ID: 954062987

View in Genome Browser
Species Human (GRCh38)
Location 3:48084485-48084507
Sequence CTGCATTTAAAGACTGGCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 566
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 540}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954062982_954062987 19 Left 954062982 3:48084443-48084465 CCTTAAAATGTTAATGACATCCA 0: 1
1: 0
2: 2
3: 39
4: 288
Right 954062987 3:48084485-48084507 CTGCATTTAAAGACTGGCCTAGG 0: 1
1: 0
2: 3
3: 22
4: 540
954062984_954062987 -1 Left 954062984 3:48084463-48084485 CCAAAATAGTTCACCATAAGGTC 0: 1
1: 0
2: 0
3: 5
4: 101
Right 954062987 3:48084485-48084507 CTGCATTTAAAGACTGGCCTAGG 0: 1
1: 0
2: 3
3: 22
4: 540

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954062987 Original CRISPR CTGCATTTAAAGACTGGCCT AGG Intronic
900863235 1:5247800-5247822 CAGGATTTCAAGACTAGCCTAGG + Intergenic
900946896 1:5836009-5836031 CAGAATTTCAAGACTAGCCTGGG - Intergenic
901254149 1:7806577-7806599 CAGGAGTTCAAGACTGGCCTGGG + Intronic
902224868 1:14990430-14990452 CAGGAGTTAAAGACTAGCCTGGG - Intronic
902325788 1:15699749-15699771 CAGGAGTTCAAGACTGGCCTGGG + Intronic
902456758 1:16539010-16539032 CTGCATGTGAAGCCAGGCCTTGG + Intergenic
902474269 1:16672947-16672969 CTGCATGTGAAGCCAGGCCTTGG + Intergenic
902484534 1:16734495-16734517 CTGCATGTGAAGCCAGGCCTTGG - Intergenic
902495411 1:16868902-16868924 CTGCATGTGAAGCCAGGCCTTGG - Intronic
902590903 1:17473793-17473815 CAGGAGTTCAAGACTGGCCTGGG - Intergenic
903805588 1:26003297-26003319 CTGGAGTTTGAGACTGGCCTGGG + Intergenic
904101151 1:28028927-28028949 CAGGAGTTCAAGACTGGCCTGGG - Intronic
904141900 1:28360311-28360333 CAGGAGTTCAAGACTGGCCTGGG - Intergenic
904821495 1:33247692-33247714 CTCCCTTTCAAGACTGGCCCGGG - Intergenic
905072351 1:35238105-35238127 CTGCAGTTTCAGACTAGCCTGGG + Intergenic
905357399 1:37394340-37394362 CTGGATTTAAATCCTGGCTTTGG + Intergenic
905507958 1:38495031-38495053 CAGCATTTAAAGGCTAGGCTAGG + Intergenic
905632930 1:39528929-39528951 CAGGAGTTCAAGACTGGCCTGGG - Intergenic
905813089 1:40927276-40927298 CAGGAGTTCAAGACTGGCCTAGG + Intergenic
905818079 1:40967522-40967544 CTGGAATTCAAGACTAGCCTGGG - Intergenic
907283595 1:53366711-53366733 CAGGAGTTCAAGACTGGCCTGGG - Intergenic
907362193 1:53926931-53926953 CAGGAGTTCAAGACTGGCCTAGG - Intronic
907593667 1:55700134-55700156 GTGCACGTAAAGACTGGCATAGG + Intergenic
908306354 1:62822944-62822966 CAGCAGTTCAAGACTAGCCTGGG + Intronic
908509510 1:64840275-64840297 CTGCATACAGAAACTGGCCTCGG + Intronic
909404153 1:75267777-75267799 CAGAAGTTCAAGACTGGCCTGGG - Intronic
909644842 1:77905480-77905502 CAGAAGTTAAAGACTAGCCTGGG + Intronic
910306133 1:85766155-85766177 CAGGAGTTCAAGACTGGCCTGGG + Intronic
910911467 1:92238965-92238987 CAGGAGTTCAAGACTGGCCTGGG - Intronic
911206278 1:95094341-95094363 CAGAAGTTAAAGACCGGCCTGGG - Intergenic
911590472 1:99742061-99742083 CAGGATTTTGAGACTGGCCTGGG - Intronic
912304257 1:108549264-108549286 CTGCTTTTAAATGCTGGGCTGGG - Intergenic
912351560 1:109018859-109018881 CAGCAGTTCAAGACTAGCCTGGG + Intronic
913662001 1:121012653-121012675 CTGCATGTGAAGCCAGGCCTTGG + Intergenic
914013375 1:143795838-143795860 CTGCATGTGAAGCCAGGCCTTGG + Intergenic
914164450 1:145165347-145165369 CTGCATGTGAAGCCAGGCCTTGG - Intergenic
914651999 1:149704447-149704469 CTGCATGTGAAGCCAGGCCTTGG + Exonic
915209781 1:154299802-154299824 CTGGTTTTAAAAACTGGTCTAGG + Intergenic
915683559 1:157606621-157606643 CTGCATGAAAACACTGGCCAGGG - Intergenic
