ID: 954043869

View in Genome Browser
Species Human (GRCh38)
Location 3:47912157-47912179
Sequence CTTGAACCCCAGAGGGATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 147}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954043869_954043875 27 Left 954043869 3:47912157-47912179 CCAAGATCCCTCTGGGGTTCAAG 0: 1
1: 0
2: 1
3: 13
4: 147
Right 954043875 3:47912207-47912229 GTTCCCAGGCCCACCACAGGAGG 0: 1
1: 0
2: 1
3: 21
4: 190
954043869_954043873 13 Left 954043869 3:47912157-47912179 CCAAGATCCCTCTGGGGTTCAAG 0: 1
1: 0
2: 1
3: 13
4: 147
Right 954043873 3:47912193-47912215 ATACTTTTTCTTTGGTTCCCAGG 0: 1
1: 0
2: 6
3: 31
4: 326
954043869_954043874 24 Left 954043869 3:47912157-47912179 CCAAGATCCCTCTGGGGTTCAAG 0: 1
1: 0
2: 1
3: 13
4: 147
Right 954043874 3:47912204-47912226 TTGGTTCCCAGGCCCACCACAGG 0: 1
1: 0
2: 1
3: 16
4: 175
954043869_954043872 5 Left 954043869 3:47912157-47912179 CCAAGATCCCTCTGGGGTTCAAG 0: 1
1: 0
2: 1
3: 13
4: 147
Right 954043872 3:47912185-47912207 CAACATGAATACTTTTTCTTTGG 0: 1
1: 0
2: 1
3: 19
4: 326

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954043869 Original CRISPR CTTGAACCCCAGAGGGATCT TGG (reversed) Intronic
903134393 1:21300010-21300032 TTAGAACCCCTGAGGGAGCTGGG - Intronic
905307840 1:37031828-37031850 CTTGAACCCCAGCTGGAGCCAGG - Intronic
906682062 1:47734466-47734488 CTTGAACCCCAGAGGGGTGGGGG - Intergenic
914390062 1:147213162-147213184 CTTGTTCCCCAGAAGGATGTTGG - Intronic
914976705 1:152371146-152371168 CTTGAGCCCCAGAGGGGCCAAGG + Intergenic
915442522 1:155954228-155954250 CTTTAATCCCAGAAGGATTTGGG - Intronic
917207262 1:172590233-172590255 CTTGATTCCCAGAGGGCTCATGG + Intronic
920336910 1:205251003-205251025 CTGGCACCCCAGAGGGGACTGGG - Intronic
920374465 1:205500117-205500139 CTGCATCCCCAGAGGGTTCTAGG - Intergenic
921555923 1:216598995-216599017 CTTGAGTGCAAGAGGGATCTGGG + Intronic
922163098 1:223092765-223092787 TTTGAACCCAAGAGGGTTCATGG - Intergenic
924709732 1:246522360-246522382 CCTGAAACCCAGAGGGAGCCAGG + Intergenic
1064063709 10:12162257-12162279 CATGAACCATAGAGGTATCTCGG - Exonic
1065677366 10:28192040-28192062 CTTGAACCCCAGAGGCAGCCTGG + Intronic
1066548887 10:36533152-36533174 CTTGAACCCCAGGGGGGTGGAGG + Intergenic
1067563238 10:47318777-47318799 CAAGAACCCCAGAAGGGTCTAGG - Intergenic
1069554008 10:69384857-69384879 CGTGAAGCCCAGAGGCATCCTGG - Exonic
1070303997 10:75227240-75227262 CTTGAACCCCAGGGGGTTGTGGG + Intronic
1075546924 10:123362160-123362182 CTTGTGTCCCAGAGGGAGCTTGG + Intergenic
1075726391 10:124612965-124612987 CTGGAGGCCCAGAGGGAGCTGGG + Intronic
1076091328 10:127688721-127688743 CTTGAACAACAGAGGGATTAGGG + Intergenic
1076304464 10:129454771-129454793 CTTGAGCCCAAGAAGGATGTGGG - Intergenic
1077435916 11:2539123-2539145 CTTGCCCCCCAGAGGGACCACGG - Intronic
1078080949 11:8204467-8204489 CTTGAACCCCAGAGCAAGTTAGG - Intergenic
1082227158 11:49721594-49721616 CTTTGACCCCAGAAGTATCTTGG - Intergenic
1082834663 11:57642786-57642808 CTGGACCCTGAGAGGGATCTTGG + Intergenic
1086622263 11:88901498-88901520 CTTTGACCCCAGAAGTATCTTGG + Intronic
1088703706 11:112440774-112440796 TTTCCACCCCAGATGGATCTGGG + Intergenic
