ID: 954049050

View in Genome Browser
Species Human (GRCh38)
Location 3:47957841-47957863
Sequence CTGTATATTCTGATTGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 146}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954049050_954049056 -7 Left 954049050 3:47957841-47957863 CCTCCCTCAATCAGAATATACAG 0: 1
1: 0
2: 0
3: 20
4: 146
Right 954049056 3:47957857-47957879 TATACAGGTCTGGGAATCAAAGG 0: 1
1: 2
2: 6
3: 39
4: 314
954049050_954049058 9 Left 954049050 3:47957841-47957863 CCTCCCTCAATCAGAATATACAG 0: 1
1: 0
2: 0
3: 20
4: 146
Right 954049058 3:47957873-47957895 TCAAAGGGTAGAAGTATGTGCGG 0: 1
1: 0
2: 0
3: 25
4: 235
954049050_954049057 -6 Left 954049050 3:47957841-47957863 CCTCCCTCAATCAGAATATACAG 0: 1
1: 0
2: 0
3: 20
4: 146
Right 954049057 3:47957858-47957880 ATACAGGTCTGGGAATCAAAGGG 0: 1
1: 0
2: 7
3: 22
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954049050 Original CRISPR CTGTATATTCTGATTGAGGG AGG (reversed) Intronic
903403233 1:23073582-23073604 TTCTATATTCTGATTGTGTGGGG - Intronic
903825910 1:26145728-26145750 CTGTATCTGGTGATTGAAGGAGG - Intergenic
904120746 1:28196159-28196181 CTGAAGATTCTGATTCAGGGTGG - Intergenic
905491561 1:38348184-38348206 ATTTATATGCTGATTGAAGGTGG - Intergenic
906414623 1:45611114-45611136 CTGCATATTCTGCTAGAGGATGG - Intronic
906464373 1:46063044-46063066 CTGTATATTCTGAGTCCTGGAGG - Intronic
907345739 1:53778143-53778165 CTGAATATTCAGATTAAGTGGGG - Intronic
910053609 1:83005747-83005769 CTGGAGATGCTGATTGAGGTTGG + Intergenic
910735072 1:90444768-90444790 CTGAATATTCTGACTGAGAATGG + Intergenic
916523867 1:165590991-165591013 CTATGTATTGTGATAGAGGGAGG - Intergenic
918740315 1:188122294-188122316 TAGTTTATTCTGTTTGAGGGTGG - Intergenic
921062242 1:211595395-211595417 CTGTACAGTCTAATTGAAGGAGG + Intergenic
921679973 1:218020145-218020167 CAGGATTTTCTGCTTGAGGGTGG - Intergenic
923859418 1:237878053-237878075 CTGAATATTCTGAGTGAAGATGG + Exonic
924438010 1:244062306-244062328 CTGCATATTCCCACTGAGGGAGG + Intergenic
1065405112 10:25355768-25355790 CTGTTTATTCTGAATGGGGTGGG + Intronic
1068611137 10:59061617-59061639 CTGGATATTCTGATATGGGGAGG + Intergenic
1068867702 10:61912219-61912241 CTGTGTATTCTTCTTAAGGGAGG + Intronic
1069132951 10:64728936-64728958 GGGTATTTTCTGATAGAGGGAGG + Intergenic
1070332264 10:75426650-75426672 CTATGTATTTTAATTGAGGGTGG + Intergenic
1072284185 10:93896879-93896901 CGGTCTGTTCTGTTTGAGGGTGG + Intronic
1073852346 10:107635403-107635425 CTGTAATTTCTGATTGAGTGGGG + Intergenic
1075827528 10:125371939-125371961 CTGCATATTTTAATTGAGGGTGG - Intergenic
1077246135 11:1539679-1539701 CTGTTTATTGGGATTGAGGTGGG + Intergenic
1080214955 11:29829726-29829748 ATGTATATTCTGTTTGGTGGTGG - Intergenic
1080685201 11:34509599-34509621 TTTTATATCCTGAGTGAGGGGGG + Intronic
1089852493 11:121512450-121512472 CTGAATAATCTCATTGAGGAAGG - Intronic
1090009244 11:123031573-123031595 CTGTGTATGCTGATGGAGAGTGG + Intergenic
1090334569 11:125954073-125954095 CTGGATATCCTGGGTGAGGGTGG - Intergenic
1092738843 12:11609637-11609659 CTGTAGAGTCTGACTGAAGGAGG + Intergenic
1093736715 12:22628307-22628329 TTGTATATTATGATTTAGGCAGG + Intronic