915901472 1:159849622-159849644 CTGCATTTAACAACTGGCTTGGG - Intronic
915957807 1:160237746-160237768 CAGCAGTTAAAGACCAGCCTGGG - Intronic
916011922 1:160714046-160714068 CAGGAGTTCAAGACTGGCCTGGG - Intergenic
916341814 1:163745133-163745155 CAGCATTTACAGACTGGCCCTGG - Intergenic
916646613 1:166792971-166792993 CAGGAGTTCAAGACTGGCCTGGG - Intergenic
916699567 1:167277520-167277542 CAGGAGTTCAAGACTGGCCTAGG - Intronic
916753146 1:167741822-167741844 CAGCAGTTCAAGACCGGCCTGGG + Intronic
917135187 1:171782360-171782382 CTGGAGTTAAAGACCAGCCTGGG + Intronic
918059758 1:181050781-181050803 CAGGAGTTTAAGACTGGCCTGGG + Intronic
919441146 1:197634778-197634800 CAGGAGTTCAAGACTGGCCTGGG + Intronic
920208719 1:204312936-204312958 CAGGAGTTCAAGACTGGCCTGGG - Intronic
920208766 1:204313125-204313147 CAGGAGTTCAAGACTGGCCTGGG - Intronic
920947414 1:210542587-210542609 CAGGAGTTGAAGACTGGCCTGGG + Intronic
921059091 1:211567479-211567501 CTGAAGTTTGAGACTGGCCTGGG - Intergenic
921855942 1:219984629-219984651 CAGGAGTTCAAGACTGGCCTGGG - Intronic
922148524 1:222975231-222975253 CAGGAGTTCAAGACTGGCCTGGG - Intronic
922921916 1:229312574-229312596 CAGGAATTCAAGACTGGCCTGGG - Intergenic
923551992 1:234971323-234971345 CTGCTTTTAAAGAGCTGCCTGGG - Intergenic
923613507 1:235516917-235516939 CTGCATTCAGAGACTGTTCTTGG + Intergenic
923811951 1:237328449-237328471 CTGCATTTAAAGTCTGCAGTTGG - Intronic
923986942 1:239392055-239392077 CTGGATTTAATGTCTGGCCTGGG + Intronic
1063144332 10:3283246-3283268 ATGGATGTAAAGATTGGCCTGGG + Intergenic
1063361489 10:5463033-5463055 CAGCATTTAGAGCATGGCCTGGG - Intergenic
1064204189 10:13309217-13309239 CAGGATTTCAAGACTAGCCTGGG + Intergenic
1064338408 10:14464809-14464831 CAGGAGTTCAAGACTGGCCTGGG - Intergenic
1064663296 10:17627811-17627833 CAGGAATTCAAGACTGGCCTGGG - Intergenic
1065056276 10:21845731-21845753 CTGCATTAAAACAATTGCCTTGG - Intronic
1065089992 10:22222039-22222061 CAGGAGTTCAAGACTGGCCTGGG - Intergenic
1065117953 10:22500135-22500157 CAGGAGTTCAAGACTGGCCTGGG + Intergenic
1065626194 10:27631345-27631367 CAGGAGTTCAAGACTGGCCTGGG + Intergenic
1065828595 10:29594763-29594785 CAGGAGTTCAAGACTGGCCTAGG - Intronic
1065951268 10:30653794-30653816 CAGGAGTTCAAGACTGGCCTGGG - Intergenic
1067184018 10:44011900-44011922 CAGCATTTAAACATTGGCCAGGG - Intergenic
1068912988 10:62398686-62398708 CTGCATTTGAGGACTGGATTTGG - Intronic
1069008365 10:63343827-63343849 CAGCAGTTCAAGACCGGCCTGGG + Intronic
1069042892 10:63712912-63712934 CTGGATTTCAAAACTGGCTTTGG + Intergenic
1069969304 10:72152235-72152257 CAGGAGTTCAAGACTGGCCTGGG - Intronic
1070030561 10:72672982-72673004 CAGGAGTTAGAGACTGGCCTGGG - Intergenic
1070548271 10:77469903-77469925 CTGCAGTTGAAGACTGACCGAGG - Intronic
1071575265 10:86721016-86721038 CTGGATTTCAAGACCAGCCTGGG - Intronic
1071964335 10:90836716-90836738 CAGGAGTTCAAGACTGGCCTGGG - Intronic
1072343630 10:94480641-94480663 CTGCAGTTCAAGACCAGCCTGGG + Intronic
1073562843 10:104511486-104511508 CAGGATTGAAAGAATGGCCTGGG + Intergenic
1073672254 10:105605282-105605304 GTGCATGTAGTGACTGGCCTGGG + Intergenic
1074155620 10:110796533-110796555 CAGGATTTCAAGACTAGCCTGGG + Intronic
1074557300 10:114503240-114503262 CAGAAGTTCAAGACTGGCCTGGG + Intronic
1074913304 10:117931966-117931988 CTTAATTTAATTACTGGCCTGGG - Intergenic
1076825961 10:132968369-132968391 CTGCCTTCAAACACTGGCCTCGG + Intergenic
1078625963 11:12958415-12958437 CAGGAGTTCAAGACTGGCCTGGG - Intergenic