1089367093 11:117927501-117927523 CTGGATCTTCAGAGGGATCTTGG - Intronic
1091890179 12:4047300-4047322 CTTGAACGCCAGTGGTATATCGG + Intergenic
1093300543 12:17448799-17448821 CATGACACCCAGAGGCATCTTGG + Intergenic
1096482801 12:51953072-51953094 ATTGACCCACAGATGGATCTGGG + Intronic
1097141104 12:56903033-56903055 CTTGACCCCCAGAGTCATCTGGG - Intergenic
1102998065 12:117364852-117364874 CCTGAACCCCAGAGAGGTCCTGG - Intronic
1105543695 13:21336859-21336881 CTTGAGCTCCACCGGGATCTAGG - Intergenic
1106138495 13:26991922-26991944 CTTGCTATCCAGAGGGATCTTGG - Intergenic
1107377552 13:39820822-39820844 CTGGAATTCCAGAGGCATCTAGG - Intergenic
1107819067 13:44269950-44269972 CATGTAACCCAGAGGGTTCTTGG - Intergenic
1110175404 13:72549871-72549893 ATTTTTCCCCAGAGGGATCTTGG - Intergenic
1111053617 13:82919239-82919261 CTTGAACCTCAGAGAGTTATGGG - Intergenic
1112243070 13:97701677-97701699 CTTGAACCCAGGAGGTGTCTGGG + Intergenic
1112656066 13:101453731-101453753 CTTGGACCCCAGAGAGATGTGGG + Intronic
1117325246 14:54662843-54662865 GTTGACCCCCAGAGAGGTCTTGG + Intronic
1121252666 14:92511526-92511548 CTTCAACCCCAGCGGCTTCTGGG - Intergenic
1122319706 14:100846386-100846408 CGCGAGCCCCAGAAGGATCTGGG + Intergenic
1122965314 14:105121208-105121230 GTTGAACCACAGAGTGATCTTGG - Intergenic
1123032262 14:105457499-105457521 CTTCCACCCCAGGGGGTTCTGGG - Intronic
1123945111 15:25235165-25235187 GGTGACCCCCAGAGGGATGTGGG - Intergenic
1124087342 15:26563267-26563289 AATGAACCCCAGAGGGACCTGGG + Intronic
1125207105 15:37166198-37166220 CTTGTACCCCATAGGCATGTAGG - Intergenic
1127289169 15:57554873-57554895 CCGGAGCCCCAGAGGGAGCTTGG - Intergenic
1127581052 15:60339777-60339799 CTTGAACCCCAGTGGAAGCCTGG - Intergenic
1127702694 15:61516647-61516669 TTTGAACCCTAGAGGTTTCTAGG - Intergenic
1130639062 15:85653931-85653953 CTTGAACCTGAGAGGGAGCGAGG - Intronic
1132208553 15:100003249-100003271 CTAGAACCCCAGGTGGAGCTGGG - Intronic
1137674584 16:50298014-50298036 GATGAACCTCAGAGGGCTCTCGG + Intronic
1138279212 16:55760461-55760483 CTGGAAGCCCAGGGAGATCTGGG + Intergenic
1138674182 16:58639057-58639079 CTTGAACCCGAAAGGGATCAAGG - Intergenic
1139271053 16:65682791-65682813 CTCAAACCCAGGAGGGATCTTGG + Intergenic
1140232461 16:73128940-73128962 ATTGAACCCCAAAGAGATCCTGG + Intronic
1142476879 17:193985-194007 CTAGAACCCCAGAGGGAGCCGGG - Intergenic
1143599336 17:7933652-7933674 CTTGATCCCAAGAGGGAGCTAGG + Intronic
1144127665 17:12217948-12217970 CTTGAACCCCAGGGGGGTGGAGG + Intergenic
1144668527 17:17118329-17118351 CTGCAACCCCAGAGGGACTTTGG - Intronic
1145753310 17:27371093-27371115 CTTGAACCCTGGAGGTGTCTTGG - Intergenic
1145911558 17:28546324-28546346 CCTGAACCCCAGAGGCCACTAGG - Intronic
1146830660 17:36066417-36066439 CTTGGACCCCAGAACGATGTAGG - Intronic
1148244278 17:46020396-46020418 CTGAAACCCCAGAGGGTGCTTGG - Intronic
1148355253 17:46971521-46971543 CTTGAACCCCACACAGATCCTGG + Intronic
1150139532 17:62716517-62716539 CTTGAACCCAGGAGGGACCCTGG + Intronic
1150194538 17:63281931-63281953 CTTGAGCCTCAGAGGGAGCATGG + Intronic
1150567892 17:66358700-66358722 CTTTACCCCCAGAGTGATGTTGG + Intronic
