ID: 954055172

View in Genome Browser
Species Human (GRCh38)
Location 3:48017119-48017141
Sequence TTTTCCATCTATTAAAGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 426
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 392}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954055172_954055176 30 Left 954055172 3:48017119-48017141 CCCTCACTTTAATAGATGGAAAA 0: 1
1: 0
2: 3
3: 30
4: 392
Right 954055176 3:48017172-48017194 TACAAATGAGGCTGAGACAAAGG 0: 1
1: 1
2: 3
3: 47
4: 662
954055172_954055174 -8 Left 954055172 3:48017119-48017141 CCCTCACTTTAATAGATGGAAAA 0: 1
1: 0
2: 3
3: 30
4: 392
Right 954055174 3:48017134-48017156 ATGGAAAAAAAAATGAGAAATGG 0: 1
1: 1
2: 51
3: 3273
4: 6844
954055172_954055175 18 Left 954055172 3:48017119-48017141 CCCTCACTTTAATAGATGGAAAA 0: 1
1: 0
2: 3
3: 30
4: 392
Right 954055175 3:48017160-48017182 AAACAAGTCACTTACAAATGAGG 0: 1
1: 0
2: 1
3: 33
4: 319

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954055172 Original CRISPR TTTTCCATCTATTAAAGTGA GGG (reversed) Intronic
904084700 1:27897114-27897136 TTTTTGTTCTATTAAAATGAAGG + Exonic
904507214 1:30967437-30967459 TTATTCAACTATTTAAGTGATGG - Intronic
906006394 1:42476164-42476186 TTTTCCTTCTAGCAAAGGGAGGG + Intronic
906666019 1:47622660-47622682 TTCTCCAACTATAAAAGTGGGGG - Intergenic
909733614 1:78928630-78928652 TGTTCTATCAATTAAATTGAAGG - Intronic
910050332 1:82966052-82966074 TTTAGCATATACTAAAGTGATGG + Intergenic
910188116 1:84567549-84567571 TTTCCCATCTATAAAAATGAGGG + Intronic
912013476 1:105002272-105002294 TTTTCCAACTATTGAAGGTAGGG + Intergenic
912780292 1:112540302-112540324 CTTTCCAGCTATTAAATGGATGG + Intronic
912878053 1:113382696-113382718 TTTTCCTTCTGTTGAAGTAAAGG + Intergenic
912984370 1:114412109-114412131 TCTTCCATCTTTTCCAGTGATGG - Intronic
913052419 1:115129298-115129320 TTTTCCATCAATGGAAGGGAGGG - Intergenic
913301922 1:117380308-117380330 TTGTCCATCTTTTAAATTGGTGG + Intronic
914980045 1:152407079-152407101 TATGCCATTTATTAAAGGGAAGG - Intergenic
916141219 1:161700139-161700161 TTATGCATCTATTGAAATGATGG - Intergenic
916207375 1:162328404-162328426 GTTTCCATATATTAAAATGTTGG + Intronic
916772902 1:167930616-167930638 TTTTTCATTTATAAAAATGAGGG - Intronic
917008770 1:170446960-170446982 TCTGCCATCTTTTAATGTGATGG - Intergenic
918322765 1:183380670-183380692 ATTTCCATTTTTTAAATTGAAGG - Intronic
918832865 1:189420812-189420834 TTTTGCATATATTAAAATTAAGG + Intergenic
919244749 1:194967769-194967791 TTTTTCATTTATTACTGTGAAGG - Intergenic
919574854 1:199294980-199295002 TTTTTCCTCTATGAAAATGATGG + Intergenic
919765296 1:201123373-201123395 TTTTTCTTCTACTAAACTGAGGG - Intronic
920089014 1:203439102-203439124 TTTCCCATCTTATAAAGTGAGGG + Intergenic
920532271 1:206712299-206712321 TTATCCCTGTATTACAGTGAAGG + Intronic
921799881 1:219390458-219390480 TTTTCCATCTATTCTTCTGAGGG + Intergenic
922444236 1:225683107-225683129 TTTTTCATCTATTGAAGTGCCGG - Intergenic
923103527 1:230836705-230836727 TATTCCATTCATTAAAGTGTAGG - Intergenic
923939109 1:238800221-238800243 TTTTCCGTATATTAATTTGAAGG - Intergenic
924168068 1:241305926-241305948 TTTTCCTTCTACAAAAGAGAAGG - Intronic
1062849350 10:731348-731370 TTTACCCATTATTAAAGTGAGGG + Intergenic
1063183824 10:3632263-3632285 TTGTGCATTTATTAAAGTGGCGG + Intergenic
1063855331 10:10244614-10244636 TTTTCCTTCTGTTGATGTGATGG - Intergenic
1063866199 10:10367933-10367955 TTTTTCTTCTAGTAAAATGAGGG + Intergenic
1063872892 10:10438760-10438782 CATTCCAGCTATTGAAGTGATGG + Intergenic
1063949770 10:11211296-11211318 TTGTCCATATATTAGAGTCAAGG + Intronic
1065720473 10:28624204-28624226 TCTTCCATCTCTCAAGGTGAGGG - Intergenic
1065759788 10:28971473-28971495 TTTTACATATATTAAATTTATGG + Intergenic
1066121686 10:32295235-32295257 TGTTACGTCTATTAAAGTGGGGG + Intronic
1066497102 10:35953127-35953149 TATTCCAACTATCAAAGGGAGGG + Intergenic