1078767818 11:14316529-14316551 CAGGAGTTCAAGACTGGCCTAGG + Intronic
1079011249 11:16830190-16830212 CAGGATTTCAAGACTAGCCTGGG - Intronic
1079086339 11:17448156-17448178 CAGGAGTTCAAGACTGGCCTGGG - Intronic
1079414248 11:20218298-20218320 CTGCAGTTAAAGGCTGGCCAAGG - Intergenic
1080355592 11:31440912-31440934 CTGCATCTCAAGACTGGCAATGG + Intronic
1081372148 11:42317065-42317087 CAGAAGTTCAAGACTGGCCTGGG + Intergenic
1083391925 11:62358066-62358088 CTGTTTTAAAAGATTGGCCTTGG + Intronic
1083443878 11:62694411-62694433 CAGGAGTTCAAGACTGGCCTGGG - Intronic
1083570327 11:63757565-63757587 CAGAAGTTAAAGCCTGGCCTGGG - Intronic
1083786480 11:64951554-64951576 CGGGAGTTCAAGACTGGCCTGGG + Intronic
1083801596 11:65049227-65049249 CAGGAGTTCAAGACTGGCCTGGG - Intronic
1084299795 11:68240815-68240837 CAGAAGTTCAAGACTGGCCTGGG - Intergenic
1084975029 11:72792402-72792424 CTGCCTTTCATGACTTGCCTGGG + Intronic
1085089328 11:73696810-73696832 CTGGAGTTCAAGACTAGCCTGGG - Intronic
1085233841 11:74995943-74995965 CAGGAGTTCAAGACTGGCCTGGG + Intronic
1085983939 11:81761732-81761754 CTGCATTCAAATTCTAGCCTAGG - Intergenic
1085987408 11:81803622-81803644 CTGAAATCAAAGACTGGCTTAGG - Intergenic
1088330998 11:108651664-108651686 CAGGATTTCAAGACTAGCCTGGG + Intergenic
1088586938 11:111367661-111367683 CTCCAGTTAAAGTCTGGGCTTGG + Intronic
1088667662 11:112109764-112109786 CTGCATTAAAAGACAAGCTTTGG - Intronic
1090288488 11:125520936-125520958 CAGGAGTTTAAGACTGGCCTGGG - Intergenic
1090837276 11:130462605-130462627 CTGCATGTAAGGACAGGGCTTGG - Exonic
1091163735 11:133451541-133451563 CTGTATTTAAAGATTGGTTTAGG + Intronic
1091181983 11:133613583-133613605 CAGGAGTTCAAGACTGGCCTGGG - Intergenic
1092089845 12:5795360-5795382 CTGCACTTAAAGTCAGGCCCTGG - Intronic
1092661079 12:10739199-10739221 CAGAAGTTAAAGACTAGCCTGGG - Intergenic
1094014296 12:25846145-25846167 CTGGAGTTCAAGACTAGCCTGGG - Intergenic
1094140992 12:27182125-27182147 CAGAATTTCAAGACCGGCCTGGG - Intergenic
1094215788 12:27940559-27940581 CAGGAGTTCAAGACTGGCCTGGG - Intergenic
1094375789 12:29785818-29785840 CAGGAGTTCAAGACTGGCCTGGG + Intergenic
1094443909 12:30508975-30508997 CTGCCTTTGAACACAGGCCTTGG + Intergenic
1095450685 12:42327389-42327411 CTGCATTTAAAGGTTGGGCATGG + Intronic
1095692970 12:45111357-45111379 CAGGAGTTCAAGACTGGCCTGGG + Intergenic
1095967214 12:47877043-47877065 CTGCATTTATAATCTGGCATTGG - Intronic
1096174163 12:49501166-49501188 CAGTAGTTCAAGACTGGCCTGGG - Intronic
1096434446 12:51576800-51576822 CAGGAGTTCAAGACTGGCCTGGG + Intergenic
1096872521 12:54602380-54602402 GTGAAGTCAAAGACTGGCCTTGG + Intergenic
1097413772 12:59288690-59288712 CAGGAGTTCAAGACTGGCCTGGG - Intergenic
1097451916 12:59747038-59747060 CAGGATTTAGAGACTAGCCTAGG - Intronic
1097686076 12:62692050-62692072 ATGCTTTTAAAGACTGGTGTGGG - Intronic
1098345232 12:69495677-69495699 CAGGAGTTTAAGACTGGCCTGGG + Intronic
1098689968 12:73474506-73474528 CTGGATGTAAAGATTGGCTTGGG + Intergenic
1099155635 12:79172450-79172472 GTCTATTTAAAGACAGGCCTTGG + Intronic
1099341124 12:81436067-81436089 CTGGAGTTAAAGACCAGCCTGGG + Intronic
1099441276 12:82702716-82702738 CAGCAGTTTGAGACTGGCCTGGG + Intronic
1099951778 12:89311880-89311902 CTGTATTTAAGGGCTGGGCTTGG - Intergenic
1100026002 12:90128793-90128815 AAGCCTTTAAAGACTGGCTTAGG + Intergenic
1100255748 12:92881193-92881215 CAGGAATTCAAGACTGGCCTGGG + Intronic
1101145964 12:101840701-101840723 CAGGAGTTTAAGACTGGCCTGGG + Intergenic
1101895998 12:108757326-108757348 CTGGAGTTCAAGACTTGCCTGGG + Intergenic
