ID: 954056798

View in Genome Browser
Species Human (GRCh38)
Location 3:48033049-48033071
Sequence CACTTTTAAAATAAGGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 571
Summary {0: 1, 1: 0, 2: 3, 3: 51, 4: 516}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954056798_954056801 -9 Left 954056798 3:48033049-48033071 CCAACCTCCTTATTTTAAAAGTG 0: 1
1: 0
2: 3
3: 51
4: 516
Right 954056801 3:48033063-48033085 TTAAAAGTGAGAAAAGTCCAAGG 0: 1
1: 0
2: 2
3: 44
4: 413

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954056798 Original CRISPR CACTTTTAAAATAAGGAGGT TGG (reversed) Intronic
900504086 1:3020585-3020607 CACTTTTTTCCTAAGGAGGTTGG - Intergenic
901042927 1:6376424-6376446 CTCTTTAAAAATAAGGTGGGAGG + Intronic
901504226 1:9674377-9674399 CACTTTGAAAATACGAAGGTTGG + Intronic
903346505 1:22687945-22687967 CACCTGTAAAATGAGAAGGTTGG - Intergenic
903760103 1:25691801-25691823 AACTTTTAACAGGAGGAGGTGGG + Intronic
905586663 1:39125058-39125080 CATTTTTATAATAAGGAAATAGG - Intronic
905663999 1:39750897-39750919 GATTTTTAAAATAACGATGTGGG - Intronic
906781560 1:48577201-48577223 CACTTGTGCAATAAGAAGGTGGG + Intronic
906997641 1:50814651-50814673 CATTTTTTAAATAAGGTTGTTGG - Intronic
907911798 1:58833717-58833739 CACTTTTACAGTCAGGAGCTGGG - Intergenic
908781690 1:67696798-67696820 CACTTTTAAAAAAAAGATTTAGG - Intergenic
909323274 1:74317432-74317454 CACTTTAGAAATAAGAAGCTGGG + Intronic
909847314 1:80411435-80411457 CAGTTTTAATATAAAGTGGTAGG - Intergenic
910080592 1:83337224-83337246 CACTCTGAAAATAAAGAGGTAGG - Intergenic
910341516 1:86193649-86193671 CACCTGTAAAATAAGCAGGGGGG + Intergenic
910553712 1:88506078-88506100 CATTTTTAAAATAAAGAAGATGG - Intergenic
910813853 1:91266975-91266997 CTCTTTTAAAAACATGAGGTGGG + Intronic
911244576 1:95502702-95502724 CACTTGCAAAATGAGAAGGTTGG - Intergenic
913555802 1:119965785-119965807 CACTTCTAAATGAAGGATGTAGG + Intronic
914729243 1:150356052-150356074 CATTTGTACAATAAAGAGGTAGG + Intergenic
914882825 1:151560759-151560781 CACTGGAAAAATAAGGAAGTTGG - Intronic
915224448 1:154402268-154402290 CACTTTTTAGATAAGGAGCTAGG - Intergenic
915790583 1:158665822-158665844 CACCTATAAAATAAGGGGTTGGG - Intronic
916585534 1:166146615-166146637 CACATTCAAAAAAAGGAGGTTGG + Intronic
916925653 1:169517792-169517814 AGCTCTTAAAATAAGGAGGGCGG + Intronic
919204745 1:194407486-194407508 CACTTTTAAAAGAGGGCTGTTGG + Intergenic
919361520 1:196601721-196601743 CAATTCTAAAAAAAGGAAGTAGG - Intronic
920314461 1:205067440-205067462 CAGTTTTTAAATGAGGAGTTTGG - Intronic
920725416 1:208430304-208430326 CATCTGTAAAATGAGGAGGTTGG - Intergenic
921814411 1:219547715-219547737 CACTTAGTAAAGAAGGAGGTTGG - Intergenic
922302717 1:224316835-224316857 CACTTTAAAAATGAAGAGGTTGG + Intronic
922385864 1:225081740-225081762 AACTTATAAAATAAAGAGGAGGG - Intronic
922647969 1:227310336-227310358 CACTTTGAAACTAGGGAGGGAGG + Intronic
923298636 1:232619748-232619770 CAATTTTAAAATAAGGATGTGGG - Intergenic
923507707 1:234620514-234620536 CACTATTAAAATCTGGATGTGGG + Intergenic
924492873 1:244556521-244556543 CACTTTAAATATAAGGAGATAGG + Intronic
924755422 1:246936521-246936543 CACCTATAAAATAAGGTGTTTGG - Intergenic
1063426216 10:5952044-5952066 CATCTATAAAATGAGGAGGTGGG + Intronic
1063443474 10:6091904-6091926 CACTTGAAAGATAAGTAGGTGGG + Intronic
1063861980 10:10320185-10320207 CACATTAAAAATAATGAAGTTGG + Intergenic
1063901389 10:10736038-10736060 CATCTTTAAAATAAGGAAATTGG + Intergenic
1064109767 10:12528604-12528626 GATTTTTAAAATCAGGAGGTGGG - Intronic
1064277553 10:13920414-13920436 CACTTTCAAAATACCCAGGTAGG - Intronic
1064623617 10:17240186-17240208 CACTTCAAAAAGGAGGAGGTTGG + Intergenic
1064991637 10:21261792-21261814 TACCTTTAAAATAAAGAGATAGG + Intergenic
1065364188 10:24918800-24918822 CATTTGTAAAATGATGAGGTTGG - Intronic
1068704517 10:60058999-60059021 TTCCTTTAAAATAATGAGGTGGG - Intronic
1069431652 10:68340965-68340987 TGCTTTTAAAATAAGCAGATAGG - Intronic
1069710602 10:70486134-70486156 TACTTTGAAAATCAGGAGGCAGG + Intronic
1070147838 10:73787549-73787571 GACTTGTAAAATAAAGGGGTTGG + Intronic
1070236478 10:74632883-74632905 CACTTTTCAAATAAAAAGGAAGG - Intronic
1070400667 10:76050870-76050892 CACCTTTCAAATAAGGGAGTTGG + Intronic
1070471531 10:76785250-76785272 CACTTGTAAAATGAGAGGGTCGG - Intergenic
1070607692 10:77910600-77910622 CATTTGTAAAATAAGGAGTTTGG + Intronic
1071296383 10:84223261-84223283 TACTTTCAAACTAATGAGGTAGG - Intronic
1072048714 10:91682358-91682380 CACTTTTAATATTAGCAGGAGGG + Intergenic
1072480062 10:95802452-95802474 TAATTTTAAAAAAAGAAGGTGGG - Intronic
1073842457 10:107513596-107513618 GAATTTTAAAATAGGGTGGTAGG + Intergenic
1074506872 10:114078929-114078951 CACTTTGCAAGTAAGGAGGCTGG - Intergenic
1074521455 10:114228707-114228729 GACATTTAAAATATGGGGGTGGG - Intronic
1074715470 10:116214452-116214474 CACCTGTAAAATGAGGGGGTTGG - Intronic
1074757668 10:116637288-116637310 TACTTTTAAAATAAGAAGCAGGG - Intronic
1074914798 10:117945260-117945282 CAGTTTTAAAATGAGGAACTGGG + Intergenic
1074967364 10:118503232-118503254 CAATGTTTACATAAGGAGGTGGG - Intergenic