1066703558 10:38155025-38155047 TTTTCCTTATATTAAATTGAAGG - Intergenic
1066987219 10:42478243-42478265 TTTTCCTTATGTTAAATTGAAGG + Intergenic
1067835455 10:49636431-49636453 TTTTCCATCTATATTTGTGAGGG + Intronic
1068440283 10:57045821-57045843 TATACCATCGATTAAAGGGAAGG - Intergenic
1068597799 10:58922063-58922085 TTTTCTAGCTCTCAAAGTGAAGG + Intergenic
1068685894 10:59869696-59869718 TTTTCCATCTCTAAAACTGTGGG - Intronic
1069146930 10:64904544-64904566 CTTTCCATCTTTTAAAGTCCTGG - Intergenic
1069182444 10:65378657-65378679 TTTTCCATCTTTTAAAATTTTGG - Intergenic
1069228763 10:65979276-65979298 CTTTACATCTACTAAAGTAAAGG - Intronic
1069315307 10:67092001-67092023 TTTTTCATCTACTAAACTTAAGG - Intronic
1069404174 10:68080293-68080315 TTTTCCATCTTTTAAAAACATGG - Intergenic
1071928450 10:90438067-90438089 TTTTGCATCTATTTAGGAGATGG - Intergenic
1072492719 10:95923395-95923417 TTTTCCAGCTATTAGAGAAAAGG - Intronic
1073673463 10:105618375-105618397 GTTTCCATTTATTAAGGTGGGGG - Intergenic
1074836612 10:117302265-117302287 TTGTTTTTCTATTAAAGTGATGG - Intronic
1074935410 10:118174354-118174376 TTATCCATTTCTTAATGTGATGG + Intergenic
1074975074 10:118573414-118573436 TTTTGCATCTATGTTAGTGAAGG - Intergenic
1074975240 10:118575379-118575401 TTTTGCATCTATGTTAGTGAAGG - Intergenic
1078701139 11:13684245-13684267 TTTTCCATCTAATAAAGAAATGG + Intronic
1078744969 11:14103766-14103788 TGTTCAATCTATTAAATTGTTGG + Intronic
1080410148 11:32015603-32015625 TTTTCCATTTATGAGAGGGATGG + Intronic
1080509108 11:32949395-32949417 TTTTATATCAATAAAAGTGAAGG + Intronic
1080922058 11:36719356-36719378 TTTTCCATATAATAATGAGAGGG + Intergenic
1081231781 11:40593658-40593680 TTTTCCATCTGGCAAAGTAAGGG + Intronic
1081452375 11:43183947-43183969 TTTTCCATATATGCAACTGATGG - Intergenic
1081773066 11:45661641-45661663 TTTCCCATCTGTGAAAGAGAAGG + Intronic
1084279153 11:68075584-68075606 GTTTCCATCTGTTGGAGTGAAGG + Intronic
1085668461 11:78438595-78438617 TTTTTCATCTATCAAAGCAAAGG - Intronic
1086873409 11:92066581-92066603 TTTTCCTTCTGTTAAATTGCTGG - Intergenic
1088305016 11:108398627-108398649 TTTCCCAGCTAGTAATGTGACGG + Intronic
1089379115 11:118015022-118015044 GTCTCCATCTATAAAAATGAAGG + Intergenic
1089798952 11:121007795-121007817 TTCTCCTTCTGTTAAAATGAAGG - Intergenic
1090237082 11:125156997-125157019 TTCTCCAGCTATTAGAGTTAGGG - Intergenic
1090779869 11:129998345-129998367 TTTACCATCAGTGAAAGTGAAGG + Intronic
1091017287 11:132063442-132063464 TTCTCCGTCTATTAATGAGAGGG + Intronic
1093945633 12:25105382-25105404 TTTCATATCTGTTAAAGTGAAGG + Intronic
1095768431 12:45923492-45923514 TTTTCCAGGCTTTAAAGTGAGGG - Intronic
1098519765 12:71421559-71421581 TTGTCCATATATGAAATTGATGG - Intronic
1098733912 12:74072475-74072497 TTTTCCATTTCTTACACTGAAGG - Intergenic
1099132107 12:78846569-78846591 TTTTTCATCTATAGAAGTAAGGG + Intergenic
1099695072 12:86008842-86008864 TTCTCCATCTGTTGAATTGAGGG + Intronic
1099868384 12:88314722-88314744 TTTTTCATCTCTTATAGTGCAGG + Intergenic
1099938769 12:89160095-89160117 TTTTCCTTTGATTAAAATGAAGG + Intergenic
1100077362 12:90802206-90802228 TTTTCCATCTATTTTACTGTTGG + Intergenic
1100186069 12:92141821-92141843 TTTTCAATCTTTGAAAATGATGG - Exonic
1101790192 12:107919009-107919031 TTTTTCATCTATAAAAGGGAAGG + Intergenic
1103486442 12:121286134-121286156 TTTTCCATCATTTACAGTCAAGG + Intronic
1106593295 13:31116304-31116326 TTTTCAATTTATTAAAGGGAAGG - Intergenic
1107111461 13:36702456-36702478 TTTTCCATGGCTTAAAGTAAAGG - Intergenic
1107366904 13:39689221-39689243 TTTTCCATCTGTGAAAATGAAGG + Intronic
1107978159 13:45709788-45709810 TTTTCCATCATATAAATTGAAGG + Intronic
1109187428 13:59287305-59287327 TTTTCCATCTTTTATAGGAAAGG - Intergenic
1110393547 13:75003645-75003667 TATTCCATCTTTAAAAATGATGG - Intergenic
1111129090 13:83951443-83951465 TTTTCTTTCTATTGATGTGATGG - Intergenic
1111145464 13:84173250-84173272 TTTTACATCCATTCAAATGATGG - Intergenic