1102105969 12:110323599-110323621 CAGGAGTTAAAGACGGGCCTGGG + Intronic
1102131446 12:110532495-110532517 CAGCAGTTCAAGACTAGCCTGGG + Intergenic
1102364920 12:112324326-112324348 CTGGAGTTCAAGACTAGCCTGGG - Intronic
1102582311 12:113897601-113897623 CAGGAGTTCAAGACTGGCCTGGG + Intronic
1103057541 12:117833569-117833591 CTGAAGTTCAAGACTAGCCTGGG - Intronic
1103084092 12:118048377-118048399 CAGGAGTCAAAGACTGGCCTGGG + Intronic
1103857133 12:123979890-123979912 CAGGAGTTCAAGACTGGCCTGGG - Intronic
1104193285 12:126504691-126504713 CTGCATACAAAGACTTGGCTGGG - Intergenic
1104539928 12:129654705-129654727 CAGCATTTATCCACTGGCCTTGG - Intronic
1104952462 12:132447699-132447721 CTGGCTTAAAAGACTGTCCTGGG - Intergenic
1105342914 13:19544685-19544707 CAGCAGTTCAAGACTAGCCTGGG + Intergenic
1105467478 13:20659502-20659524 CTGCAAATAAAGATTGGCTTAGG - Intronic
1105811967 13:24003148-24003170 CTGCATTTATAGACCAGCGTGGG - Intronic
1107121392 13:36800164-36800186 CAGGAGTTCAAGACTGGCCTGGG + Intergenic
1107304157 13:39000247-39000269 CAGGATTTCAAGACTAGCCTGGG + Intergenic
1108023841 13:46157933-46157955 CAGGAGTTAAAGACTAGCCTGGG - Intronic
1109695073 13:65944704-65944726 CAGGATTTCAAGACTGGCCTGGG + Intergenic
1109833907 13:67829777-67829799 CAGGAATTCAAGACTGGCCTGGG - Intergenic
1110045840 13:70829362-70829384 CAGTATTTCAAGACTAGCCTTGG + Intergenic
1110341565 13:74397823-74397845 CTGGTGTTAAAGACTAGCCTGGG - Intergenic
1111591709 13:90355704-90355726 CAGCAGTTCAAGACTAGCCTGGG + Intergenic
1112017708 13:95345209-95345231 CAGGAGTTCAAGACTGGCCTGGG - Intergenic
1112291681 13:98149094-98149116 CAGCAGTTCAAGACTAGCCTGGG - Intronic
1113054030 13:106248390-106248412 CAGGATTTCAAGACTAGCCTGGG + Intergenic
1113370950 13:109725023-109725045 CTGCATTCACAGGCTGGGCTGGG + Intergenic
1114745895 14:25146516-25146538 CAGGAATTCAAGACTGGCCTGGG + Intergenic
1115231606 14:31166640-31166662 CTGGAGTTAAAGACCAGCCTGGG + Intronic
1115655790 14:35442358-35442380 CTGTATTTAAAGACTGGGCTGGG - Intergenic
1115773820 14:36693850-36693872 ATTCATTTAAAGACCAGCCTAGG - Intronic
1116372647 14:44155115-44155137 CAGTATTTACAGAATGGCCTTGG - Intergenic
1116457832 14:45139766-45139788 CAGGAGTTCAAGACTGGCCTGGG + Intronic
1116631746 14:47344275-47344297 CTGTTGTTAAAGACTGGCCAGGG + Intronic
1117129635 14:52672558-52672580 CTGGAATTAAAGACCAGCCTGGG + Intronic
1118422114 14:65618108-65618130 CAGGAGTTCAAGACTGGCCTGGG - Intronic
1119515738 14:75246868-75246890 CTGGATTTACAGACTCTCCTGGG - Intronic
1121097375 14:91227053-91227075 CAGGAGTTTAAGACTGGCCTGGG + Intergenic
1121134157 14:91479841-91479863 CAGAAGTTAAAGACTAGCCTGGG - Intronic
1121286001 14:92736385-92736407 CTGGACTTCAAGACCGGCCTGGG + Intronic
1122166098 14:99825192-99825214 CAGGAGTTCAAGACTGGCCTGGG - Intronic
1123203378 14:106689976-106689998 ATACATTTAAAGACATGCCTCGG + Intergenic
1124571332 15:30866877-30866899 CTTCATTTAAAAAGTGGCCATGG - Intergenic
1125324965 15:38527086-38527108 ATGCATTTATACACTGGCATTGG + Intronic
1125710827 15:41784430-41784452 CAGGAGTTCAAGACTGGCCTGGG + Intronic
1126014826 15:44340464-44340486 CTGGAGTTAAAGAGTAGCCTGGG - Intronic
1126651824 15:50930815-50930837 CTGGATATAAAGACTTGACTGGG + Exonic
1126812905 15:52426174-52426196 CACCATTTAAAAACTGGACTAGG + Intronic
1126813413 15:52431317-52431339 CAGCAGTTCAAGACTAGCCTGGG + Intronic
1127298206 15:57628460-57628482 CTGGAGTTCAAGACTAGCCTGGG - Intronic
1127477237 15:59346346-59346368 CTTCATTAATAGAGTGGCCTGGG - Intronic