1075098399 10:119488984-119489006 CACTTTTAAAATAAAGTGATGGG + Intergenic
1075322750 10:121505310-121505332 CAGTATTAAAATAAAGAAGTGGG + Intronic
1075350158 10:121717106-121717128 CATCTGTAAAATAAGCAGGTTGG + Intergenic
1075509382 10:123057749-123057771 CACTTTTAAAATGAGAGAGTTGG - Exonic
1075742669 10:124705364-124705386 CATTTGTAAAACAAGGAGGCTGG + Intronic
1076219697 10:128723299-128723321 CTCTTTTAAAATGGGGTGGTTGG + Intergenic
1077625267 11:3765865-3765887 CACATGCAAAATAATGAGGTTGG - Intronic
1077983622 11:7328164-7328186 CACTTAAAATATAAGGATGTAGG - Intronic
1078671902 11:13373172-13373194 CATCCATAAAATAAGGAGGTTGG - Intronic
1078858042 11:15222301-15222323 CACTTTTAAAAGAAAGAGGTGGG - Intronic
1079431165 11:20389266-20389288 CACTTTTGAAATAAGGCACTTGG + Intronic
1079453091 11:20614325-20614347 CATTTTCAAAATAAGGAAGCAGG - Intronic
1080237642 11:30090272-30090294 CACCTGTGAAATTAGGAGGTTGG + Intergenic
1082929838 11:58591024-58591046 CACTTATAAAATAAAGAAGGGGG - Intronic
1082959759 11:58907023-58907045 CATTTCTAAATTAAGGAGTTTGG - Intronic
1083364080 11:62130890-62130912 CACTTGTAAAGCAAGTAGGTTGG - Intronic
1084457548 11:69277180-69277202 AATTTTTAAAAAAAGGAAGTAGG + Intergenic
1084551283 11:69843636-69843658 CATTTTAAAAATGAGGAGGGGGG + Intergenic
1084945405 11:72635679-72635701 CACTTGTAAAAGGAGGAAGTTGG - Intronic
1085362770 11:75906720-75906742 CACTTTTAAAAGAATGAAGTTGG - Intronic
1085438578 11:76534918-76534940 CACCTATAAAATAAGCAAGTTGG - Intronic
1085964532 11:81505329-81505351 CATTTTCAAAATAAGTAGCTCGG - Intergenic
1086277788 11:85151883-85151905 CGCTTTTAAAATAAGGATCATGG + Intronic
1086581947 11:88409458-88409480 CATTTCTAAAATAAGGCTGTTGG - Intergenic
1087106489 11:94414068-94414090 CACTTTTATAAAAAGGAACTTGG + Intergenic
1087971175 11:104486588-104486610 CACTTTCAAAATAATTATGTGGG - Intergenic
1088426204 11:109706871-109706893 CACATTTAAAATAAGCACCTGGG - Intergenic
1088589589 11:111392048-111392070 CATTTTTAAAATGAGGAAATAGG + Intronic
1089235928 11:117025256-117025278 CAGTTATGAAATAAGGGGGTTGG - Intronic
1090344786 11:126061693-126061715 CACCTTGAAAAACAGGAGGTTGG - Intronic
1090354150 11:126128340-126128362 CACTTTTTAAATAGGGGGATGGG - Intergenic
1090480816 11:127066751-127066773 CACTTAGTAAATAAGGAGGTGGG - Intergenic
1091071360 11:132567026-132567048 GACTTTTAAAATAAGGATATAGG + Intronic
1091436450 12:477039-477061 CACTGGTAAAATCAGGAGGCTGG - Intronic
1091567348 12:1658885-1658907 AACTTTTAAAATATTGAGGCTGG + Intergenic
1092123313 12:6059201-6059223 TAAATTTTAAATAAGGAGGTGGG - Intronic
1092174354 12:6392850-6392872 TACTTTTCAAAAAAGGAAGTTGG - Intergenic
1093763004 12:22931364-22931386 CATTTTTAAAATGAGGAAGTTGG + Intergenic
1094082073 12:26548062-26548084 CATCTATAAAATAAGGAGCTTGG + Intronic
1094472666 12:30817935-30817957 CACTCTGAAAATGAGGAGTTTGG - Intergenic
1094720902 12:33063104-33063126 GTCTTTTAAAATAATGAGGCTGG - Intergenic
1095402027 12:41825559-41825581 CACTTGTAAAATGAGGCTGTTGG - Intergenic
1095921596 12:47537127-47537149 CACTTGTGAAACAAGGAGTTTGG + Intergenic
1096209092 12:49748755-49748777 CAATTCTAAAATAAAGAGGAGGG - Intronic
1096372038 12:51076839-51076861 CACTCTTAGAATAATGAGATGGG + Intronic
1097333019 12:58352856-58352878 CATGCTGAAAATAAGGAGGTTGG - Intergenic
1097565207 12:61260271-61260293 CATTTTTTATATAAGTAGGTGGG - Intergenic
1098391434 12:69973485-69973507 CATATTAAAAATAAGGAGATTGG - Intergenic
1098458721 12:70707368-70707390 TACTTTTAAAAAAAGGAAGTAGG + Intronic
1099066977 12:77993157-77993179 CGTCTTTAAAATAATGAGGTGGG + Intronic
1101011063 12:100449919-100449941 CACATTTAAAATGAGAAGGCAGG + Intergenic
1101123374 12:101606598-101606620 TACTTTTAAAAGAAGTAGGCTGG - Intronic
1101205710 12:102485040-102485062 TTCTTATAAAATGAGGAGGTTGG - Intergenic
1101279854 12:103241618-103241640 GGCTTTTAAAATAAGAGGGTTGG + Intronic
1101498862 12:105282592-105282614 AAGTTTTAAAATCAGGAAGTGGG - Intronic
1102586243 12:113924964-113924986 CAGTTTTAGAAGAAGGAAGTAGG + Intronic
1102897589 12:116611078-116611100 CACTTTACAAGTAAGGAAGTAGG + Intergenic
1103225765 12:119286137-119286159 CACTTATAAAAGTAGGAGATAGG + Intergenic
1104782733 12:131432351-131432373 CACTTGTAAAATGAGGAAATTGG - Intergenic
1106394081 13:29363487-29363509 CACTCTGAGAAGAAGGAGGTTGG - Intronic
1106440941 13:29769520-29769542 CACTAGTAAAATTAGGAGATGGG + Intronic
1107679398 13:42832700-42832722 CATTTTTAAAATTAGGAAGTGGG + Intergenic
1107995298 13:45853277-45853299 CACTTTTAAAATAACGACACTGG + Intergenic
1108069872 13:46617383-46617405 CTTTTGTAAAATAAGGATGTCGG + Intronic
1108891183 13:55261927-55261949 GACTTTTACAACAAGGAAGTGGG - Intergenic
1109316230 13:60753154-60753176 CAATTTTAAAATGAGTGGGTCGG + Intergenic
1109544238 13:63822601-63822623 CATTTTTAAGATAAGGAAATGGG + Intergenic
1109844690 13:67972090-67972112 TACCTGTAAAATAAGGAAGTGGG - Intergenic
1110531054 13:76598719-76598741 CAGTTTTAAAAGAAAGAGATGGG - Intergenic
1110557519 13:76877092-76877114 CACTCTGAAAAAAAGGAGGGAGG + Intergenic
1111570649 13:90080492-90080514 CACATGTAAAATAAAGAAGTTGG - Intergenic