1111277916 13:85975807-85975829 TTTTCCTACTATTAAATGGAGGG + Intergenic
1111475454 13:88740367-88740389 GTTTCCATCTATGAAAGCAAGGG + Intergenic
1111571758 13:90097173-90097195 TTTTCTTTGTATTAAATTGATGG - Intergenic
1111807854 13:93060090-93060112 TTGTTCATCTAATAAAGTGATGG + Intergenic
1111900207 13:94190463-94190485 TTTGTCATCAACTAAAGTGATGG - Intronic
1112050193 13:95637565-95637587 TTTTTCTTTTTTTAAAGTGAAGG - Intronic
1112798085 13:103079264-103079286 TTTTCCGACTTTGAAAGTGAAGG + Intergenic
1112843699 13:103611547-103611569 TTTTCCTGCCATTAAAGTGGAGG - Intergenic
1113762261 13:112857482-112857504 TTTTCCATATATTTAAGTAGAGG + Intronic
1115518533 14:34209564-34209586 TTTTGCATTTAAGAAAGTGAAGG - Intronic
1115688575 14:35822166-35822188 TTTTTCATCTATAAAATGGAGGG + Intergenic
1115711498 14:36055864-36055886 CTTGCCCTCTACTAAAGTGAAGG - Intergenic
1115994115 14:39177520-39177542 TTTTAAATGTAGTAAAGTGAAGG - Intronic
1116180252 14:41522741-41522763 TTTTTCCTCTATTAATTTGATGG + Intergenic
1116611806 14:47083997-47084019 TTTTCCATCTATTTAAAGGGGGG - Intronic
1117387035 14:55225779-55225801 TTTTTCAACAATTAAATTGAAGG - Intergenic
1117934887 14:60892221-60892243 TTTTCTATCTATTATTGAGAGGG + Intronic
1118224130 14:63883362-63883384 TTATTCATTTATTAAAGTCAGGG + Intronic
1118727323 14:68638412-68638434 TTTTCCCTCTCTTAAAAAGAGGG - Intronic
1119043648 14:71297931-71297953 TTTTCCATGTATTCATCTGAGGG - Intergenic
1119825937 14:77657089-77657111 TTTTCTATTTATTGTAGTGATGG - Intergenic
1120352650 14:83382715-83382737 TTCACCATCAATTAAAATGATGG - Intergenic
1121443971 14:93967112-93967134 TTTTCCATCTGTTAAATGGCAGG + Intronic
1121591973 14:95121977-95121999 TTTTCCTCCCATTAAACTGATGG + Intronic
1121709806 14:96029310-96029332 TTTTTCATCTGTAAAAGTGGAGG - Intergenic
1124356837 15:29001803-29001825 TTTTCCATCTTTTAAAAAAAAGG - Intronic
1124913705 15:33947869-33947891 TTTTCCATCCATTACAGACATGG - Intronic
1125057677 15:35381771-35381793 TTTCCCATAAATTTAAGTGATGG - Intronic
1125869106 15:43081642-43081664 TTGTCCATTTTTTAAAGGGATGG + Intronic
1125931529 15:43603600-43603622 TCTTCCATCTATAAAAGTCTTGG - Intronic
1126749827 15:51865320-51865342 TTTTCCATCTGTAAAACAGAGGG - Intronic
1128235286 15:66062964-66062986 TTTTCCATAATTTAAAGGGATGG - Intronic
1128492229 15:68159702-68159724 TTATCCATCTGATAAATTGATGG + Intronic
1128602050 15:69003774-69003796 TTGTCCATCTAGAAGAGTGAAGG + Intronic
1128661965 15:69508108-69508130 TTTTCTTCCTTTTAAAGTGAAGG + Intergenic
1128808687 15:70554361-70554383 TTTTCTATCTATAAAAGAGATGG + Intergenic
1129651534 15:77494298-77494320 TTTTCCATGTTTTATAGAGATGG + Intergenic
1129988398 15:79939521-79939543 TGTTCATTCTATTCAAGTGAAGG + Intergenic
1130008328 15:80125059-80125081 TTTTCCATTTATTTAATAGATGG + Intronic
1130109103 15:80950217-80950239 TTCCCCATCTGTTAAAATGAAGG - Exonic
1131072060 15:89472166-89472188 TTGCTCATCTATTAAAATGAGGG + Intronic
1131249713 15:90822289-90822311 TTTCCCATCTGCAAAAGTGAGGG + Intergenic
1131487038 15:92829368-92829390 TTTTACATTTATTAAACTGGTGG + Intergenic
1133492381 16:6282943-6282965 TTCTTCATCTCTTCAAGTGAGGG - Intronic
1133539962 16:6740717-6740739 TTTTCCATCTATTTACATGTTGG - Intronic
1134136168 16:11677750-11677772 CCTTCCATCTATTACAGGGATGG - Exonic
1134628945 16:15743041-15743063 GTTTTCAGCTATTAAAATGATGG - Intronic
1137050371 16:35706501-35706523 TTTTGAGTCTATTAAAGTGATGG + Intergenic
1138138236 16:54543408-54543430 TTCTCCCTCTATTAAATTCACGG + Intergenic
1139786423 16:69396456-69396478 TTTCTCATCCATTAAATTGAGGG + Intronic
1140926079 16:79585238-79585260 ATTTTCATCTATTAAAATAATGG - Intergenic
1141143852 16:81515343-81515365 TTTTCCATCTAGAAGCGTGAGGG - Intronic
1142822305 17:2479879-2479901 TTCTCCACCTATAAAAGTAAAGG + Intronic
1143668579 17:8380554-8380576 TGTTGCATCTATTTAGGTGAAGG - Intronic
1144515000 17:15911298-15911320 TTTGCCTGCTATTAAAGTGGGGG + Intergenic