1151388166 17:73768028-73768050 CTAGAACCCCAGCTGCATCTGGG - Intergenic
1151455321 17:74222344-74222366 CTTGAACCCTAGGTGGAGCTTGG + Intronic
1159149401 18:64501778-64501800 ATTGAACCCCAGCTGGGTCTTGG + Intergenic
1164480866 19:28610041-28610063 CTTGAACCCTTGGGGGAGCTGGG - Intergenic
1165978997 19:39703995-39704017 CTTGATCCTCAGGAGGATCTGGG - Intergenic
1166148293 19:40852014-40852036 CTTGACTCCCAGGGTGATCTAGG - Intronic
1166152436 19:40883799-40883821 CTTGACTCCCAGGGTGATCTAGG - Intronic
1166171314 19:41029323-41029345 CTTGACTCCCAGGGTGATCTAGG - Intergenic
1166177745 19:41086846-41086868 CTTGACTCCCAGGGTGATCTAGG + Intergenic
927072156 2:19542115-19542137 CCTGAAACCCAGGAGGATCTTGG - Intergenic
932837322 2:75049705-75049727 CTTGAAGCCCAGACGGAACCTGG + Exonic
933810105 2:86027776-86027798 CTTGCACACCAGTGGGATCTTGG - Intronic
934954694 2:98608119-98608141 ATTTAACCCCACAGGGAACTGGG + Intronic
935581610 2:104760640-104760662 CTGGAACACCAGAGGATTCTAGG + Intergenic
936382385 2:111997968-111997990 CTTGAACCCAGGAGGGTTGTTGG + Intronic
938737086 2:134195877-134195899 CTGGAAGACCAGAGGGGTCTAGG + Intronic
945808893 2:214523749-214523771 CTTGAACCCAGGAGGGTTCAAGG + Intronic
946343789 2:219091295-219091317 CTTAAACTCCACAGGAATCTAGG - Intronic
946532050 2:220581094-220581116 TTTTAACCTCAGAGGCATCTTGG + Intergenic
947501547 2:230674800-230674822 CTTCAGCCCCAGTGGGAGCTGGG + Intergenic
1169613237 20:7407721-7407743 CTAGAATCCCAGATGGATGTTGG - Intergenic
1171064608 20:22002324-22002346 CTTGCAACACAGAAGGATCTCGG - Intergenic
1172205717 20:33161600-33161622 GATGAACCCCAGAGAGAACTTGG + Intergenic
1176155607 20:63618662-63618684 CTTCCTCCCCAGAGGGCTCTGGG - Intronic
1180101515 21:45590001-45590023 CTCGCGCCCCAGAGGGGTCTGGG - Intergenic
1180953333 22:19730513-19730535 CTTGAACCCCAGATGGGTCTTGG - Intergenic
1181891235 22:26065367-26065389 TTTTACCCCCAAAGGGATCTTGG - Intergenic
952101435 3:30017644-30017666 CTAGAACCTCAGAGGGAGCATGG + Intergenic
952749788 3:36815944-36815966 CTTGAACTCCAGAGAGCTCTTGG + Intergenic
953350179 3:42209645-42209667 CGTGAACCCCAGCAGGGTCTGGG - Intronic
954043869 3:47912157-47912179 CTTGAACCCCAGAGGGATCTTGG - Intronic
955542009 3:59986457-59986479 CTTGGACTCCAAAGGGCTCTGGG + Intronic
956109794 3:65859249-65859271 CTTGAACCCAGGAGGTACCTGGG + Intronic
956721926 3:72125585-72125607 CCATAACCCCAGAGGTATCTGGG - Intergenic
957022318 3:75139711-75139733 CTTGAACCCTTGGGGGAGCTGGG - Intergenic
958483208 3:94671473-94671495 CATGAACCCCAAAGTAATCTTGG - Intergenic
973294132 4:48496728-48496750 CTTGATACCCAGAGACATCTTGG - Intergenic
974412140 4:61555614-61555636 CCAGACCCCGAGAGGGATCTTGG + Intronic
977687553 4:99865670-99865692 CATGAACCACAAAAGGATCTAGG + Intronic
977693464 4:99942651-99942673 CTTAATCCCCAAATGGATCTAGG - Intronic
985997764 5:3606289-3606311 CTTGAACCCGGGAGGGAGCAAGG + Intergenic
988500865 5:31782661-31782683 CCTGAACCCCAGAATCATCTGGG - Intronic
988674789 5:33421061-33421083 CTTTAATCCCAGAGCCATCTAGG - Intergenic
990833493 5:59987122-59987144 ATTGAACCCGAGGGTGATCTTGG + Intronic
997037303 5:130208198-130208220 CTTGAACAACACAGGGGTCTAGG + Intergenic