1111792849 13:92880545-92880567 ATCTTTAAAAATAACGAGGTGGG + Intergenic
1112219515 13:97473812-97473834 CACATTTGAAAGATGGAGGTTGG - Intergenic
1113234672 13:108257139-108257161 GACTTTTAAAATAATGAAGATGG + Intronic
1113712210 13:112474293-112474315 CACTTATAAAATATGAAGGATGG + Intergenic
1114308968 14:21448871-21448893 AACTTTTAAAAGGAGGAGGCTGG + Intronic
1114354138 14:21888878-21888900 CAATTTTTAAAAAAGGAGGGAGG - Intergenic
1114735041 14:25035321-25035343 CACTCAAAAAATAAGGATGTGGG + Intronic
1114939882 14:27595527-27595549 CAATATTAAAATTAGGAAGTTGG - Intergenic
1115361403 14:32507426-32507448 TACATTTAAAATAAGGGTGTTGG + Intronic
1116002042 14:39254233-39254255 CACTTTTAAAGTAGTGAAGTGGG + Intronic
1116696216 14:48181966-48181988 CACTTTTAAAATAACCAGACTGG + Intergenic
1117210283 14:53490449-53490471 CATTTTTAAAATACTAAGGTGGG - Intergenic
1119003280 14:70902465-70902487 GACATTTAAAAAAAGGAGATTGG + Intergenic
1119431133 14:74568646-74568668 CACCATTAAAATTAGGAAGTAGG + Intronic
1120201148 14:81539700-81539722 AAAATTTAAAATGAGGAGGTCGG + Intergenic
1121521596 14:94589802-94589824 CATTTGCAAAACAAGGAGGTTGG - Intronic
1121947787 14:98139238-98139260 CAACTCTAAAATGAGGAGGTTGG + Intergenic
1124125858 15:26937653-26937675 CACTGTTTAAAGCAGGAGGTGGG - Intronic
1124456499 15:29847483-29847505 CACTTTTAAAGTAAGCACTTGGG + Intronic
1124936254 15:34174593-34174615 CACTTCAAAAATAATGATGTAGG + Intronic
1126363957 15:47874149-47874171 CATCTTCAAAATAAGCAGGTTGG - Intergenic
1127164281 15:56228663-56228685 AACTTTTAAAATGAGGCTGTAGG + Intronic
1127231006 15:56995108-56995130 TACTTACAAAATAAGTAGGTAGG + Intronic
1127444601 15:59047869-59047891 CATTTCTAAAATAAGTAGGCTGG - Intronic
1127514842 15:59683227-59683249 TACTTTTAAAATGAGGATATTGG - Intronic
1127753683 15:62069046-62069068 CAATTTTAAAATGAGGTGATTGG - Exonic
1127808556 15:62543280-62543302 CAACTCTAAAACAAGGAGGTTGG + Intronic
1127939101 15:63675521-63675543 TACTTATAAAAACAGGAGGTTGG + Intronic
1128047927 15:64635472-64635494 TATTTGTAAAATGAGGAGGTTGG + Intronic
1128360482 15:66958220-66958242 CCATTTTAAAAGAAGGAGGCTGG - Intergenic
1128502396 15:68236018-68236040 CAGATTTAAAATAACTAGGTAGG + Intronic
1128505291 15:68265897-68265919 TACTTTTAAAGTAAGCGGGTAGG + Intergenic
1129532934 15:76283490-76283512 CACTTTAAAAATAATGAAATGGG - Intronic
1130111434 15:80968633-80968655 TATTTTTAAAGTAAAGAGGTGGG - Intronic
1130151747 15:81316515-81316537 CATTTTTAAAATAAGAATGGTGG - Intronic
1130672401 15:85924182-85924204 AACTTATTAAATCAGGAGGTTGG - Intergenic
1130920639 15:88341380-88341402 AACTGTTAAAATAACAAGGTTGG + Intergenic
1131003302 15:88955365-88955387 CTCATTTAAAATAACGAGGATGG + Intergenic
1131029835 15:89177324-89177346 CACTGTAAAATGAAGGAGGTGGG + Intronic
1131130482 15:89896465-89896487 CAATTTGAAAATAAGTAGTTAGG + Exonic
1133185226 16:4091373-4091395 CACTTTTAAAATGAGGAACTTGG - Intronic
1133197378 16:4180705-4180727 CAATTTTAAAATGAGTGGGTTGG + Intergenic
1134136835 16:11682320-11682342 CTCTTTTAATGTAAGGATGTTGG - Intronic
1134142376 16:11732131-11732153 CATCTGTAAAATAAGAAGGTTGG + Intronic
1134199684 16:12187675-12187697 CACCTTCAAAAAAAGGGGGTTGG - Intronic
1136095185 16:27950522-27950544 CACTTCAGAATTAAGGAGGTGGG + Intronic
1137479382 16:48838941-48838963 CATTTGAAAAATAAGGAGGTTGG + Intergenic
1137660766 16:50204103-50204125 CAGTGTTACCATAAGGAGGTTGG + Intronic
1137964683 16:52918787-52918809 CACTTATAAAATAAAAGGGTTGG - Intergenic
1138321037 16:56111980-56112002 CATTTGTTAAATGAGGAGGTTGG + Intergenic
1138832468 16:60391656-60391678 CATCCCTAAAATAAGGAGGTTGG - Intergenic
1139253304 16:65517598-65517620 CACTTTTAAAATGAAGCAGTTGG - Intergenic
1140150090 16:72354046-72354068 TACCTCTGAAATAAGGAGGTGGG + Intergenic
1140317909 16:73917267-73917289 CACATTTAAAAGAAGGCAGTTGG + Intergenic
1140488178 16:75311113-75311135 GATCTATAAAATAAGGAGGTTGG - Intronic
1141073228 16:80977650-80977672 AACTTCAAATATAAGGAGGTGGG + Intronic
1142327675 16:89427379-89427401 CACTTTTGAAAAAAGGCCGTTGG - Intronic
1142423440 16:89987545-89987567 CACATTTAAAAGAAAGAGGCCGG + Intergenic
1142645213 17:1307290-1307312 CACCATTAAAAGAAGGAGGCCGG + Intergenic
1143900722 17:10172776-10172798 CACTTGAGAAATAAGAAGGTAGG - Intronic
1145115714 17:20209468-20209490 CTTTTTTAAAAATAGGAGGTAGG + Intronic
1145744589 17:27306163-27306185 AACTTTTAAAATAAGGGGATTGG + Intronic
1146372076 17:32271022-32271044 AACTTTTAAAAAACGGAGGTGGG - Intronic
1146960787 17:36975637-36975659 TACTTTTAAAGCAAAGAGGTAGG - Intronic
1146968778 17:37055538-37055560 CACTTTTAAAACAAGACGGCAGG + Intronic
1148286560 17:46398312-46398334 CACTGTTAAAATAATGCTGTAGG + Intergenic
1148308726 17:46615902-46615924 CACTGTTAAAATAATGCTGTAGG + Intronic
1148405052 17:47405137-47405159 GTCTTTTAAAAGAATGAGGTAGG - Intronic
1149039248 17:52168403-52168425 CACATAAAAAATAAGGGGGTTGG - Intergenic
1150558453 17:66274815-66274837 CACTTTAAAAATAATTAGCTGGG - Intergenic
1150628666 17:66860273-66860295 CACTTTACAGATAAGGAGGTTGG - Intronic
1150970623 17:70023262-70023284 CACATGTAAAATAAAGAAGTTGG + Intergenic
1150978494 17:70115769-70115791 CTCATTTAAAACAAGGAGGTGGG - Intronic