1145361608 17:22216768-22216790 TTTTCTTTCTTTTAAAGAGATGG + Intergenic
1146473810 17:33145666-33145688 TTCTTCATCTATGAAAATGAGGG + Intronic
1146599422 17:34201659-34201681 TTTTGTATCTCTTAAACTGATGG + Intergenic
1147928546 17:43961401-43961423 ATTTCCAACTTTTAAATTGAGGG - Intronic
1148088008 17:45006336-45006358 TTTCCCATCTGTCAAAGAGAGGG - Intergenic
1150475227 17:65470010-65470032 TTAGCCATCTAAGAAAGTGATGG - Intergenic
1150591549 17:66567070-66567092 TTTTCCATATTTTAAAATTAAGG - Intronic
1153170009 18:2305051-2305073 TCTTCCATCTATTAAGGAGCAGG - Intergenic
1153284951 18:3448961-3448983 CTTTCCTTTTTTTAAAGTGATGG + Intronic
1153587372 18:6636891-6636913 TTCTTCATCTCTTTAAGTGATGG + Intergenic
1153635915 18:7113408-7113430 TTGTGCATCTTATAAAGTGAGGG + Intronic
1155645585 18:28073527-28073549 TTTTACATCTCTTAAGGTGGGGG + Intronic
1155998305 18:32356576-32356598 TTTTCAATATATGATAGTGATGG - Intronic
1157441381 18:47714354-47714376 TTCTCTATCTATTAGAATGAAGG - Intergenic
1157526569 18:48387375-48387397 TTGAGCATCTATTAAAGTGGAGG - Intronic
1157551720 18:48586569-48586591 TTTTACATCTATCAAATTTAAGG - Intronic
1158179580 18:54698741-54698763 TTTCCCTACTAGTAAAGTGAAGG - Intergenic
1159107337 18:64017596-64017618 TTTTCCATATATAAAATGGAGGG - Intergenic
1159830487 18:73272484-73272506 TTTTACATTTATGAAAGTGCAGG + Intergenic
1160358593 18:78250140-78250162 TCTCCCATCTATTAAACAGATGG + Intergenic
1162176868 19:8836816-8836838 TTTGCCATTTAATAATGTGATGG - Intronic
1162225226 19:9215502-9215524 TTGTACATCTATTAGAATGAAGG - Intergenic
1164531452 19:29051357-29051379 GTTTCCTTCTTTTAAAGTAAGGG + Intergenic
1165179219 19:33953381-33953403 TTTTCCATCCATTAAAGAACTGG - Intergenic
1165643770 19:37415448-37415470 TTTTCCATTAAGTAAAGTGCTGG - Intronic
1167801917 19:51748787-51748809 TTTTTCCTTTATTAAATTGATGG - Intronic
925895854 2:8471333-8471355 TTCTCCATCTGTAAAAGTAAAGG + Intergenic
930861528 2:56079121-56079143 TGTTCTTTCTTTTAAAGTGAAGG - Intergenic
930988907 2:57626795-57626817 TTTTCTTTTTTTTAAAGTGAGGG + Intergenic
931000994 2:57781989-57782011 TTTTCCTTCTAATAACCTGAGGG + Intergenic
931808054 2:65827182-65827204 TTTTGGTTCTTTTAAAGTGAAGG + Intergenic
931823838 2:65979046-65979068 TTTTAAATCAATTAAAGGGAAGG + Intergenic
932067259 2:68578182-68578204 AATTCCATCTATTATACTGAAGG - Exonic
933568910 2:83984421-83984443 TTTTGCATCTATATAAATGAGGG + Intergenic
933574420 2:84051093-84051115 TTTGCCATGTAATAAAGGGAAGG - Intergenic
936100076 2:109569568-109569590 TTTTCTGTCTATGAAATTGATGG + Intronic
936108462 2:109645674-109645696 TTGTCCACATATTTAAGTGAAGG - Intergenic
936741649 2:115519064-115519086 TTTCCAATTTATTAAAGTGTTGG + Intronic
936761988 2:115797618-115797640 TTTTCTATGTATTACAGTGTGGG - Intronic
936877598 2:117210777-117210799 TTTGTCAACTAATAAAGTGAAGG - Intergenic
937372859 2:121314165-121314187 TTTTGCATTTATTATAGTGCAGG - Intergenic
939625407 2:144471278-144471300 TTATCCATTTTTTAAAGGGATGG + Intronic
940123927 2:150301290-150301312 TTTTGCATCTATTTTTGTGAGGG + Intergenic
941729273 2:168898342-168898364 TTTTCTTTTTATTAAAGAGAGGG - Intronic
942353075 2:175075322-175075344 TTTTCCATCTATTGCAGCCATGG + Intronic
943157371 2:184199992-184200014 TTTTTCATGTTTTAAATTGAAGG - Intergenic
945308351 2:208281807-208281829 TTTGTCTGCTATTAAAGTGAGGG - Intronic
945713230 2:213327280-213327302 TTTTCCATTTATTAAGCAGATGG + Intronic
945880419 2:215319369-215319391 TTTTCAATTTTTTAAAGAGAAGG - Intronic
945907215 2:215607760-215607782 TTTTCCAATTTTTAAAGAGAAGG + Intergenic
945979985 2:216301811-216301833 TTTTCTAATTATTAAAATGAGGG + Intronic
946126150 2:217564689-217564711 TTTTCCATCCATAAAATTAAAGG + Intronic
946506864 2:220310806-220310828 TTTTCCGTCTCTTAAAAGGAAGG - Intergenic
948093230 2:235313590-235313612 TCTTCCATATTTTAAAGGGAAGG - Intergenic
948160749 2:235822104-235822126 TTTTCCATTTGATAAAGTTAGGG + Intronic
