ID: 954055767

View in Genome Browser
Species Human (GRCh38)
Location 3:48023047-48023069
Sequence TAGGATGACGATAATGCACT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 61}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954055763_954055767 10 Left 954055763 3:48023014-48023036 CCATTAGCCTACAAGAGAAATGA 0: 1
1: 0
2: 1
3: 14
4: 165
Right 954055767 3:48023047-48023069 TAGGATGACGATAATGCACTAGG 0: 1
1: 0
2: 0
3: 6
4: 61
954055762_954055767 23 Left 954055762 3:48023001-48023023 CCAAAAAATAGTACCATTAGCCT 0: 1
1: 0
2: 2
3: 15
4: 278
Right 954055767 3:48023047-48023069 TAGGATGACGATAATGCACTAGG 0: 1
1: 0
2: 0
3: 6
4: 61
954055764_954055767 3 Left 954055764 3:48023021-48023043 CCTACAAGAGAAATGAAATGCAA 0: 1
1: 0
2: 3
3: 44
4: 510
Right 954055767 3:48023047-48023069 TAGGATGACGATAATGCACTAGG 0: 1
1: 0
2: 0
3: 6
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954055767 Original CRISPR TAGGATGACGATAATGCACT AGG Intronic
905298153 1:36967691-36967713 GAGGGTTAAGATAATGCACTTGG + Intronic
908747324 1:67388237-67388259 TACTAGGACGACAATGCACTTGG - Intronic
908943111 1:69460659-69460681 TAGGAAGACGAAAAGGAACTGGG - Intergenic
914684047 1:149962364-149962386 TAGGAGGAGGATAATGAACTGGG - Intronic
920016314 1:202912488-202912510 GAGGATGGCGATAATGGATTTGG + Intronic
921564969 1:216705923-216705945 TAGGATGATGATAATGTACCTGG - Intronic
1066419662 10:35252755-35252777 TTGGATGACAACAATGCAGTTGG - Intronic
1067219177 10:44330669-44330691 AAAGATGAAGATAAAGCACTTGG + Intergenic
1069427434 10:68301256-68301278 TAGGATGGTGAAAATGCAGTGGG + Intronic
1073710866 10:106038968-106038990 TAAGAAGAAGATAATGCTCTAGG + Intergenic
1075513514 10:123091507-123091529 TAGGATGAAGATAAGGGAATTGG - Intergenic
1085534605 11:77210580-77210602 TAAGATGACCATAAGGCTCTAGG + Intronic
1086257680 11:84898444-84898466 TATGATGAAGATAATGCAGGAGG - Intronic
1092788315 12:12049858-12049880 TAGGATGAAGCGAAAGCACTGGG - Intronic
1098199158 12:68036475-68036497 GAGGATGACTATAATGGATTTGG + Intergenic
1106346876 13:28887670-28887692 TGGGATGACCTTCATGCACTCGG + Intronic
1106959262 13:34978563-34978585 TGGGATGACTATAATGTTCTAGG - Intronic
1116485351 14:45442357-45442379 TAGGCTGACTACAGTGCACTAGG + Intergenic
1120020258 14:79522160-79522182 TTGGATGACTGTAATGCACAGGG + Intronic
1121856936 14:97278819-97278841 TAGCATGACCAAAATCCACTTGG + Intergenic
1122064375 14:99161654-99161676 TAGGATGGGGAAAAGGCACTGGG + Intergenic
1130149968 15:81303990-81304012 TGGGATGACAGCAATGCACTCGG - Intronic
1130866620 15:87938730-87938752 TAGGATGACACTAATCCACGGGG - Intronic
1132322409 15:100935638-100935660 TGGGAGGAAGAGAATGCACTGGG + Intronic
1135561867 16:23482922-23482944 ACTGATGACGATGATGCACTCGG - Exonic
1136854963 16:33647865-33647887 GAGGATCACGTTAATGCCCTAGG + Intergenic
1140832007 16:78760559-78760581 GAGGATGCCCACAATGCACTTGG + Intronic