1151558247 17:74858109-74858131 TACATTTAGAAAAAGGAGGTTGG - Intronic
1153131982 18:1864862-1864884 CACATGTAAAATAATGAAGTTGG + Intergenic
1154458386 18:14552073-14552095 CACTTTTACATAAAGGAAGTAGG - Intergenic
1155541373 18:26871897-26871919 TGCTTTTAAAATAAGAAGTTAGG + Intergenic
1156990963 18:43406862-43406884 CACCTGTCAAATAAGGAGGCTGG - Intergenic
1157543957 18:48534863-48534885 CACCTGTAAAATGAGAAGGTTGG - Intergenic
1158149620 18:54353366-54353388 CATATTTAAAATGAGGAAGTAGG + Intronic
1158233049 18:55280086-55280108 CACTTTTACAGAGAGGAGGTAGG + Intronic
1159216130 18:65393177-65393199 CACTTTTAAAATAATGTTTTTGG + Intergenic
1159279688 18:66269630-66269652 AACTTTGAAAATAAGAAGATAGG + Intergenic
1160315799 18:77845366-77845388 AAGTTTTAAAATCAGGAAGTTGG + Intergenic
1161635363 19:5385335-5385357 CAGTTATAAAACAAGGCGGTGGG + Intergenic
1161715100 19:5871624-5871646 CAATTTAAAAATAAGGTGGCTGG + Intronic
1166394006 19:42425507-42425529 CATTTCTAAAATGAGGATGTTGG + Intronic
1166453904 19:42924093-42924115 CAATTTTAAAAGAATGGGGTGGG - Intronic
1166787951 19:45380502-45380524 GATTTTTTAAATATGGAGGTGGG - Intronic
925702269 2:6650672-6650694 CATTTTCAAAATAAGGCTGTTGG - Intergenic
926301241 2:11604621-11604643 CAATTATAAAATGAGGTGGTTGG - Intronic
926697935 2:15783809-15783831 CACTGTTATAATGAGGAGGTTGG - Intergenic
926828174 2:16930505-16930527 GACTTTTAAATTAAAGAGATTGG + Intergenic
926988981 2:18656422-18656444 CATTTATAAAATGAGGAGGCAGG + Intergenic
927323915 2:21781045-21781067 CATTTTTATAATCAGAAGGTGGG + Intergenic
927806731 2:26154258-26154280 AAGTTTTAAAATCAGGAAGTAGG - Intergenic
928332566 2:30368830-30368852 CATTGTTAAAATGAAGAGGTTGG + Intergenic
928383156 2:30838626-30838648 CATTTATAATATATGGAGGTAGG - Intergenic
928507220 2:31966126-31966148 CACTTTTTGAATGAGGAGATTGG - Intronic
929833101 2:45365946-45365968 CACTTTTAAAATATTGAAGCAGG - Intergenic
929847977 2:45552622-45552644 CACTTTAAAAATTAGGAATTTGG - Intronic
930537983 2:52667580-52667602 TACTTTCAAAATGAGGAGATAGG + Intergenic
930662905 2:54072863-54072885 CACTTTTAAAAAAGGTAGCTGGG - Intronic
930745691 2:54881356-54881378 AACTTTTAAAAACAGGAGGCCGG + Intronic
930790362 2:55320685-55320707 CACATTTAAAATTATGAGTTAGG - Intronic
930845015 2:55894488-55894510 GACTTTTCAAATAAGCAGGTTGG + Intronic
931995449 2:67835128-67835150 CATCTGTAAAATGAGGAGGTTGG - Intergenic
933866589 2:86523705-86523727 CTCTTTTTAAAGAAAGAGGTGGG - Intronic
934144470 2:89078071-89078093 CATGTTTAAAATAAGGAGGATGG - Intergenic
934224782 2:90122478-90122500 CATGTTTAAAATAAGGAGGATGG + Intergenic
935036990 2:99386839-99386861 CACTATTAAGAAAAGGAGGCTGG - Intronic
935334163 2:101999630-101999652 CACCTCTAAAATACAGAGGTTGG - Intronic
935356164 2:102201856-102201878 CACTGTTAGAATCAGAAGGTGGG + Intronic
935528167 2:104198440-104198462 CTCTTATAAAATAAGGGGGATGG + Intergenic
936626741 2:114156743-114156765 AACTTATAAAATAAGTATGTAGG + Intergenic
937200303 2:120199272-120199294 CACTTGAAAAAGAATGAGGTTGG + Intergenic
938225247 2:129610148-129610170 CACTTTGACAATAAGGATCTTGG + Intergenic
940137307 2:150452475-150452497 CACATGTAAAATAAAGAAGTTGG - Intergenic
940267147 2:151850591-151850613 CATTTGTAAAATGAGGAGATTGG + Intronic
940548555 2:155121441-155121463 CACTTTTAAAATAACAATGTAGG + Intergenic
941781677 2:169452356-169452378 TCCTTTTATATTAAGGAGGTTGG - Intergenic
942005076 2:171690001-171690023 TACTTTTAAAATAATGGGGCTGG - Intronic
942283877 2:174394535-174394557 CATTTATAAAATGAGGAGATGGG + Intronic
943267539 2:185754082-185754104 TACTTTAAATATAGGGAGGTTGG - Intronic
943861362 2:192868011-192868033 AACTTTCAAAATAGGGATGTGGG - Intergenic
945121428 2:206461509-206461531 AATTTTAAAAATAAGGAGGTTGG + Intronic
945142579 2:206702697-206702719 CATTTGTAAAATAAGGTGGGTGG + Intronic
945368392 2:208985248-208985270 TTCTTTTGAAATAAGGAGGTTGG + Intergenic
945718833 2:213392479-213392501 CAGTTTGAAAATATGGAAGTTGG + Intronic
947235662 2:227938210-227938232 CCATTTGGAAATAAGGAGGTTGG + Intergenic
947250195 2:228094213-228094235 CACTTTTAAAATATTCCGGTTGG - Intronic
947620198 2:231585107-231585129 TACTTTAAAAAGCAGGAGGTTGG - Intergenic
948096802 2:235341880-235341902 CATCTGTAAAATGAGGAGGTGGG + Intergenic
948386256 2:237582772-237582794 CACTTTTAGGATGAGGAGATGGG - Intronic
1168982105 20:2013827-2013849 CATTTTTAATATAAGGACATAGG + Intergenic
1169251260 20:4063191-4063213 CTCTTAAAAAAAAAGGAGGTGGG - Intergenic
1169744296 20:8927979-8928001 GACTGAGAAAATAAGGAGGTGGG + Intronic
1169959341 20:11141615-11141637 TTCTTTTAAAATAAGGATGCTGG - Intergenic
1170170707 20:13408251-13408273 CACATGTAAAATAATGAAGTTGG - Intronic
1170803286 20:19608036-19608058 CACTTTTAAAATTGGGAGATGGG - Intronic
1171384042 20:24755304-24755326 CACTTTTAAGAAAAATAGGTGGG + Intergenic
1172298019 20:33827452-33827474 GACTTTTACAATAAGCAGGCAGG - Intronic
1172783527 20:37451241-37451263 CAAGTTTAAAGGAAGGAGGTGGG - Intergenic
1173423632 20:42924709-42924731 CACTTTTCAGATAAGGAAATGGG + Intronic
1173594683 20:44251113-44251135 CACTTTTAAGAAAAGGAAGCAGG - Intronic
1173683198 20:44902090-44902112 CAATTTTAAAAGATGGAGGGAGG - Intronic