1093843123 12:23930420-23930442 CTGTATATATTTATAGAGGGAGG + Intronic
1098347610 12:69523046-69523068 ATGTATATTCTGTTTTGGGGTGG + Intronic
1106472067 13:30064915-30064937 CTGTATAGTCTGTTTGAAGGTGG - Intergenic
1106998341 13:35514480-35514502 CAGTTTTTTCTGATTGAGGGTGG - Intronic
1108476406 13:50822586-50822608 CTAAATATTCTGATTGAAGTAGG - Intronic
1111384282 13:87503431-87503453 ATGTATATTCTAATGGAGGTAGG + Intergenic
1111938427 13:94582665-94582687 GTGCATACTCAGATTGAGGGTGG - Intronic
1113433191 13:110268007-110268029 CTGTATTTTTTTTTTGAGGGGGG - Intronic
1114318292 14:21526168-21526190 ATGGATATTGGGATTGAGGGAGG + Intronic
1114490427 14:23097558-23097580 CTGTAGATGCTAATTGAGTGTGG + Intronic
1114793762 14:25688720-25688742 CTGTACATTCTTATTGAGATTGG + Intergenic
1115472619 14:33783793-33783815 CTGCAGATTCTGATTGGGGAAGG - Intronic
1115629564 14:35230357-35230379 CTGTAAATTCTGATAGAGATGGG + Intronic
1115682473 14:35756852-35756874 CTTTATCTCCTGATTGTGGGGGG + Exonic
1115964825 14:38876330-38876352 TAGTATTTTCTGATGGAGGGTGG - Intergenic
1124819137 15:33026490-33026512 GTGTACATTCTGTTTGAGGTAGG - Intronic
1126927747 15:53609426-53609448 TTGTATTTTCAGATAGAGGGGGG + Intronic
1126948864 15:53856746-53856768 ATGTATATTCTGTTTTTGGGTGG + Intergenic
1127032967 15:54884370-54884392 CTGTAGATTCTTATGGATGGGGG - Intergenic
1128266190 15:66268528-66268550 ATGTATTTTCTGATTCAGTGAGG - Intergenic
1130198820 15:81806550-81806572 CTATCTATTCTCATGGAGGGAGG + Intergenic
1130447166 15:84014048-84014070 TTGTATATTCTTCCTGAGGGAGG + Intronic
1131113667 15:89780779-89780801 CTGTATCTGCTGACTCAGGGAGG + Intergenic
1133981391 16:10635637-10635659 CTGGATGTCCTGATTGAAGGAGG + Intronic
1139595217 16:67953953-67953975 CTGAATCTTCTGATTTGGGGGGG - Intronic
1141299130 16:82796661-82796683 GTGTCCATTCTGATTGAGCGAGG - Intronic
1146798258 17:35798176-35798198 ATGTCTATTCTGACTGAGTGCGG + Intronic
1148137914 17:45307346-45307368 CTGAATATTCTGATTAAGTGGGG + Intronic
1149243499 17:54678605-54678627 CAGTGTATTCTGAGTAAGGGAGG + Intergenic
1150751594 17:67868509-67868531 CTGTATTTTCAATTTGAGGGTGG + Intronic
1150929751 17:69571987-69572009 CCGTTTGTTCTTATTGAGGGTGG + Intergenic
1151390933 17:73786233-73786255 CTTTAAATTCCCATTGAGGGTGG - Intergenic
1156311491 18:35926628-35926650 ATGCATATTCTCATTTAGGGTGG - Intergenic
1165929567 19:39347913-39347935 ATTTATATTCTGATGGGGGGAGG + Intronic
926395503 2:12438300-12438322 CTGGAGATTCTGATTCAGGAGGG + Intergenic
927292485 2:21418822-21418844 CAGGATAATCTGATTGAGAGGGG - Intergenic
927613924 2:24570134-24570156 CTGGATATTATGATTGAACGTGG - Intronic
928599352 2:32887913-32887935 CTTGATCTTCTGATTGAGGTAGG - Intergenic
928636991 2:33257023-33257045 ATGTATATTCTGATTTGGGTAGG + Intronic
929181387 2:39043823-39043845 CTGTATATATTGATTGGAGGTGG - Intronic
936064380 2:109319525-109319547 ATGTGTATTCTGAGTGAGAGGGG + Intronic
938275912 2:130022123-130022145 CTGCATGTTCTCATTCAGGGGGG + Intergenic
938988037 2:136598705-136598727 ATGTATATTCTGATTTGGGGTGG - Intergenic
940197630 2:151113563-151113585 CTGTATAATCTGAAAGGGGGAGG + Intergenic
940873329 2:158878253-158878275 CTGGATATTATGATCCAGGGTGG + Intergenic