948236189 2:236392993-236393015 ATTTCCATTTATTTTAGTGATGG - Intronic
948317297 2:237038018-237038040 TTTTCCATTAATTAAAATCAAGG - Intergenic
1168991290 20:2097767-2097789 TTATCCATCTATTTGAGAGAGGG - Intergenic
1169035563 20:2448514-2448536 TTTTGCATCTATATCAGTGAGGG - Intergenic
1169572008 20:6916606-6916628 TTCTCCAGCTATTAAATTTAAGG - Intergenic
1170378296 20:15727355-15727377 TTTTACATCAAGTAATGTGATGG + Intronic
1170434341 20:16310049-16310071 TTAACTTTCTATTAAAGTGAAGG + Intronic
1170848316 20:19981119-19981141 TTCTTCATCTATAGAAGTGAGGG - Intronic
1171507660 20:25651875-25651897 TTTGGCATCTATTGAAGTAATGG + Intergenic
1171963267 20:31510659-31510681 TTTTCCATTTTTTATAGAGATGG - Intergenic
1172322718 20:34009144-34009166 TTTTCCATTTATAAGAGTGGGGG + Intronic
1172457006 20:35084799-35084821 TCTTCCATTTTTTAAATTGAAGG - Intronic
1172864880 20:38088370-38088392 TCTTCCATATCTGAAAGTGAGGG - Intronic
1173450509 20:43159437-43159459 TTTTCCATCTATAAAATGGCAGG + Intronic
1173555200 20:43960999-43961021 TTTTCCATCTTTGAAGGTGATGG + Intronic
1173572885 20:44088899-44088921 TTCCCCATCTATAAAAGAGATGG + Intergenic
1173944302 20:46938380-46938402 TTTTTTATCTATTAAAGTTTGGG - Intronic
1174118327 20:48243144-48243166 ATCTCCATCTATTATATTGAAGG - Intergenic
1174560858 20:51429766-51429788 TTTTTCATCTTTTAAAGCCATGG + Intronic
1176357926 21:5968019-5968041 TTCCTCATCTATTAAAATGAAGG - Intergenic
1176697024 21:9990324-9990346 TTTACCATCAATGAAAGAGAGGG - Intergenic
1177126551 21:17200900-17200922 TTTTAGATCTATTTAAGGGAAGG - Intergenic
1177242475 21:18477413-18477435 CTTTCTATCTATAAATGTGATGG - Intronic
1177574877 21:22940122-22940144 TATTCCATTTATTTAATTGAAGG + Intergenic
1177766844 21:25468190-25468212 TTTTCCATCCATTAAATAAAAGG + Intergenic
1178378576 21:32089584-32089606 TTTTCCATTTATTATAGTGGTGG + Intergenic
1179765592 21:43570532-43570554 TTCCTCATCTATTAAAATGAAGG + Intronic
1179995359 21:44971560-44971582 TAGTTCATCTCTTAAAGTGAGGG + Intronic
1182021330 22:27083966-27083988 TTTTCTATCTTTTATAGAGATGG - Intergenic
1183528307 22:38337178-38337200 TTTTCCATCTTTTGTAGAGATGG + Intronic
1183878265 22:40803127-40803149 TTTTTCTTCTTTTAAAGAGATGG + Intronic
1184459801 22:44630761-44630783 TTTCCCATCTATAAAATAGATGG + Intergenic
949240463 3:1865240-1865262 TTTTCAATTTATTAAATTAAAGG + Intergenic
950052907 3:10005634-10005656 TTTTTCATCAGTTACAGTGAAGG - Intronic
951324853 3:21288991-21289013 TTGGCCAGCTATGAAAGTGAAGG - Intergenic
951639009 3:24813234-24813256 GTTTCCATCTTTTGAAGGGAGGG - Intergenic
951960398 3:28312085-28312107 TTTTCCACCTATTAAGATGATGG + Intronic
952134748 3:30405043-30405065 TTTTCCATCACTGAAAATGATGG + Intergenic
952649294 3:35705685-35705707 TTTTGCCTCTTTTAAAGAGAAGG - Intronic
954055172 3:48017119-48017141 TTTTCCATCTATTAAAGTGAGGG - Intronic
954721804 3:52570757-52570779 TTTTCCAGCTATAAATATGATGG + Intronic
956878399 3:73486639-73486661 TTTTCCTTCTTTTAAAATTATGG - Intronic
957238091 3:77621113-77621135 TTTAGAATTTATTAAAGTGAAGG - Intronic
957347427 3:78980035-78980057 TTGTACATGTATTAAAGTGTAGG - Intronic
957996578 3:87697759-87697781 TTTTCCATCTATTACAGTGGGGG - Intergenic
958556890 3:95690597-95690619 TTTTCCACCTTTTAAAGATATGG - Intergenic
959029839 3:101286092-101286114 TTATCCTTCTCTTAAAGAGAAGG - Intronic
959132423 3:102373523-102373545 TTTTCCATCTTTTAAAATAATGG + Intronic
959321596 3:104883137-104883159 TTTCCCATCTATTGGAGAGATGG - Intergenic
959806300 3:110558167-110558189 TATTCCAGATCTTAAAGTGAAGG + Intergenic
960170651 3:114456633-114456655 TTTTCCGCCCATGAAAGTGATGG + Intronic
960242569 3:115362725-115362747 TGTTACAACTATTAAAGTGGTGG + Intergenic
960402001 3:117211534-117211556 TTTTCCAAAAATTGAAGTGAAGG + Intergenic
960538958 3:118843804-118843826 TTTTGCAGCTAAAAAAGTGAGGG + Intergenic
961846181 3:129765826-129765848 TCTTCAAACTCTTAAAGTGAGGG - Intronic