1173733614 20:45344806-45344828 CAACTCTAAAATAAGGAGGCTGG - Intronic
1175291069 20:57875691-57875713 CAGTTTTAAAATAACAATGTTGG - Intergenic
1176815764 21:13601263-13601285 CACTTTTACATAAAGGAAGTAGG + Intergenic
1177615594 21:23514348-23514370 CAATTTTAAAATATTGAGTTTGG + Intergenic
1177783886 21:25648992-25649014 CACTGTTAAAAAGAGGAGGAGGG - Intronic
1178095471 21:29210546-29210568 CACATGTAAAATAATGAAGTTGG + Intronic
1179385973 21:40942251-40942273 ATATTTTAAACTAAGGAGGTGGG - Intergenic
1180821464 22:18831709-18831731 CACCTTTAAAATAAGAGGATTGG + Intergenic
1180831250 22:18907346-18907368 AACTTTTAAAATAAGAAGTTTGG - Intronic
1181068600 22:20319026-20319048 AACTTCTAAAATAAGAAGTTTGG + Intronic
1181191514 22:21144336-21144358 CACCTTTAAAATAAGAGGATTGG - Intergenic
1181207684 22:21266174-21266196 CACCTTTAAAATAAGAGGATTGG + Intergenic
1182203696 22:28600568-28600590 GACTCTTAAAATAATGAGATTGG + Intronic
1182808961 22:33099558-33099580 CTAATTTAAAATAAGAAGGTGGG + Intergenic
1203219236 22_KI270731v1_random:29242-29264 CACCTTTAAAATAAGAGGATTGG - Intergenic
1203271589 22_KI270734v1_random:57585-57607 CACCTTTAAAATAAGAGGATTGG + Intergenic
1203281336 22_KI270734v1_random:132617-132639 AACTTTTAAAATAAGAAGTTTGG - Intergenic
949251877 3:1995019-1995041 CATTTATAAAAAAAGGAGCTGGG - Intergenic
949415203 3:3806447-3806469 CTCTTTGAACATAAGGGGGTTGG + Intronic
949650678 3:6155529-6155551 CATTTTTAAAAGAAAGAGATTGG + Intergenic
950315407 3:11997576-11997598 CACATATAAAATGAAGAGGTTGG - Intergenic
950332648 3:12168749-12168771 CACCTGTAAAATGAGCAGGTTGG - Intronic
950729286 3:14942737-14942759 CACAGTTAAAAAAAGGGGGTGGG + Intergenic
951228863 3:20153147-20153169 AACTTTTAAAATAAGCATCTAGG + Exonic
951622731 3:24623996-24624018 TACTTTTTAAATAAGGATCTTGG + Intergenic
952624267 3:35384571-35384593 CAGCTGTAAAATAAGGGGGTTGG + Intergenic
952914587 3:38224115-38224137 CAGTTTTAAAATGAAGAGTTTGG - Intronic
953040000 3:39247937-39247959 CATTTTTAAAATAAAAAGTTGGG + Intergenic
953267698 3:41408690-41408712 AAATTTTAAAATTAGGAAGTAGG - Intronic
953603656 3:44392201-44392223 TACTTTTAAAATAAGTTGCTTGG - Intronic
954056798 3:48033049-48033071 CACTTTTAAAATAAGGAGGTTGG - Intronic
954553563 3:51501653-51501675 CACATTTAAGAGAAGGAGGATGG - Intergenic
955152763 3:56384876-56384898 GACATGTAAAATAATGAGGTTGG - Intronic
955430082 3:58834158-58834180 CTCTTTTAAAGTAAGGAATTCGG - Intronic
955736923 3:62048514-62048536 CTCTTGTAAAATCAGGATGTAGG + Intronic
955803927 3:62714071-62714093 AACTTATAAATTAAGGAGCTGGG + Intronic
956077022 3:65516672-65516694 CACTTTTCAAATGAGGATTTGGG + Intronic
956592042 3:70925282-70925304 CATCTTTAAAATAAGGTTGTTGG - Intergenic
956646352 3:71460985-71461007 CAGTTTTACAATAAAGAGATGGG + Intronic
956887977 3:73579521-73579543 TACTTTTAAAATAAGTTTGTTGG - Intronic
957112739 3:75986742-75986764 CACATATAAAATAATGAAGTTGG - Intronic
957251955 3:77783366-77783388 CACTTTTACACAAAGGAAGTAGG - Intergenic
957288989 3:78252676-78252698 CACTTTGAACATAAGGACATAGG + Intergenic
957518437 3:81286988-81287010 CACTTTAAAAATAAGCACTTTGG - Intergenic
958091043 3:88876516-88876538 CGCTTTAAAACTTAGGAGGTAGG - Intergenic
958118136 3:89249230-89249252 CTCTTATAAAATAATGAGGAAGG - Intronic
959076868 3:101758406-101758428 AACTGATGAAATAAGGAGGTGGG + Exonic
959174579 3:102890220-102890242 CACTTTTTAAATCTGGAAGTTGG + Intergenic
959481061 3:106873190-106873212 CACTTTAAAGATAAAGAGGTCGG - Intergenic
960356954 3:116664973-116664995 CACTTATAAAATAAGAATTTAGG + Intronic
961074932 3:123973490-123973512 CCCTTCTAAAATAAGGAGGTGGG - Intronic
961308749 3:125978997-125979019 CCCTTCTAAAACAAGGAGGTGGG + Intronic
961804362 3:129478286-129478308 CAGTTTTAAAACCATGAGGTGGG - Intronic
962287915 3:134103845-134103867 CACTTTGAAAAGATGGAGCTGGG - Intronic
963712001 3:148756738-148756760 CATCTGTAAAATAAGGGGGTTGG - Intergenic
963816399 3:149836043-149836065 AAATTTTAAAAAATGGAGGTTGG - Intronic
964194771 3:154049925-154049947 CATTTTTGAAATTAGGAGTTTGG - Intergenic
964465968 3:156993422-156993444 CACTTGTAAAATGAGGTGGTGGG - Intronic
964734696 3:159904654-159904676 TACTTTTAAAAAAAGGAAGTAGG - Intergenic
965447552 3:168794276-168794298 CACCTATAAAATAAAGGGGTTGG - Intergenic
965504800 3:169502663-169502685 CACTTTTTAAATATAGAGCTTGG + Intronic
967221216 3:187249655-187249677 CAACTATAAAATAAGGAGTTTGG - Intronic
967327606 3:188257795-188257817 CACTTTGCAAATAAGGAACTGGG + Intronic
967455871 3:189686041-189686063 CTCTTGTAAAATGAGGAGTTTGG + Intronic
967545725 3:190724922-190724944 CATTTTAAAAATAAAAAGGTGGG + Intergenic
967863831 3:194174118-194174140 CATTTGGAAAATAAAGAGGTTGG - Intergenic
967925871 3:194646815-194646837 AATGTTTAAAATAAGGAGGCTGG - Intronic
970912471 4:21293308-21293330 AACTCTTAAATGAAGGAGGTAGG + Intronic
971076976 4:23161203-23161225 CACTTTTGGAATGAGGAGGTTGG - Intergenic
971172795 4:24250572-24250594 CACAATAAAAAGAAGGAGGTGGG + Intergenic
971379316 4:26082379-26082401 CATTTTTAAAATAAGTGAGTTGG + Intergenic
971717448 4:30197625-30197647 AACTTTTCAAAAAAGGAGATAGG + Intergenic