941892722 2:170598377-170598399 CTGTTTATTCAGATGGAGGCAGG - Intronic
942173007 2:173305584-173305606 CTGAATATGCTGATTCAGGTAGG - Intergenic
942252562 2:174059894-174059916 CTGGAGATTCTAATTCAGGGAGG - Intergenic
943319729 2:186432513-186432535 CTGTAATTGCTGATGGAGGGAGG - Intergenic
944138590 2:196429494-196429516 CTTTATAATTTGATTTAGGGTGG - Intronic
945265708 2:207889385-207889407 ATGTGTATTCTAGTTGAGGGAGG - Intronic
946797121 2:223366927-223366949 CTGTATTTTCTGATGTAGGCGGG + Intergenic
1170695177 20:18651521-18651543 CAGTATATTCTGATAAAGAGAGG + Intronic
1173334383 20:42101059-42101081 CTGTCTATTCTGAGTGAGATAGG + Intronic
1174289945 20:49501065-49501087 TTGTATATTTTGATAGAGGGGGG - Intergenic
1174905311 20:54544357-54544379 CTGTATATTATGACTGGGGGAGG + Intronic
1175655946 20:60771050-60771072 CTGGAGATTCTGTTTGAGTGAGG - Intergenic
1180088409 21:45519891-45519913 ATGTATATTCTGCTTTTGGGTGG - Intronic
1180939636 22:19650096-19650118 ATGTATATTCTGCTAGTGGGTGG - Intergenic
1185391910 22:50566607-50566629 CTGGATTTTCTGAATGACGGGGG - Intergenic
949187316 3:1207665-1207687 GTTTGTATTCTAATTGAGGGAGG - Intronic
950599853 3:14024096-14024118 ATGTATATTCTGTTTTGGGGTGG + Intronic
951596171 3:24320596-24320618 CTGTAGATTCTAATTCAGGGTGG - Intronic
953461017 3:43081241-43081263 CTGCAGATCCTGATGGAGGGCGG - Exonic
954049050 3:47957841-47957863 CTGTATATTCTGATTGAGGGAGG - Intronic
959424104 3:106164891-106164913 CTGTATAGAATGATTTAGGGAGG - Intergenic
959728353 3:109571408-109571430 CTCTATATTCTGGTAGACGGTGG - Intergenic
959939409 3:112064750-112064772 CTGGATATTCTTATTTTGGGTGG + Intronic
965426790 3:168535028-168535050 CTATAGATTCTGACTGCGGGTGG - Intergenic
966977698 3:185100223-185100245 CTGTATATTCTGTTTTGGGGTGG - Intronic
968243206 3:197112285-197112307 TTCTATATTTTGATTGTGGGTGG - Intronic
969068730 4:4513222-4513244 GTGGAGATTCTGATAGAGGGGGG + Intronic
974338357 4:60581011-60581033 CTGCATATTGTGTTAGAGGGTGG - Intergenic
975412188 4:74066424-74066446 CTGTATAGTCTGAATAGGGGTGG - Intergenic
976064312 4:81166249-81166271 TTGTATATTGTGATTGACAGAGG + Intronic
976180835 4:82397177-82397199 TTGTATTTTCTGATAGAGGCGGG - Intergenic
977376608 4:96212962-96212984 CTGTATATTCAGGCTCAGGGAGG + Intergenic
977935108 4:102792888-102792910 CTGTTAAGTCTGATTGAAGGTGG + Intergenic
979190218 4:117847980-117848002 CTGTATAATCTGAGTCTGGGTGG + Intergenic
982699745 4:158647137-158647159 CTGTATCTTCTGAATGAAGAGGG - Exonic
983040791 4:162923436-162923458 CTGTCTATTCTCTCTGAGGGAGG + Intergenic
983515937 4:168656694-168656716 CTGCATATCCAGATTGTGGGGGG + Intronic
985182467 4:187280131-187280153 ATGTATATGCTGGTGGAGGGTGG + Intergenic
987715620 5:21565784-21565806 ATGTATTTTCTGATTGAGTGTGG + Intergenic
987950642 5:24670500-24670522 CAGTTTATTCTGATTGAGATGGG + Intergenic
991659646 5:68937210-68937232 CTTCATATTATGAGTGAGGGAGG - Intergenic
994358245 5:98819937-98819959 CTGTATAGGATGATTTAGGGCGG - Intergenic
995159117 5:108954883-108954905 CTGTATATTCTGATGGACAGAGG + Exonic
995672009 5:114615628-114615650 ATGTATATTCTGTTTTGGGGTGG - Intergenic
995966569 5:117914756-117914778 CTATAGATTCTCATTGATGGTGG + Intergenic
998528112 5:142860944-142860966 CTAGAGATTTTGATTGAGGGTGG + Intronic