997530724 5:134579725-134579747 AATGGACCCCAGTGGGATCTGGG - Exonic
999256772 5:150213878-150213900 CTTGGACCCCAGAGTGCTTTGGG + Intronic
999396805 5:151234718-151234740 CGTGAGCCCCAGAGTGACCTTGG - Intronic
999775963 5:154813420-154813442 GGTGATCCCCAGAAGGATCTGGG + Intronic
1001724402 5:173884948-173884970 CTCAAACCCCAGAGGGGGCTGGG + Intergenic
1003939205 6:11007523-11007545 CTAGAACCTCAGAGGGAACAAGG + Intronic
1004777503 6:18864284-18864306 TGTGAAGCACAGAGGGATCTTGG + Intergenic
1005506112 6:26470261-26470283 CTTGAACCCCAGTGGGGTGGAGG + Intronic
1005739620 6:28778106-28778128 CTTCTACCCTAGATGGATCTTGG + Intergenic
1006758867 6:36442108-36442130 CTTGAACCCAGGAGGCAACTGGG - Intronic
1009248188 6:61265561-61265583 CCTGAAACTCTGAGGGATCTGGG - Intergenic
1010045060 6:71432277-71432299 CTTGAACCCAGGAGAGATCAAGG - Intergenic
1010879794 6:81153468-81153490 CCTGAACCCCAGTTGTATCTAGG - Intergenic
1011104041 6:83758895-83758917 CTTGAACCCAGGAGCAATCTTGG + Intergenic
1014623444 6:123697788-123697810 ATTGAGCCCCAGAGGGCTTTAGG + Intergenic
1025230729 7:57201859-57201881 CTAGGCCCCCAAAGGGATCTGGG + Intergenic
1031640721 7:124161142-124161164 CTAGAACCCCAGAGGAACTTGGG + Intergenic
1033657512 7:143383144-143383166 CTGGAGCCCCAGGTGGATCTGGG + Exonic
1034107247 7:148500988-148501010 CTTGAAACCCAGAGGGCACCTGG + Intergenic
1034313057 7:150106899-150106921 TTAGAACCCCAAAGAGATCTGGG + Intergenic
1034793807 7:153993765-153993787 TTAGAACCCCAAAGAGATCTGGG - Intronic
1036686914 8:10917823-10917845 GTTGAAGCCCAGAGAGATCAAGG - Intronic
1038191363 8:25324078-25324100 CTAGAAACCCAGAGGGCTCTGGG + Intronic
1041739993 8:61147882-61147904 CAGGAACCCCTGAGGGGTCTTGG + Intronic
1041791388 8:61699892-61699914 GTTGAACAGCAGAGGGAACTGGG + Intronic
1043166754 8:76911973-76911995 CTTGGGCCCCATGGGGATCTTGG + Intergenic
1044543063 8:93429393-93429415 CTTGCTCCCCAGATGGCTCTTGG - Intergenic
1047175659 8:122538092-122538114 CTTGAACCTCAGAGGGAGAAGGG + Intergenic
1048016756 8:130504068-130504090 CCTGAACCCTTGAGGGATCCAGG + Intergenic
1051213377 9:14769737-14769759 CATGGACCCCACAGGGAACTCGG - Exonic
1052533303 9:29716373-29716395 CTTGAACCCCAGTGGGGTGGAGG - Intergenic
1052991221 9:34520412-34520434 CTTGAACCTCAGATGGACATGGG - Intronic
1054148541 9:61582334-61582356 CTTGAACCCGAGAGGAAGGTTGG - Intergenic
1054795971 9:69302358-69302380 CTTCCATCCTAGAGGGATCTAGG - Intergenic
1056018039 9:82412027-82412049 CTTGAACCTTTGATGGATCTTGG + Intergenic
1062460337 9:136660208-136660230 CTTGGACGCCAGAGGGTACTGGG - Intronic
1186040038 X:5465907-5465929 ACTGAACAACAGAGGGATCTGGG - Intergenic
1186339560 X:8629524-8629546 ACTGAATCCCAGAGAGATCTGGG - Intronic
1187191073 X:17035532-17035554 CTTGAACCCCAAAAGAATCCGGG - Intronic
1190159735 X:48022572-48022594 CTGGAACCCCAAAGGGAGCCAGG + Intronic
1193748288 X:85310906-85310928 CATGAAGCCCAGAAGGAACTAGG + Intronic
1193915099 X:87354080-87354102 CTTGAACCCCGGGGGGATGGAGG + Intergenic
1197400982 X:125990731-125990753 CTTGAACCAGAGTGGTATCTTGG - Intergenic
1197785342 X:130192189-130192211 TATGAACCCCAGGGCGATCTGGG + Intergenic
1201546950 Y:15175752-15175774 ACTGAACAACAGAGGGATCTGGG + Intergenic