971850224 4:31975962-31975984 CTCTTTTAAAATAAAGAGTAGGG + Intergenic
973655184 4:53039763-53039785 CATTTTACAAATAAGGAAGTTGG + Intronic
975236849 4:72008669-72008691 CATTTTTAGTATGAGGAGGTTGG + Intergenic
975712673 4:77176150-77176172 ATCTTTAAAAATAAGGAAGTAGG - Intronic
976262827 4:83162212-83162234 CATCTATAAAATAAAGAGGTTGG - Intergenic
976288600 4:83394394-83394416 TACTTTTAAAACATGTAGGTAGG - Intergenic
976729898 4:88251208-88251230 GACTTTTAAAATGTGGATGTTGG + Intergenic
977280467 4:95033487-95033509 CACCTGTAAAAGAAGGAAGTTGG - Intronic
978061288 4:104343833-104343855 TCCTTTTAAAAAGAGGAGGTTGG - Intergenic
978190535 4:105906037-105906059 CACAATTAAAATAAGGAAATAGG + Intronic
978681709 4:111388887-111388909 CATCTGTAAAATAAGGAGCTTGG - Intergenic
979418430 4:120473147-120473169 CATTTTTCAAATAATGAAGTTGG - Intergenic
979485059 4:121261858-121261880 CATCTGTAAAATAAAGAGGTTGG - Intergenic
980023212 4:127733638-127733660 ATGTTTTAAAATAAGGAAGTTGG - Intronic
981304555 4:143232744-143232766 AACTTGTAAAATAAGGAAGCTGG + Intergenic
981306293 4:143249891-143249913 TACTTTTAACCAAAGGAGGTTGG - Intergenic
981457377 4:144968905-144968927 CACTGTTACAATACGTAGGTAGG - Intronic
981758157 4:148163596-148163618 TACTTTCAAAAAAAGGAGGGTGG - Intronic
981908644 4:149953042-149953064 CATTTTTAAAAGAAGGAGAGAGG + Intergenic
982858605 4:160418138-160418160 CATTTAAAAAATAAGGAGCTGGG - Intergenic
983282355 4:165696597-165696619 CACTTAGATAACAAGGAGGTTGG + Intergenic
984003428 4:174279791-174279813 CACATTCAAAAGAATGAGGTTGG + Intronic
984683614 4:182640625-182640647 CATGTTTAAAATAAGAAAGTGGG + Intronic
985080352 4:186258715-186258737 CACTTTTATAAGAAAGAGATGGG + Intergenic
985342392 4:188968882-188968904 CACTTGTCAAAGAAGGAGGTTGG + Intergenic
985497835 5:219396-219418 TACTTTGTAATTAAGGAGGTGGG - Intronic
986218045 5:5739469-5739491 CACTTTAAAAATAAAGATTTGGG - Intergenic
986365558 5:7026393-7026415 CACATGCAAAATAATGAGGTTGG + Intergenic
986417345 5:7542451-7542473 CATATTTAAAATGAGGAGTTTGG + Intronic
987588849 5:19896054-19896076 AAATTTTAAAATAAAGAGCTTGG + Intronic
987592171 5:19944035-19944057 CACTTTTAATTTAAAGAGCTAGG + Intronic
988616189 5:32777379-32777401 CACCTGTATAATAAGGAGGTTGG + Intronic
988838621 5:35060536-35060558 TACTTGTTAAATAAGTAGGTTGG - Exonic
990719038 5:58672448-58672470 CACCTGTAAAATGAGGAGATGGG + Intronic
991178782 5:63724056-63724078 TAATTTTAAAATTAGCAGGTAGG + Intergenic
991179886 5:63737805-63737827 CACTTTTTAAACAAGAAAGTTGG - Intergenic
991520418 5:67490950-67490972 CACATTTAAAACAAAAAGGTTGG - Intergenic
992041083 5:72833427-72833449 CATTTTTAAAATAAGAGGATTGG + Intronic
992135171 5:73737208-73737230 CACTTTTGTAAAAAGGAGGAGGG - Intronic
993181065 5:84553133-84553155 CATTTGTAAAATAAAGGGGTTGG + Intergenic
993654530 5:90561308-90561330 CAAATATAAAATAAAGAGGTTGG - Intronic
993686985 5:90949824-90949846 CCATTTTAAAATAAGAGGGTTGG - Intronic
993976173 5:94484354-94484376 CACCTTCAAAATAATGATGTAGG - Intronic
994168021 5:96628504-96628526 GATTCTTAAAACAAGGAGGTTGG - Intronic
994195549 5:96918885-96918907 CGCCCTTAAAAGAAGGAGGTGGG - Exonic
994271925 5:97787803-97787825 TTTTTTTAAAATAAGGAGGAAGG - Intergenic
994674361 5:102802589-102802611 AATATTTAAAATAAGGATGTTGG - Intronic
995339201 5:111038415-111038437 AACTTTAAAAATAAGGAGTATGG + Intergenic
995601789 5:113805327-113805349 CATTTTAAAAATGAGCAGGTTGG + Intergenic
995859214 5:116624101-116624123 CATCTATAAAATAAGGAGGTTGG - Intergenic
996413132 5:123180575-123180597 CATCATTAAAATAAAGAGGTAGG + Intronic
996581169 5:125033982-125034004 CATTGAGAAAATAAGGAGGTAGG - Intergenic
996845540 5:127895150-127895172 CACTGTTAGAAGAAGGTGGTGGG - Intergenic
997368475 5:133340807-133340829 CACTAATAAAATGAGGATGTGGG + Intronic
997549037 5:134736556-134736578 CACCCTCAAAATAAGGAAGTGGG - Intergenic
997697172 5:135870800-135870822 CTCTTTTAACATAAGGAAATGGG + Intronic
997880591 5:137586043-137586065 CATTTTTAAATTGAGCAGGTTGG - Intronic
997922044 5:137990656-137990678 CAAGTTTAAAATAAGGAGCCAGG + Intronic
998412287 5:141920629-141920651 CAATTTTAAAACATGGATGTGGG - Intergenic
998832299 5:146172825-146172847 TCCTTTTACAATAAGGAAGTGGG + Intronic
999084206 5:148872764-148872786 CATTTATAAAATGAGGGGGTTGG + Intergenic
999411548 5:151354548-151354570 CATCTATAAAATGAGGAGGTTGG - Intergenic
999569227 5:152899652-152899674 CACTTTAAAAATTAGGAAGCAGG - Intergenic
999596494 5:153210953-153210975 TATTTATAAATTAAGGAGGTTGG + Intergenic
1000260616 5:159585077-159585099 CATTTGTAAAATGAGGAGTTTGG - Intergenic
1000421640 5:161044814-161044836 CACTTATAAAATGAGGATGGGGG - Intergenic
1002625881 5:180528912-180528934 CACTTTTAAAAGATGTGGGTCGG + Intronic
1002922602 6:1583260-1583282 GACTTTTAAATAAAGGAGGCCGG + Intergenic
1003034440 6:2630956-2630978 CACTTCAAAAAGAAGGGGGTAGG + Intronic
1003328424 6:5110019-5110041 CACTTTAAAAAGAAGGGGGCAGG - Intronic
1003375879 6:5577112-5577134 TACTTTTAAAATAATGGTGTGGG + Intronic
1003663912 6:8091364-8091386 CACTTTTGAAATCAGGATATTGG + Intronic
1003783946 6:9461740-9461762 TACTTTTAAAGTAAGTAGTTAGG - Intergenic