964727047 3:159824159-159824181 TTTTCAATTTATTAATATGAGGG - Intronic
965077502 3:163997541-163997563 TTTTCCAACTTTTAAATTCAGGG - Intergenic
965294053 3:166920408-166920430 ATTTCAATCCATTAATGTGATGG - Intergenic
965440978 3:168713538-168713560 TTTTCCATCTTTTAAACTGTTGG - Intergenic
965832684 3:172811797-172811819 TTTACTGTCTATTAAATTGAAGG + Intronic
967044333 3:185722929-185722951 TTTTCTCTATATTAAAATGAAGG - Intronic
967214712 3:187200215-187200237 TTTTCCATCTATAAAACTCAGGG + Exonic
967779134 3:193417462-193417484 TTTTCATGCTATTAAAGTGAAGG + Intronic
968247632 3:197169192-197169214 TTTTCAATGAATCAAAGTGAGGG - Intronic
969147146 4:5133872-5133894 TTTTCCATTTAATAAAATGGAGG - Intronic
970012044 4:11470008-11470030 TTTTCCATCTTTCAAATTGTTGG - Intergenic
971442503 4:26703131-26703153 TTATCCATCTATTTATGTTATGG - Intronic
971525710 4:27615361-27615383 TTTTCAATTTATTAAAAGGAAGG - Intergenic
971704253 4:30018930-30018952 TTTTCTATTTATTACAGAGAAGG - Intergenic
971909539 4:32777722-32777744 TTTTCCATTTATTAAGATAAAGG + Intergenic
973251280 4:48063046-48063068 TTTGCCATCTATCCATGTGACGG + Intergenic
973653599 4:53022501-53022523 TTTTCCATCTAGCAAATTGGAGG + Intronic
973839638 4:54848033-54848055 ATTTCCATCTATTAAAAACAGGG + Intergenic
974961715 4:68710217-68710239 TTTTTCATCTATTATATGGAAGG - Intergenic
975459847 4:74638522-74638544 TTTTGCTTCTATAAATGTGATGG + Intergenic
975693845 4:76992478-76992500 TTTCCCAACTAGTAAAGTCAAGG - Intronic
976671201 4:87656049-87656071 TGTTCCATGTATTGTAGTGAAGG - Intronic
977023285 4:91784376-91784398 TTTTCCATTTAATAAAGGGAGGG + Intergenic
977838053 4:101668840-101668862 TACTGCATCTATTCAAGTGATGG + Intronic
977856200 4:101897463-101897485 TTCTCCATCTATAAAAATAAGGG - Intronic
978193908 4:105948427-105948449 TTTTTCATCTGTAAAATTGAGGG + Intronic
978978618 4:114913657-114913679 TTTTCAATCTACTACAGTGCTGG + Intronic
979947660 4:126853691-126853713 TTTTCCATCATTTAAAAGGAAGG - Intergenic
980255083 4:130370014-130370036 TCTTCTATCCATTAAAGTGAAGG - Intergenic
980369631 4:131850516-131850538 TTTACCATCAATGAAAGAGAGGG - Intergenic
980557131 4:134423327-134423349 TTTTCCTTGTTTTAAAGAGAAGG - Intergenic
980688302 4:136259137-136259159 ATTTCCAGCTATTAATGTCATGG + Intergenic
980896012 4:138861054-138861076 TTGCCCATCTGTAAAAGTGAGGG - Intergenic
981820139 4:148877741-148877763 TTTTCAGTCTTTTAAAGAGAAGG + Intergenic
982077883 4:151756914-151756936 TTTTCCAGCTGTGAATGTGATGG - Intronic
982558267 4:156896947-156896969 TTGACCATCTGTTAAAATGATGG + Intronic
983807087 4:172007829-172007851 TGATCCATCTATAAAAGGGAAGG - Intronic
984522262 4:180816365-180816387 TTTTCCAGCAATTAAAGTGTGGG + Intergenic
984744366 4:183199771-183199793 TTTCACATCTATAAAACTGATGG + Intronic
984788727 4:183593806-183593828 TTTTAAATCTATTATAGAGATGG + Intergenic
985084906 4:186303065-186303087 TCTTCCATCTATTGAGATGATGG + Intergenic
985971999 5:3385569-3385591 TTGTCCATTTATGAAAGGGAGGG + Intergenic
986659293 5:10044754-10044776 TTTACCATCAAATAAAATGATGG + Intergenic
987249501 5:16084132-16084154 ATTTACATTTTTTAAAGTGAGGG - Intronic
987852838 5:23379321-23379343 TTTTCCATCTAGTAAAGGGATGG - Intergenic
988390795 5:30627311-30627333 TTTTCCATCTATGAAATGAAAGG + Intergenic
988471389 5:31542529-31542551 TTTTCAATCTCTTGACGTGAAGG + Intronic
988842759 5:35098869-35098891 TTCCCCATGTGTTAAAGTGAGGG - Intronic
989666255 5:43857902-43857924 CTTTCCATCCACAAAAGTGATGG - Intergenic
990065180 5:51703978-51704000 TTTTAAATCTATTATAATGAAGG + Intergenic
990332022 5:54737592-54737614 TTTTCCATCTATCAAATATAGGG - Intergenic
990441129 5:55846500-55846522 TTTCTCATCTATAAAAGTGAAGG + Intergenic
992411469 5:76509901-76509923 TTTTCCATATCTTAAAATTATGG + Intronic
992519326 5:77533869-77533891 TTTTCCACATATTAAAGAGCTGG + Intronic
992572540 5:78074618-78074640 TTTTCCATTTTATAAAGTTAAGG - Intronic
994176919 5:96721077-96721099 TTTTCCCTCTATCAAATTAATGG - Intronic