1001344023 5:170874297-170874319 ATGTATATTCTGTTTTGGGGTGG + Intronic
1007628149 6:43258123-43258145 CTCTATGCTCAGATTGAGGGTGG - Intronic
1009001105 6:57716266-57716288 ATGTATTTTCTGATTGAGTGTGG - Intergenic
1012784350 6:103604396-103604418 ATGTATATTCTGTTTTGGGGTGG + Intergenic
1013928136 6:115497680-115497702 CTGTATATTTTAATTGGTGGAGG - Intergenic
1020735770 7:11947665-11947687 ATGTATATTCTGTTTTGGGGTGG + Intergenic
1021075523 7:16299459-16299481 ATGTATATTCTGACTGAATGAGG + Intronic
1021866447 7:24962931-24962953 CTTTTTATTATAATTGAGGGTGG - Intronic
1022429970 7:30308499-30308521 CCAGAGATTCTGATTGAGGGTGG - Intronic
1022921094 7:35015564-35015586 CTGTATGGTCTGAAAGAGGGAGG + Intronic
1025852377 7:65254471-65254493 CTGTATTTTGTGTTTTAGGGTGG - Intergenic
1028238344 7:88387932-88387954 CTGTATCTTCTGAATTAGGGAGG - Intergenic
1028455457 7:91033527-91033549 CTGTAGATTCTGATTCAGCAGGG + Intronic
1028819236 7:95187019-95187041 CTTTATATGATGATTTAGGGAGG + Intronic
1030139936 7:106293876-106293898 CTCTTTATTCTGATGCAGGGTGG + Intergenic
1031683094 7:124699019-124699041 CCTTATATTCTGAGTGAGGATGG - Intergenic
1035445244 7:158936804-158936826 CTGTATTTAGTGATTGAGGGAGG - Intronic
1037307493 8:17521190-17521212 TTGTATATTTTGATAGAGGGAGG + Intronic
1037513684 8:19609185-19609207 TTTTATATTGAGATTGAGGGAGG + Intronic
1038211854 8:25525727-25525749 ATGTATATTCTGTTTTTGGGGGG - Intergenic
1039842189 8:41302088-41302110 CTATAGATACAGATTGAGGGTGG - Intronic
1040400916 8:47048608-47048630 ATGTATATTCTGTTTTGGGGTGG - Intergenic
1040432169 8:47353847-47353869 GTGTAGATTCTGACTGAGTGAGG + Intronic
1041131489 8:54706902-54706924 AAGTAGATTCTGATTGAGGAAGG + Intergenic
1044151106 8:88775571-88775593 CTGTAGATACAGATTAAGGGTGG - Intergenic
1044579356 8:93808770-93808792 CTGTATTTTCTTTTTGAGGCAGG + Intronic
1045672969 8:104577255-104577277 ATGTATATTCTGTTTTAGGGCGG - Intronic
1047454937 8:124999652-124999674 CCTTATTTTCTGATTCAGGGGGG - Exonic
1047889272 8:129289846-129289868 CTCTCTATTCTGATTGAGGATGG - Intergenic
1050524565 9:6534346-6534368 CTGTGTAGTCTGTTTGAGTGAGG - Intronic
1050889619 9:10807574-10807596 CTGTATATTTAGAATGAGAGGGG + Intergenic
1052629348 9:31017793-31017815 CTGTATATTCTCAGTGAGTGTGG + Intergenic
1052994602 9:34544863-34544885 CTGAATATTCAGATTGAAAGGGG - Intergenic
1058020529 9:100082209-100082231 ATGTATATTTTAACTGAGGGAGG - Intronic
1058492874 9:105520835-105520857 CTTTATCTCCTGATTGTGGGGGG - Intronic
1059984483 9:119808859-119808881 CTGTGTAATCTCCTTGAGGGTGG - Intergenic
1061699604 9:132406130-132406152 GTGTATGTTCTGAGTAAGGGGGG - Intronic
1186880087 X:13856444-13856466 ATGCAGATTCTGATTCAGGGGGG - Intronic
1188241864 X:27802214-27802236 CTCTATATTTTGATTGGGGATGG - Intergenic
1192291083 X:69795875-69795897 CTGTATGTTCTGGATGGGGGAGG - Intronic
1193482810 X:82048029-82048051 CTGTATTTTCTGATTTTGAGTGG - Intergenic
1194983398 X:100463256-100463278 CTGTGTATTCATATTGAGGCTGG - Intergenic
1196250871 X:113458740-113458762 CTGTATCTTCAGATAGTGGGAGG + Intergenic
1198544883 X:137680805-137680827 ATGTCTATTATGATTGTGGGAGG + Intergenic
1198974835 X:142325022-142325044 ATGTATATTCTGGTTTTGGGGGG + Intergenic