1004361823 6:14978028-14978050 CACTATAAGAATAATGAGGTTGG - Intergenic
1005093819 6:22088695-22088717 CACTGATAAAATGAGGAGGTTGG - Intergenic
1005525757 6:26646341-26646363 CAGGCTAAAAATAAGGAGGTGGG + Intronic
1005791327 6:29304572-29304594 CACTTATCAAATAAGAAGGAAGG - Intergenic
1005884922 6:30090096-30090118 CAATTTTAAAATGAGGAGTTTGG - Intergenic
1006916363 6:37596528-37596550 CAGGTTTAAAAGAAGAAGGTGGG + Intergenic
1007192058 6:40027790-40027812 CCATTTTAAAATAAGGAAATAGG - Intergenic
1007267045 6:40604399-40604421 CACCTTTACGATAAGGAGGGGGG - Intergenic
1008007995 6:46432784-46432806 CAATTTAATAATAAGAAGGTGGG + Intronic
1008394615 6:50992294-50992316 CATTTTTAAAAAGAAGAGGTGGG - Intergenic
1010756620 6:79672743-79672765 TACTCTTAAATTAAGAAGGTAGG + Intronic
1011424831 6:87214909-87214931 CACTTTTAAAAACTGGAGGGAGG - Intronic
1011665064 6:89625412-89625434 AACTTTTAAAATAAAAAGTTGGG - Intronic
1011720719 6:90154050-90154072 CTCTTTTAAAATAGGGACTTTGG + Intronic
1013455009 6:110322698-110322720 CTCTTTTGAAAGAAGGAGGTGGG - Intronic
1014248110 6:119088968-119088990 CATTTGTAAAATGAGGAGATTGG + Intronic
1015070444 6:129087643-129087665 CACTTTAAAGATAAGGATGATGG + Intronic
1015083161 6:129253032-129253054 CTCTTTTAAAAAAAGGGGGCGGG - Intronic
1015236133 6:130973428-130973450 CACATTTAACATAAAAAGGTGGG - Intronic
1016568241 6:145483190-145483212 TACTTTTAACTTTAGGAGGTAGG - Intergenic
1016819973 6:148338119-148338141 GACTTTTAAAATAATCAGTTTGG + Intronic
1017298088 6:152822479-152822501 AATTTTAAAAATAAGGAGCTGGG + Intergenic
1018625717 6:165777001-165777023 CACTTTAAAACTGAGGAGGAGGG + Intronic
1020966035 7:14869969-14869991 AAATTTTAAAATAGAGAGGTTGG - Intronic
1021465242 7:20935561-20935583 CACTTTGAAAACATGAAGGTAGG - Intergenic
1022148029 7:27567365-27567387 CACTTTAAATATAATGATGTAGG - Intronic
1022247854 7:28577709-28577731 CACCTTTAAAATTGGGGGGTGGG + Intronic
1022849894 7:34249513-34249535 CACTTGTAGAATAAGTAGTTGGG + Intergenic
1023089460 7:36604170-36604192 CACTGTTAATATGAAGAGGTGGG - Intronic
1023672770 7:42596602-42596624 TACTTTTATAAGAAGGAGCTAGG + Intergenic
1023788469 7:43732088-43732110 TACTTTTAAACTAAGGAGCCAGG + Intergenic
1023964011 7:44952346-44952368 TACTTTAAAAATAAATAGGTCGG + Intergenic
1024014723 7:45302543-45302565 CACATGCAAAATAAGGAAGTGGG + Intergenic
1024372142 7:48597763-48597785 CATTTTTAAAAAATGGAGGATGG - Intronic
1024885727 7:54139982-54140004 CATATTTAAAATATGGATGTTGG + Intergenic
1025153425 7:56579895-56579917 CACTTTAAAAATATGCATGTTGG + Intergenic
1027298368 7:76802493-76802515 CACTCTGAAAATAAAGAGGTAGG - Intergenic
1027681798 7:81231962-81231984 CTTGTTTAAAAAAAGGAGGTAGG + Intergenic
1028550764 7:92061894-92061916 CATTTTGAAAATTAGAAGGTTGG - Intronic
1028803632 7:94998173-94998195 CATTTTTTAAAAAAGGAGGGAGG - Intronic
1029456805 7:100675793-100675815 CCCTTTTAAAATTAGGTGCTTGG + Intronic
1030772432 7:113490875-113490897 TACATTTAAAACAAGGAAGTGGG + Intergenic
1030854586 7:114538630-114538652 CATCTTTAAAATAAAGATGTTGG + Intronic
1031212928 7:118854591-118854613 CACTTTGAAAATAAAGCTGTCGG + Intergenic
1031438034 7:121756963-121756985 CACTTTAAAAACAAGGAAATGGG + Intergenic
1031958825 7:127970387-127970409 CTCTGTAAAAATAAGGAGTTTGG + Intronic
1032156313 7:129471685-129471707 CATCTTTGAAATAAGGGGGTTGG - Intronic
1032480579 7:132243558-132243580 CATGTTTAAAATCAGGAGGAGGG - Intronic
1032627705 7:133610469-133610491 CAGTATTAAAATAAACAGGTTGG - Intronic
1032716405 7:134512641-134512663 CACTTTGAAAAAAAGGAAATTGG - Intergenic
1033149393 7:138900027-138900049 CACATGTAAAATAAGGAGCTCGG - Intronic
1033433313 7:141308724-141308746 CATCTTTAAAACAAGAAGGTTGG - Intronic
1033665322 7:143435735-143435757 CACTTTAAAAATGACAAGGTGGG + Intergenic
1034083016 7:148298184-148298206 CCCTTCTAAAATAGGCAGGTTGG - Intronic
1037348163 8:17922430-17922452 CATATGTAAAATCAGGAGGTTGG + Intergenic
1037437908 8:18883228-18883250 CTCTTTTAAAATAAAAAAGTAGG - Intronic
1038851904 8:31287125-31287147 CATTTATAAAATAAGCAGCTTGG + Intergenic
1040563424 8:48545134-48545156 CACCTATAAAACAAGGAGCTTGG + Intergenic
1042438829 8:68800714-68800736 CACTTGTAAAATTAAGAGGTTGG - Intronic
1043156068 8:76781235-76781257 CACTTTTAAAATAAAGTTGGAGG - Intronic
1043240480 8:77927602-77927624 GACTTGTAAGATGAGGAGGTTGG - Intergenic
1043589125 8:81807627-81807649 AACTTTTAAATAAATGAGGTTGG + Intronic
1043919131 8:85961206-85961228 CATTTTTAAAATAGCAAGGTAGG + Intergenic
1044440028 8:92212631-92212653 TATCTTTAAAATAAAGAGGTGGG - Intergenic
1046042603 8:108924145-108924167 CAGTTTTGAAAAAAAGAGGTTGG + Intergenic
1046274174 8:111935547-111935569 CACCTGTAAAATCAGGAGGTAGG - Intergenic
1046823176 8:118657849-118657871 TACTTTTAATATAATGAGCTTGG + Intergenic
1046978424 8:120310202-120310224 GGCTTTTAAAATAAGGAAGAAGG - Intronic
1047477813 8:125251750-125251772 CACTTTTTAAATAAAGAAGCAGG + Intronic
1047513071 8:125530102-125530124 CACTTATAAAATGAGGGGGTTGG + Intergenic
1047670532 8:127141569-127141591 CACCTGTAAAGTAAGGAGATTGG + Intergenic
1048496673 8:134941425-134941447 CAAGTGTAAAATAAGGAGTTAGG + Intergenic
1048933668 8:139337744-139337766 CACTTTAAAAATAAGGACCGTGG + Intergenic