1142498745 17:320709-320731 TAGGAAGACACAAATGCACTGGG - Intronic
1145041056 17:19579063-19579085 TAGGATGGATATAATGCTCTAGG + Intergenic
1149426479 17:56559287-56559309 TAGGATAAGAAGAATGCACTTGG - Intergenic
1150225193 17:63520876-63520898 CAGGCTGAGGATAATGAACTAGG - Intronic
1152130857 17:78475591-78475613 TCGGATGTCGATAATGCAACCGG + Intronic
1152472454 17:80497796-80497818 TATGATCACGACACTGCACTGGG + Intergenic
1153516259 18:5904890-5904912 TTGGATGAAGAAAATGCACTAGG - Intergenic
929626345 2:43412314-43412336 TGGGTTGAAGATTATGCACTTGG - Intronic
930432350 2:51295093-51295115 AAGGAAGAAGATAAAGCACTGGG - Intergenic
931184436 2:59936368-59936390 AGGGATGACAATACTGCACTAGG + Intergenic
931801226 2:65760124-65760146 TAGGATGACATTAATGAAGTTGG + Intergenic
935599378 2:104907088-104907110 TAGGATGACGATGAGGGGCTGGG - Intergenic
941606924 2:167609502-167609524 CAGGATGAGGATGATGCTCTGGG - Intergenic
947242480 2:228011134-228011156 TAGAATGACAAAAATGCATTAGG + Intronic
1184587523 22:45458046-45458068 TAGGATGGAGAAAATGCCCTAGG - Intergenic
949370859 3:3333444-3333466 GAGGATGTCTATAAAGCACTTGG - Intergenic
949650299 3:6150447-6150469 TAGGAAGTCTATAATGCACTGGG + Intergenic
949785645 3:7738253-7738275 TAGGAAGACAATACTGCAGTTGG - Intronic
954055767 3:48023047-48023069 TAGGATGACGATAATGCACTAGG + Intronic
955370421 3:58346619-58346641 TAGAATTACTATAAAGCACTTGG - Intronic
955757876 3:62244334-62244356 TAGTAAGAAGATAAAGCACTTGG + Intronic
957383420 3:79464439-79464461 TAGGATGACTATAATGAAAAAGG - Intronic
957541501 3:81576192-81576214 TATGATGAAGGTAATGCATTAGG + Intronic
957542060 3:81584707-81584729 TATGATGAAGGTAATGCATTAGG - Intronic
962593951 3:136920632-136920654 TAGGATGATGATACTGATCTTGG - Intronic
970481386 4:16479403-16479425 TAGGATGATGAAAATGCAAAAGG - Intergenic
976409737 4:84699730-84699752 TAGGATGACCATAATGGGGTGGG - Intronic
977352453 4:95905705-95905727 TATGATCACAATAATGAACTGGG + Intergenic
980204469 4:129699562-129699584 TCTGATGAGGTTAATGCACTGGG + Intergenic
984597995 4:181693457-181693479 TGGGATGATGACAATGCACCAGG - Intergenic
987257611 5:16172693-16172715 TAGGATGTAGCTGATGCACTAGG - Intronic
998669584 5:144338717-144338739 TGGGATGAAGATCATGTACTTGG + Intronic
1022652001 7:32285894-32285916 AAGGATGAAGATAATGCAGGGGG - Intronic
1024286606 7:47763195-47763217 CAGGATGATGATCATTCACTGGG - Intronic
1025050110 7:55726718-55726740 AAGGATGACGAAAATTCACTGGG - Intergenic
1030524430 7:110636359-110636381 TTGGTTAACCATAATGCACTAGG + Intergenic
1032172002 7:129592660-129592682 TAGGAAGAAGAGAATGCTCTAGG + Intergenic
1042540099 8:69899339-69899361 TTGGATGATGACAACGCACTCGG + Intergenic
1045628665 8:104088289-104088311 CAGGATGACGAAAATGCACATGG + Intronic
1052785622 9:32825550-32825572 TAGGATAAAGATAATGACCTGGG + Intergenic
1196615776 X:117765752-117765774 TAGCATGACCATAATGCAAATGG - Intergenic