994849111 5:105031100-105031122 TTTTCCATCAAGAAAAATGAAGG - Intergenic
995016147 5:107311538-107311560 TATTCCTAATATTAAAGTGATGG + Intergenic
995669111 5:114580264-114580286 CTTTCCATCTTTAAATGTGAAGG - Intergenic
996799575 5:127388317-127388339 TTTTGCATCTTTTATAGAGATGG + Intronic
997175626 5:131773493-131773515 GTTTCCTTCTATTAAAATGCAGG + Intronic
998352072 5:141508371-141508393 TTTCCCATCTATAAATCTGAGGG - Intronic
1000603316 5:163300865-163300887 TTTTCTATCTTTTAAATTGTAGG - Intergenic
1000633748 5:163620187-163620209 TTTTCCATCTCATTAACTGAGGG - Intergenic
1000829886 5:166089770-166089792 TTTGCCACCTATTAAAATAAAGG + Intergenic
1001100334 5:168808995-168809017 TTTTCCATCTGTTCAGGTGGAGG + Intronic
1002830632 6:817163-817185 TTTCTAATGTATTAAAGTGAAGG + Intergenic
1002956113 6:1866494-1866516 TTTTCTATTTATTAAAGGGCAGG + Intronic
1003733795 6:8854919-8854941 TTTTCCATCTAATAAAGGTTAGG + Intergenic
1004296693 6:14418680-14418702 TTTTAAATCTATTAATATGATGG + Intergenic
1005363139 6:25051599-25051621 TTTTACATATAAAAAAGTGAAGG + Intergenic
1009682805 6:66920911-66920933 CTTTCCATCTATTATTCTGAGGG + Intergenic
1010091965 6:71993206-71993228 TTTTCTCTCTTTTAAAATGATGG - Intronic
1011100310 6:83712978-83713000 TCCTCCACCTCTTAAAGTGATGG - Intergenic
1011467135 6:87669793-87669815 TTTTCCATCTATTTAAGGTAAGG + Intergenic
1011524193 6:88245529-88245551 TTTTCCATCTGTTAGAGAAATGG - Intergenic
1012024260 6:93968036-93968058 TTTTCCCTCAGTTAAAATGAAGG - Intergenic
1012920024 6:105211892-105211914 TTCTCCATCTATGAAAGTGAAGG - Intergenic
1013601381 6:111708315-111708337 TTTTCCATCCATCCAAGTTAAGG - Intronic
1013810442 6:114039223-114039245 TTTTACATACATTAAAGGGAGGG - Intergenic
1014716995 6:124878296-124878318 TTTTTCATCTATGAAACTGTTGG + Intergenic
1015002292 6:128233054-128233076 TTTTCCACTTATTATAATGAAGG - Intronic
1015997756 6:139012273-139012295 TTTTCTATATATTTAATTGAGGG - Intergenic
1016098159 6:140063438-140063460 TTTTACATCTATTAGAATCACGG - Intergenic
1016174715 6:141066842-141066864 TTTTTCCTCTTTTATAGTGAAGG + Intergenic
1016454174 6:144214392-144214414 CATTCCATCTATTAATGGGAGGG + Intergenic
1016776923 6:147914578-147914600 TTTTGCAGCCATCAAAGTGAAGG + Intergenic
1016868947 6:148797968-148797990 TTTGCCATCCATTAGAATGATGG - Intronic
1019829294 7:3310633-3310655 TTTTGAATTTATTAATGTGAGGG + Intronic
1022221913 7:28322029-28322051 TTATCCATTTATTAAACTTAGGG + Intronic
1022730324 7:33016837-33016859 TTTTCCAACTATGAATGTTAAGG + Intronic
1023353609 7:39344721-39344743 TTTTTCATCTATAAAAGGGAGGG + Intronic
1023434201 7:40125400-40125422 TTTTTCGTCTATTGATGTGATGG + Intergenic
1024382679 7:48717015-48717037 ATCTCCATCTACTAAAGTTAAGG + Intergenic
1026023188 7:66726532-66726554 TTTTAAATTTATTAAAGAGATGG + Intronic
1026268864 7:68819194-68819216 TCATCCACCTATCAAAGTGATGG + Intergenic
1026378951 7:69780025-69780047 TTTTCCATCTTTTCTAGAGATGG + Intronic
1026990573 7:74582876-74582898 TTTTCCATCTTTTGTAGAGATGG - Intronic
1027485281 7:78753989-78754011 TTTACCATATTTTAAAGTGTGGG - Intronic
1027575701 7:79928468-79928490 TTTTCCAACTATTAAATTCAGGG + Intergenic
1027679198 7:81197917-81197939 TCTTCCATATATTGAAGTGCTGG - Intronic
1027899732 7:84096281-84096303 TTTTCTATATTATAAAGTGAAGG + Intronic
1030499633 7:110343315-110343337 CTTTTCATCTATAAAACTGAGGG - Intergenic
1031041977 7:116847980-116848002 TTATCATTCTATTAAAGTTAGGG + Intronic
1031567498 7:123319124-123319146 TTATCCATCCAATAAATTGAAGG + Intergenic
1031642713 7:124185036-124185058 TTTTCTATCTATCCAAGTGAAGG + Intergenic
1031924714 7:127628504-127628526 TTTTGCATTTTTTAAAGGGAGGG + Intergenic
1032328508 7:130955174-130955196 TTTTACATCAATTAAAATGGAGG + Intergenic
1034217404 7:149419065-149419087 TTTTCCATCTTTTCTAGTAAAGG + Intergenic
1034695407 7:153048812-153048834 GTTTCCATCTATTAAATAAATGG + Intergenic
1036534310 8:9630575-9630597 TTTTCCCCCCATTAATGTGATGG - Intronic