1127986261 15:64073795-64073817 CAGGATTTCAAGACTAGCCTGGG - Intronic
1128039171 15:64555154-64555176 CAGGAGTTCAAGACTGGCCTAGG + Intronic
1128574554 15:68763288-68763310 CAGGAGTTCAAGACTGGCCTGGG + Intergenic
1128711868 15:69878261-69878283 CAGCATTTACACACTGGACTAGG - Intergenic
1128723294 15:69969027-69969049 CAGGATTTCAAGACTAGCCTGGG - Intergenic
1129003774 15:72355315-72355337 CAGGAGTTCAAGACTGGCCTGGG + Intronic
1129137954 15:73571070-73571092 CAGGAGTTCAAGACTGGCCTTGG + Intronic
1129155554 15:73715100-73715122 CAGGATTTCAAGACTAGCCTGGG + Intergenic
1129386130 15:75197033-75197055 CAGGAGTTCAAGACTGGCCTGGG - Intronic
1129395624 15:75244088-75244110 CAGGAGTTAAAGGCTGGCCTAGG + Intergenic
1130351544 15:83096586-83096608 CAGAATTTCAAGACTAGCCTGGG - Intergenic
1130361625 15:83192892-83192914 CCTCATTTAAGGACAGGCCTGGG + Intronic
1130417969 15:83712337-83712359 CTGCAACTGAAAACTGGCCTTGG + Intronic
1132534279 16:469731-469753 CAGGAGTTCAAGACTGGCCTGGG - Intronic
1132811686 16:1802194-1802216 CAAGATTTCAAGACTGGCCTAGG + Intronic
1132926953 16:2435366-2435388 CTGGAATTCAAGACTAGCCTGGG + Intronic
1133198336 16:4186594-4186616 CAGGAGTTCAAGACTGGCCTGGG - Intergenic
1133541226 16:6756384-6756406 ATGCATTAAGACACTGGCCTAGG + Intronic
1135717123 16:24781265-24781287 CAGGAGTTCAAGACTGGCCTAGG - Intronic
1135952099 16:26924138-26924160 CAGGAGTTAAAGACTAGCCTGGG + Intergenic
1136004169 16:27317110-27317132 CAGCAGTTCAAGACTAGCCTAGG - Intronic
1136619975 16:31422146-31422168 CAGGAGTTCAAGACTGGCCTGGG - Intronic
1137907708 16:52341175-52341197 CAGGGTTTCAAGACTGGCCTCGG - Intergenic
1137970453 16:52979652-52979674 CTGGAGTTCAAGACTAGCCTGGG + Intergenic
1138098932 16:54236081-54236103 CAGGAATTCAAGACTGGCCTGGG - Intergenic
1139176277 16:64692219-64692241 ATGCATTTAAAGAAGGGCCATGG - Intergenic
1139633311 16:68243657-68243679 CAGGAGTTCAAGACTGGCCTGGG + Intergenic
1139690571 16:68639035-68639057 CTGGAATTCAAGACTAGCCTGGG + Intronic
1139751577 16:69112174-69112196 CAGCATATAAAGAATGGGCTAGG + Intronic
1139777104 16:69323356-69323378 CAGCAGTTTCAGACTGGCCTGGG - Intronic
1139828909 16:69780793-69780815 CAGGAGTTCAAGACTGGCCTGGG + Intronic
1139873506 16:70126732-70126754 CAGGAGTTCAAGACTGGCCTGGG - Intronic
1140362274 16:74354416-74354438 CAGGAGTTCAAGACTGGCCTGGG + Intergenic
1140575813 16:76167467-76167489 CTGCTTTTAAAGAATGCCCAAGG + Intergenic
1141192138 16:81832610-81832632 CTGCAGTTTAAGACCAGCCTGGG - Intronic
1141612312 16:85188591-85188613 CGGGAGTTAAAGACTAGCCTGGG + Intergenic
1141723961 16:85773912-85773934 CAGGAGTTAAAGACTAGCCTGGG + Intronic
1143827627 17:9624881-9624903 CTGCTTTTTTAGCCTGGCCTTGG + Intronic
1143898251 17:10153856-10153878 CTGGAGTTCAAGACCGGCCTGGG + Intronic
1144317921 17:14081573-14081595 CTGCATTCAAATCCTGGCTTTGG + Intronic
1144869249 17:18358691-18358713 CAGGAGTTCAAGACTGGCCTGGG + Intronic
1146038929 17:29432966-29432988 CAGGAATTCAAGACTGGCCTAGG - Intronic
1146704836 17:34993529-34993551 TGTCATTTAAAGACTGGCATGGG + Intronic
1147290045 17:39434705-39434727 CTGGAGTTAGAGTCTGGCCTGGG - Intronic
1147329196 17:39686752-39686774 CTGGAGTTCAAGACTAGCCTAGG - Intronic
1147812412 17:43182061-43182083 CAGCAGTTCAAGGCTGGCCTGGG - Intronic
1147957331 17:44143298-44143320 CAGGAGTTCAAGACTGGCCTGGG + Intronic
1148263145 17:46201796-46201818 CTGGAGTTCAAGACCGGCCTGGG + Intronic
1148378980 17:47178325-47178347 CAGGAGTTTAAGACTGGCCTGGG + Intronic
1148451799 17:47783423-47783445 CTGGAGTTTAAGACTGGCCTGGG - Intergenic