1049875089 8:145012243-145012265 CTCCTTTAAAACAAGGAGTTGGG + Intergenic
1049925257 9:401189-401211 CAGTTTTAAAATAAGAAGGGGGG + Intronic
1050136855 9:2474579-2474601 CACATTCAAAATAAAGAGGATGG + Intergenic
1050247570 9:3707076-3707098 CACTTTGAAAAGCAAGAGGTTGG + Intergenic
1050290648 9:4150743-4150765 AATTTATAAAATAAGGAGGTTGG - Intronic
1050611021 9:7353904-7353926 AACATTTAAAATAAGCATGTAGG + Intergenic
1050685369 9:8162695-8162717 CACTTTTCAAATAATGGTGTTGG - Intergenic
1050747264 9:8891029-8891051 CACTTTAAAAATAAGGATCAAGG + Intronic
1051898873 9:22017124-22017146 GGCATTTAAAATAAGGAAGTTGG + Intronic
1051984881 9:23072251-23072273 CATTTTTAAAATAAGATGGAAGG + Intergenic
1052320656 9:27164032-27164054 CAAATTTAAAATGAGGTGGTTGG + Intronic
1052525827 9:29618443-29618465 TGCTTTCAAAATAAGAAGGTGGG + Intergenic
1054828808 9:69600500-69600522 CGTTTTTAAAATAGGGATGTTGG + Intronic
1055107122 9:72524795-72524817 CACCTGTAAAATCAAGAGGTTGG - Intronic
1055110467 9:72554709-72554731 CATCTGTAAAATAAGGGGGTTGG + Intronic
1055124492 9:72703421-72703443 CACTTTTAAAAGATTGAGGCTGG - Intronic
1055872913 9:80905914-80905936 CACTTTAAATATAAAGATGTAGG - Intergenic
1056024012 9:82473382-82473404 CACATATAAAATAATGAAGTTGG + Intergenic
1056286164 9:85089902-85089924 CATGTGTAAAATCAGGAGGTTGG + Intergenic
1057306313 9:93914190-93914212 CACCTGTAGAACAAGGAGGTTGG - Intergenic
1057361997 9:94381833-94381855 TACTTTTAAAATAATTAGTTTGG - Intronic
1057661359 9:97006331-97006353 TACTTTTAAAATAATTAGTTTGG + Intronic
1057865686 9:98678687-98678709 CACTCTGAAAATTTGGAGGTGGG - Intronic
1058031898 9:100209360-100209382 CACATGAAAAATAAGGAGGGTGG - Intronic
1058376186 9:104324707-104324729 CTCTTTTAAACTAAGGAAGAAGG + Intergenic
1059175257 9:112164382-112164404 CACCTTTAAAACAAGGACTTTGG + Intronic
1059371355 9:113841441-113841463 CATTTTTAAAAAAAGAAAGTTGG + Intergenic
1059526722 9:114998591-114998613 CCATTTTAAAAAAAGGATGTTGG - Intergenic
1059535613 9:115077571-115077593 AACTTTTAAAATAATGCCGTAGG + Intronic
1059611400 9:115901016-115901038 CACTTATAAAATTAGGATCTTGG - Intergenic
1060019234 9:120114815-120114837 CATCTGTAAAATAAGGAAGTGGG + Intergenic
1060174984 9:121491178-121491200 CACTTTCAAAATTAGGAGTGGGG - Intergenic
1060618457 9:125040928-125040950 CATTTTTAAAACAGGGAGGCCGG - Intronic
1061411110 9:130422252-130422274 CACCTGTAAAATGAGGAGGCGGG - Intronic
1061944981 9:133903527-133903549 CACTTAGAAAATATGGGGGTGGG + Intronic
1203531593 Un_GL000213v1:148198-148220 CACTTTTACATAAAGGAAGTAGG - Intergenic
1185666506 X:1769535-1769557 CACTTATAAAATCATGAGATCGG + Intergenic
1186389147 X:9141168-9141190 CACTTTGAAAAGAGGGAGGAAGG + Intronic
1187241698 X:17519846-17519868 TTCATTTAAAATAAGGATGTAGG + Intronic
1187484587 X:19690410-19690432 AACTTTTTAAATAAGGAATTAGG + Intronic
1187839299 X:23470352-23470374 CACTTTTTAACAAAGCAGGTAGG + Intergenic
1188790931 X:34407569-34407591 CAACATTAAAATATGGAGGTGGG + Intergenic
1188935340 X:36168725-36168747 CTCATTTAAAATAAGCAGGAGGG - Intergenic
1190096906 X:47488766-47488788 CACATTTAAAATAAAGAGACTGG - Intergenic
1190514497 X:51208784-51208806 CACTATTAAAATAAGTAGATTGG + Intergenic
1190830679 X:54056566-54056588 AAATTTAAAATTAAGGAGGTTGG - Intergenic
1190949919 X:55133416-55133438 CAGTTTTGAAATTAGGAGGAAGG + Intronic
1191199774 X:57767694-57767716 CATTTTTAGACTGAGGAGGTGGG + Intergenic
1191682449 X:63855173-63855195 AACTCTTTAAATAAGGAGTTGGG + Intergenic
1192142556 X:68658411-68658433 CACCTATAAAATGAGGAGGCTGG + Intronic
1192823676 X:74671489-74671511 CCCTTTTAAAATAAGTACTTGGG + Intergenic
1192831277 X:74753295-74753317 CACTTGTAAAATGGGGAGTTTGG - Intronic
1193238566 X:79138998-79139020 CACCTGTAAAATGAGGAAGTTGG + Intergenic
1193679337 X:84499211-84499233 TACTTGTAAAATAAGGGGATTGG + Intronic
1195175731 X:102313658-102313680 TAGTTTTAAAATAAGAAAGTAGG - Intronic
1195183133 X:102373435-102373457 TAGTTTTAAAATAAGAAAGTAGG + Intronic
1195525647 X:105886889-105886911 CACATGCAAAATAATGAGGTTGG + Intronic
1195645953 X:107230753-107230775 TACTTTTAAGATAAGGAGTTTGG - Intronic
1195866907 X:109442388-109442410 TAATTATAAAATAAGGATGTTGG - Intronic
1196646902 X:118127638-118127660 CACTTGCAAGATAAAGAGGTTGG - Intergenic
1196714348 X:118797186-118797208 CATCTGTAAAATGAGGAGGTTGG + Intergenic
1197370833 X:125623848-125623870 CATTTTTGAAATTAGGATGTTGG + Intergenic
1197632753 X:128881042-128881064 ATCTATCAAAATAAGGAGGTTGG + Intergenic
1198294805 X:135276189-135276211 TAATTTCAAAATAAGGAAGTGGG - Intronic
1198820528 X:140643258-140643280 CTCTTGTAAAATGAGAAGGTTGG - Intergenic
1199053340 X:143263192-143263214 AATTTTTAAAATAAGGAAATAGG - Intergenic
1199689252 X:150295369-150295391 TGTTTTTAAAATAAGGAGTTGGG + Intergenic
1200768926 Y:7105786-7105808 CACTGCTAACATGAGGAGGTGGG + Intergenic
1201334527 Y:12865896-12865918 TGCATTTAAAATAATGAGGTTGG + Intergenic
1202266416 Y:23023301-23023323 TTCTTTTAAAATAAAAAGGTAGG - Intergenic
1202419409 Y:24657044-24657066 TTCTTTTAAAATAAAAAGGTAGG - Intergenic
1202451377 Y:25013040-25013062 TTCTTTTAAAATAAAAAGGTAGG + Intergenic