 3:112054512-112054534 TAGTGGAATCAGTGTGCAAGGGG + Intronic
962009411 3:131379827-131379849 CAGTTGAATCAGAATGTATGGGG - Intergenic
964381846 3:156105314-156105336 CAGAAGAATGAGAGGGCAAGAGG + Intronic
969674014 4:8605036-8605058 CACTGGAATTTGAGGGCAAGAGG + Intronic
970559600 4:17269664-17269686 AACTTGATTCTGAGGGCAAGAGG - Intergenic
970616453 4:17772649-17772671 CAGTTAGATCAGTGGGGAAGAGG - Intronic
970689621 4:18607514-18607536 CACTGGAATCAGAGGGGAAGTGG - Intergenic
972307124 4:37841719-37841741 AAGTTAAATCAGAGGGGCAGAGG - Intronic
976607148 4:86994757-86994779 CAGCTGGAGCAGAGGGAAAGGGG + Intronic
983281953 4:165692278-165692300 CTGTTGAGTCAGTGGGCATGAGG - Intergenic
984451679 4:179911335-179911357 CAGCAGAGTCAGAGGACAAGGGG - Intergenic
984500413 4:180551319-180551341 TAGTAGAACCAGAGGCCAAGAGG - Intergenic
985483080 5:129918-129940 CAGTAAAATCAGTGGGCAAGAGG + Intergenic
986859176 5:11905389-11905411 CTGCTGAATCAGAGGGACAGGGG - Intergenic
987338175 5:16915569-16915591 CAGGCCAATCAGAGGTCAAGTGG + Intronic
991534564 5:67653177-67653199 AAGTTGAAATAGAGAGCAAGTGG + Intergenic
993759672 5:91777895-91777917 CAGTTGAATCAGAGGAGAAAAGG + Intergenic
995479989 5:112583991-112584013 CACTTGAACCACAGAGCAAGAGG - Intergenic
995640873 5:114255816-114255838 CTGTTGAATCACAGAGGAAGTGG - Intergenic
1000859817 5:166443898-166443920 CAGTAGCAGCAGAAGGCAAGAGG - Intergenic
1001081634 5:168671777-168671799 CAGTGGGATCATAGGGCAATGGG - Intronic
1004780546 6:18903704-18903726 CAGGTGGCTTAGAGGGCAAGAGG + Intergenic
1006890852 6:37426879-37426901 CACTTCAACCAGAGGGCAAGAGG + Intergenic
1007326129 6:41061414-41061436 TGGTTGAAGCACAGGGCAAGGGG + Exonic
1007650644 6:43418522-43418544 AAGTTAAGTCAGAGGACAAGAGG - Intergenic
1007760898 6:44133285-44133307 CACTTCAACCACAGGGCAAGAGG - Intronic
1007936732 6:45738919-45738941 CTGTTAATTCAGAGGGTAAGAGG + Intergenic
1008086505 6:47250743-47250765 CAAGTGAATCAGAAGGCAGGGGG - Intronic
1008230247 6:48978213-48978235 CAGATGAATCAGTGAGTAAGTGG + Intergenic
1009937084 6:70246555-70246577 AATTAGAATCAGAGGGCAAGGGG - Intronic
1011216908 6:85014786-85014808 CAGCTGAACAGGAGGGCAAGGGG + Intergenic
1012339671 6:98104550-98104572 CAGATGAAGCAGAGTGCTAGTGG + Intergenic
1013873681 6:114798738-114798760 CAGTTACATCAGGGGCCAAGAGG - Intergenic
1016376880 6:143430344-143430366 CATCTGAATCAGAAGGCAGGGGG - Intronic
1018896425 6:168021422-168021444 CATTTGAAGCAGAGAGAAAGGGG - Intronic
1019064335 6:169283530-169283552 CAGGTGAATGGGAGGGCATGAGG + Intergenic
1021864226 7:24938967-24938989 CAAATGAAACAGAGTGCAAGGGG + Intronic
1022270827 7:28806185-28806207 GACTTGAAACAGAGGGCAATTGG - Intronic
1024633038 7:51264766-51264788 CAGCTGAGGTAGAGGGCAAGTGG + Intronic
1026653515 7:72236367-72236389 CAGTTGATTCGGAGGGCGGGTGG - Intronic
1026875487 7:73876953-73876975 CAATGGAATCGGAGGGCAGGCGG - Intergenic
1027824206 7:83089820-83089842 GAGGTGATTCAGAAGGCAAGGGG - Intronic
1028874226 7:95802405-95802427 CAGTTGAATCAGAGAGAAGTTGG + Intronic
1033969604 7:147023751-147023773 CAGGTGACTCAGAAGGCAACTGG - Intronic
1037581960 8:20250689-20250711 CAGGAGAATCAGAGGGGAGGCGG - Intronic
1037732340 8:21537599-21537621 AAGTTCACTCAGAGGGTAAGGGG - Intergenic
1038326144 8:26574188-26574210 CAGTTGTTTCAGAGGGAAGGAGG + Intronic
1044277767 8:90322126-90322148 CAGTGGAGTCAGTGGGCAGGAGG + Intergenic
1045244313 8:100429579-100429601 CACTTGAATCTGAGAGGAAGAGG - Intergenic
1045414250 8:101950905-101950927 GAGTTGACTCAGATGGCAATAGG + Intronic
1047287437 8:123500055-123500077 CAGTTGAATGGGAGGGCAAATGG - Exonic
1048305671 8:133282759-133282781 CAGTTGCAACAGAGGTCATGTGG + Intronic
1048632830 8:136262704-136262726 CAGGGGAGTCAGCGGGCAAGGGG - Intergenic
1051153171 9:14107814-14107836 CAGTTGAATCAGGGAGGTAGAGG - Intronic
1053498586 9:38566765-38566787 CAGTTGTCTCACACGGCAAGAGG + Intronic
1058961250 9:109994788-109994810 CAGCAGAGTCAGAGAGCAAGGGG - Intronic
1186130474 X:6460323-6460345 CAGTTGAGTCAGAGACCACGTGG + Intergenic
1188543478 X:31275808-31275830 CAATTGAATGTGAGGGCTAGAGG + Intronic
1192185533 X:68944398-68944420 AAGTTGAAGCAGAGGGCCAGGGG - Intergenic
1193331791 X:80243202-80243224 CACTTGAACCAGAGAGCCAGTGG - Intergenic
1194922264 X:99780666-99780688 CTGCTGTATCAGAGGGCAAAAGG - Intergenic
1195618168 X:106929226-106929248 CAGGTAAACCAGAGGGCAAAGGG - Exonic
1198441273 X:136665689-136665711 CAGTTTAATTACAGGGCAACAGG + Exonic
1199142616 X:144331362-144331384 CAGGAGAATCAGAGGACAAGTGG + Intergenic