1149501034 17:57152563-57152585 CAGGAGTTTAAGACTGGCCTGGG + Intergenic
1150102496 17:62436336-62436358 CAGGAGTTCAAGACTGGCCTAGG + Intronic
1150238792 17:63615286-63615308 CAGGAGTTCAAGACTGGCCTGGG - Intergenic
1150804230 17:68306480-68306502 CAGGAGTTCAAGACTGGCCTAGG + Intronic
1150882976 17:69052160-69052182 CAGGAGTTAGAGACTGGCCTGGG + Intronic
1152374359 17:79911389-79911411 CTGGATTTCAGGACAGGCCTGGG - Intergenic
1152703392 17:81830695-81830717 CAGGAGTTCAAGACTGGCCTGGG + Intronic
1153700768 18:7691704-7691726 CAGGAGTTCAAGACTGGCCTGGG + Intronic
1153901531 18:9621624-9621646 CAGCAGTTCAAGACTAGCCTGGG - Intergenic
1155365896 18:25048668-25048690 CAGCATTTCAAGACCAGCCTGGG + Intergenic
1156214839 18:34987329-34987351 CTGCATTTTAAGACACTCCTAGG - Intronic
1156360333 18:36378983-36379005 CAGCATTTAAGGACTAGACTTGG - Intronic
1157469466 18:47977815-47977837 CTGGAGTTAAAGACCAGCCTGGG - Intergenic
1157872199 18:51240720-51240742 CTGGATTTCAAGACCAGCCTGGG - Intergenic
1157880474 18:51316825-51316847 CTGCAGCTAAAGTGTGGCCTTGG + Intergenic
1159596883 18:70391083-70391105 CAGGATTTTGAGACTGGCCTGGG - Intergenic
1159958362 18:74535821-74535843 CAGGAGTTCAAGACTGGCCTGGG + Intronic
1160300401 18:77672735-77672757 CAGGAGTTCAAGACTGGCCTAGG - Intergenic
1161815452 19:6496947-6496969 CAGCAGTTCAAGACTAGCCTGGG + Intronic
1161835670 19:6644667-6644689 CAGGAGTTCAAGACTGGCCTGGG - Intergenic
1162773969 19:12967619-12967641 CTGCTTTTCAAGACCAGCCTGGG + Intronic
1162903013 19:13806456-13806478 CAGCAGTTCAAGACCGGCCTGGG + Intronic
1163085007 19:14973108-14973130 CAGGAGTTCAAGACTGGCCTGGG + Intronic
1163247211 19:16104023-16104045 CAGGAGTTCAAGACTGGCCTGGG + Intergenic
1163247231 19:16104150-16104172 CAGGAGTTCAAGACTGGCCTGGG + Intergenic
1163301954 19:16453311-16453333 CAGGAGTTAGAGACTGGCCTGGG - Intronic
1163704044 19:18802105-18802127 CAGCAGTTCCAGACTGGCCTGGG + Intergenic
1163704074 19:18802336-18802358 CTGAAATTCAAGACCGGCCTGGG - Intergenic
1164505036 19:28853064-28853086 CTGTATTTAAAGACTCATCTTGG + Intergenic
1164629072 19:29749286-29749308 CTGCATTGTAAGTCTGGCCGTGG + Intergenic
1164854975 19:31513703-31513725 CTTCATTTGCAGACTTGCCTAGG + Intergenic
1165074058 19:33270930-33270952 CAGGAGTTCAAGACTGGCCTGGG + Intergenic
1165176395 19:33933511-33933533 CAGCAGTTCAAGACTGGCCTGGG - Intergenic
1165310566 19:35027171-35027193 CAGGAGTTCAAGACTGGCCTGGG - Intergenic
1165553711 19:36610738-36610760 CTTCATTTATAGACTCACCTAGG - Exonic
1165563705 19:36704228-36704250 CAGGAGTTCAAGACTGGCCTGGG + Intronic
1165789196 19:38481333-38481355 CAGGAGTTCAAGACTGGCCTGGG - Intronic
1165920597 19:39295526-39295548 CAGGAGTTCAAGACTGGCCTGGG + Intergenic
1165959654 19:39523476-39523498 CAGGAGTTCAAGACTGGCCTGGG + Intergenic
1167135322 19:47612204-47612226 CTGGATTTTAAGACCAGCCTAGG + Intronic
1167770810 19:51515849-51515871 CAGGATTTCAAGACTAGCCTGGG - Intergenic
925068329 2:947674-947696 CTGCAATTGAAGACTTGCTTTGG - Intergenic
925467565 2:4121794-4121816 CTCCATTTTAAGAATGTCCTAGG - Intergenic
925652443 2:6105455-6105477 CAGTGTTTAAAGACTGGTCTCGG + Intergenic
925763877 2:7212209-7212231 CAGGAGTTCAAGACTGGCCTGGG + Intergenic
926176895 2:10601601-10601623 CTGAAGTTAAAGACCAGCCTGGG + Intronic
926254908 2:11184736-11184758 TGGCATTTAAAGACTGGGATTGG - Intronic
926652199 2:15358651-15358673 CAGGAGTTCAAGACTGGCCTGGG - Intronic
927205161 2:20604352-20604374 CTGCTTTTAAAGACTGCCCCGGG + Intronic
927547240 2:23964933-23964955 CAGGAGTTCAAGACTGGCCTGGG + Intronic