1037306816 8:17513479-17513501 TTTTCTATCTTTTAAAATCATGG - Intronic
1037871893 8:22505869-22505891 TTTTCCTTCTAGTACAGGGAGGG + Intronic
1039836335 8:41259085-41259107 TTTCCCATCTATTAACATTATGG - Intergenic
1040362570 8:46681574-46681596 TTTTCCATCTCTTATAGTGCTGG + Intergenic
1041046107 8:53887804-53887826 TTTTGCATTTTTTAAAGAGACGG - Intronic
1041744716 8:61196221-61196243 TTTCTCTTCTATTAAAGAGATGG + Intronic
1041773374 8:61496942-61496964 TTTTCCATCTAAAAAACTAAGGG - Intronic
1042838448 8:73099277-73099299 TTTTACATTTTTTAAAATGATGG + Intronic
1042938717 8:74086505-74086527 TTTTCCTTCTGTAAAAGTCAGGG + Intergenic
1043207547 8:77465395-77465417 TTTTGCATATATTAAAATGGAGG - Intergenic
1043521672 8:81053318-81053340 TTTTCCATATATTTGAGTAATGG + Intronic
1043559391 8:81472920-81472942 TTTTCAAACTATTGAAGAGAAGG - Intergenic
1044202783 8:89456334-89456356 TTTCCCATCCATAAAAATGAGGG - Intergenic
1046082433 8:109387498-109387520 TTTTTCATCTGTAAAATTGAAGG + Intronic
1046953217 8:120037856-120037878 TCTTCCATCTATAAAGATGATGG + Intronic
1047673778 8:127177431-127177453 TTTTACATTTATAAAAGAGAGGG + Intergenic
1050244612 9:3675494-3675516 TTTTTCATCAAGTGAAGTGAAGG + Intergenic
1050904627 9:10988498-10988520 TTTTCCATGAATGAGAGTGAAGG - Intergenic
1051304487 9:15694168-15694190 TTTTCTAACTATTAAATTGCTGG + Intronic
1051637220 9:19191516-19191538 TTTTCCATCCCCTACAGTGATGG + Intergenic
1052051740 9:23856563-23856585 TTTTTAATCAACTAAAGTGATGG - Intergenic
1052296770 9:26905378-26905400 TTTTACATCTTGTAAAGTGGTGG - Exonic
1053347831 9:37391023-37391045 TTCTCCATCTATAAAACTGCAGG + Intergenic
1053634008 9:39976176-39976198 TTTACCATCAATGAAAGAGAGGG - Intergenic
1053771739 9:41487328-41487350 TTTACCATCAATGAAAGAGAGGG + Intergenic
1054209879 9:62274521-62274543 TTTACCATCAATGAAAGAGAGGG + Intergenic
1054315116 9:63574433-63574455 TTTACCATCAATGAAAGAGAGGG - Intergenic
1055156607 9:73070279-73070301 TTTTGCATCTATTATAATCATGG - Intronic
1055666171 9:78555289-78555311 TATTCCATCTACTAAACTAAAGG - Intergenic
1056425469 9:86471247-86471269 TTTTCCATCTAAAAATGGGAAGG - Intergenic
1057849244 9:98551858-98551880 TTTCTCATCTCTGAAAGTGATGG + Intronic
1058186141 9:101857761-101857783 TTCTTCATATATTAAAGTGATGG - Intergenic
1058477960 9:105359834-105359856 TTTTCCATCTGTTGAAGAGGAGG - Intronic
1058676562 9:107405223-107405245 TTTTCTATCTTTTATAGAGATGG + Intergenic
1059261561 9:112982028-112982050 CTGTCGATCTATTAAAATGAGGG + Intergenic
1059397501 9:114047330-114047352 GTTTCCATGTCTTACAGTGAGGG + Intronic
1059636183 9:116173035-116173057 TTCCCCATCTATTCAACTGAAGG - Intronic
1060520864 9:124293257-124293279 TTCTTCATCTGTAAAAGTGAAGG + Intronic
1186022892 X:5276258-5276280 TTTTCTATTTTTTATAGTGATGG - Intergenic
1187305310 X:18090002-18090024 TTTGTTATCTGTTAAAGTGAGGG - Intergenic
1188487473 X:30699041-30699063 TATCCCGTCTGTTAAAGTGAGGG - Intronic
1188749836 X:33891791-33891813 TTTTCTATTAATTAAAATGAAGG + Intergenic
1189765119 X:44363492-44363514 TTTTTCATCTATAAAATGGATGG + Intergenic
1189818392 X:44846511-44846533 TTTTCCATCTGTAAAAGTAGTGG - Intergenic
1190570316 X:51775079-51775101 TTTACCATCTATTATAGTAAAGG - Intergenic
1191776194 X:64816283-64816305 TTTTCCCACTATTATAGTGTGGG - Intergenic
1192103931 X:68294764-68294786 TTCTCCATCTGTTGAATTGAGGG + Intronic
1192888213 X:75360331-75360353 TTTTCAATCTATAAAAATTATGG - Intergenic
1194420504 X:93667709-93667731 TTTTCCATCTTATAAATTGTTGG + Intergenic
1195566106 X:106340630-106340652 TTTACAATCTATTATAGTAAAGG + Intergenic
1195941089 X:110168554-110168576 TTCTCCATCTATAAAATGGAGGG + Intronic
1196821613 X:119705766-119705788 TTTTCCATCTCTTAATGTTGAGG - Intergenic
1198299797 X:135324119-135324141 TTTTTCATCTTTTACTGTGACGG - Intronic
1199592122 X:149477235-149477257 TTTTTCCTCTATAAAAGTCAGGG - Intergenic
1200387332 X:155907041-155907063 TTTTACATCTATTGAAATGATGG + Intronic