928025028 2:27732516-27732538 CAGGAGTTCAAGACTGGCCTGGG - Intergenic
928536275 2:32244767-32244789 CAGGAGTTCAAGACTGGCCTTGG + Intronic
928956543 2:36875299-36875321 CAGCAGTTCAAGACTAGCCTGGG + Intronic
929676061 2:43931013-43931035 CTGGATTTAATGTCTGGTCTTGG - Intronic
929692311 2:44085184-44085206 CAGGAGTTCAAGACTGGCCTGGG - Intergenic
931971933 2:67597614-67597636 CAGGAGTTCAAGACTGGCCTGGG - Intergenic
932024732 2:68121437-68121459 CTGCATTTGAAGACAGACCCAGG - Intergenic
932559017 2:72851085-72851107 CTACATCTAAAGAGTGGCCAAGG - Intergenic
932650639 2:73551928-73551950 CTACATTTAAAAACTGCCCTGGG - Intronic
932818864 2:74882552-74882574 CAGGATTTCAAGACTAGCCTAGG + Intronic
933665907 2:84964652-84964674 CAGGAGTTCAAGACTGGCCTAGG + Intergenic
933756135 2:85640078-85640100 CAGGAGTTAAAGAATGGCCTGGG - Intronic
933800673 2:85958048-85958070 CTGCAGTTCAAGACCAGCCTGGG - Intergenic
935671843 2:105562643-105562665 CAGGAGTTCAAGACTGGCCTGGG + Intergenic
936238777 2:110769439-110769461 CAGGAGTTCAAGACTGGCCTGGG + Intronic
936482727 2:112900109-112900131 CAGGATTTCAAAACTGGCCTGGG + Intergenic
937871203 2:126787623-126787645 CAGCATTAGGAGACTGGCCTTGG + Intergenic
938111249 2:128567149-128567171 CAGGAGTTCAAGACTGGCCTGGG + Intergenic
938252169 2:129823885-129823907 CTTCTTTTAAAGAATGCCCTTGG - Intergenic
938542258 2:132293809-132293831 CTGCATTTAAAGAGTGTCCTCGG + Intergenic
938600585 2:132834695-132834717 CAGCAGTTCAAGACTAGCCTGGG - Intronic
940023135 2:149177233-149177255 ATGCATTTGAAGAATGGCATTGG - Intronic
940323537 2:152401617-152401639 CTTTATTTAGAGATTGGCCTTGG + Intronic
940381051 2:153015289-153015311 CAGGAGTTCAAGACTGGCCTGGG - Intergenic
941821283 2:169845790-169845812 CAGCAGTTCAAGACTAGCCTGGG - Intronic
942034615 2:171999007-171999029 CTGCATTTAAAGTCTGGAAACGG + Intronic
942073524 2:172336420-172336442 CTTCCTTTAAAGAGTGGTCTTGG - Intergenic
942275827 2:174322881-174322903 CCGCATTTCAAGCCTTGCCTGGG + Intergenic
942309979 2:174647161-174647183 CAGGAGTTCAAGACTGGCCTGGG + Intronic
944109355 2:196115454-196115476 CAGGAGTTCAAGACTGGCCTAGG + Intergenic
945056881 2:205877146-205877168 CAGGATTTTAAGACCGGCCTGGG - Intergenic
945227492 2:207546822-207546844 CTACATTTAAAAACTGACCATGG - Intronic
945281206 2:208036962-208036984 CAGGAGTTCAAGACTGGCCTAGG + Intergenic
946008322 2:216544246-216544268 CTGCAGTTCAAGACCAGCCTGGG - Intronic
946744949 2:222836332-222836354 CAGGAGTTCAAGACTGGCCTGGG + Intergenic
948003613 2:234589622-234589644 CTGGAGTTTAAGACTAGCCTGGG - Intergenic
948111397 2:235458847-235458869 CAGGAGTTCAAGACTGGCCTGGG + Intergenic
948293792 2:236846364-236846386 CTGGAGTTCGAGACTGGCCTGGG + Intergenic
948394502 2:237634283-237634305 CTGCATTGAAGGACGGGACTTGG + Intronic
948455609 2:238103212-238103234 CAGGAATTCAAGACTGGCCTGGG + Intronic
1169079746 20:2789873-2789895 CAGGATTTCAAGACTAGCCTGGG + Intergenic
1169434583 20:5574524-5574546 CAGGAGTTCAAGACTGGCCTGGG + Intronic
1171272056 20:23825168-23825190 CTGCAGTGCATGACTGGCCTGGG + Intronic
1171871140 20:30526652-30526674 CTGCATTTAAAGAGTGTCCTCGG + Intergenic
1172432602 20:34905124-34905146 CAGGAGTTCAAGACTGGCCTGGG - Intronic
1172723147 20:37014588-37014610 CAGGAGTTCAAGACTGGCCTTGG + Intronic
1174457676 20:50661281-50661303 CAGGAGTTGAAGACTGGCCTGGG - Intronic
1175104074 20:56601578-56601600 CAGGAGTTCAAGACTGGCCTGGG + Intergenic
1175112052 20:56655278-56655300 CAGGAGTTCAAGACTGGCCTGGG + Intergenic
1176053243 20:63131605-63131627 CAGCATTTAAAGACACGCCTGGG + Intergenic
1178528443 21:33353443-33353465 TTACATTTAAAGATTGGCGTGGG - Intronic
1178668522 21:34569879-34569901 CTGCATTCAAAGACTGGATCCGG - Intronic
1178979174 21:37246964-37246986 CTGGAGTTCAAGACTAGCCTGGG - Intronic
1178983043 21:37281349-37281371 CAGAAGTTAAAGACTAGCCTGGG - Intergenic
1180390013 22:12221246-12221268 CTGCAGTTATAAACTAGCCTTGG + Intergenic
1180415924 22:12713234-12713256 CTGCAGTTATAAACTAGCCTTGG - Intergenic
1180885090 22:19237264-19237286 CAGGAGTTCAAGACTGGCCTAGG + Intronic
1181950526 22:26550582-26550604 CTGCACTTACAGAGTGGCCCTGG + Intronic
1182649532 22:31839920-31839942 CAGGAGTTCAAGACTGGCCTAGG + Intronic
1183889060 22:40910494-40910516 CAGGAGTTCAAGACTGGCCTGGG + Intronic
1184061500 22:42085062-42085084 CAGGAGTTCAAGACTGGCCTGGG + Intergenic
1184527587 22:45034707-45034729 CAGGAGTTCAAGACTGGCCTGGG - Intergenic
1184648640 22:45909497-45909519 CTGAATGCAAAGACTGCCCTGGG - Intergenic
1185328417 22:50239383-50239405 CAGGATTTTGAGACTGGCCTGGG - Intronic
951229964 3:20166794-20166816 CAGGAGTTTAAGACTGGCCTAGG + Intronic
952949066 3:38504157-38504179 CAGCAGTTTGAGACTGGCCTGGG + Intronic
953311436 3:41883942-41883964 CTCCATTTACAGACGGGCCAAGG - Exonic
953950413 3:47185151-47185173 CTGCAGTTCAAGACCAGCCTGGG - Intergenic
953966040 3:47308175-47308197 CTGCATGGAAAGAATGCCCTTGG - Intronic
954062987 3:48084485-48084507 CTGCATTTAAAGACTGGCCTAGG + Intronic
954734798 3:52697816-52697838 CTGCATCTGAAGACAGGCTTGGG - Exonic
954768298 3:52941686-52941708 CAGCAGTTTGAGACTGGCCTGGG + Intronic
955738373 3:62063709-62063731 CAGCAGTTCAAGACTAGCCTGGG - Intronic
956819241 3:72938047-72938069 CAGGAGTTCAAGACTGGCCTGGG + Intronic
956951992 3:74293681-74293703 CAGGATTTCACGACTGGCCTGGG - Intronic
957101051 3:75829251-75829273 CTGCAGTTATAAACTAGCCTTGG + Intergenic
958470174 3:94507533-94507555 CTGCATTTACAGGCTGACCCGGG - Intergenic
959990283 3:112623608-112623630 CTGCATTTAAAAAATTTCCTGGG + Intronic
960041525 3:113154677-113154699 CAGGAGTTCAAGACTGGCCTGGG - Intergenic
960083995 3:113571211-113571233 CAGGAGTTCAAGACTGGCCTAGG + Intronic
960624310 3:119665580-119665602 CTGGAGTTCAAGACTGGCCTGGG - Intronic
960670218 3:120148476-120148498 CAGCAATTCAAGACTAGCCTGGG - Intergenic
960773634 3:121223885-121223907 CAGGAGTTCAAGACTGGCCTGGG + Intronic
961225018 3:125236268-125236290 CTGGAGTTCAAGACAGGCCTTGG - Intronic
961710185 3:128822468-128822490 CGGGAGTTCAAGACTGGCCTAGG + Intergenic
962306322 3:134289759-134289781 CAGGAGTTCAAGACTGGCCTGGG + Intergenic
962582108 3:136807482-136807504 CAGAATTTCAAGACTGGCCTGGG - Intergenic
962979943 3:140479269-140479291 CAGGATTTAAGGACTGGCCCAGG + Intronic
963066760 3:141270358-141270380 CTGCTTTTAAAGGCTGGAGTGGG - Intronic
963356549 3:144215216-144215238 CTGCATTAAAAGACAAGCTTTGG - Intergenic
963361048 3:144272277-144272299 CTGCCTTCAAAGACAGTCCTGGG + Intergenic
964825555 3:160823818-160823840 CTGAATTTAAATCCTGGCCTTGG - Intronic
965694018 3:171388144-171388166 CTCAATACAAAGACTGGCCTGGG + Intronic
965766656 3:172137445-172137467 CAGGAGTTAAAGACTAGCCTGGG + Intronic
967391310 3:188957971-188957993 GTGCACTTAAAGAGAGGCCTTGG + Intronic
967636629 3:191809046-191809068 CGGCATTTCAAGACCCGCCTTGG + Intergenic
968129464 3:196184383-196184405 CAGGAGTTCAAGACTGGCCTGGG + Intergenic
968503078 4:960179-960201 CTGCTCTTAAGGACTGGCCAGGG + Exonic
972661275 4:41118929-41118951 CAGGAGTTCAAGACTGGCCTTGG + Intronic
972937229 4:44151448-44151470 CAGGAGTTCAAGACTGGCCTGGG + Intergenic
973807860 4:54542944-54542966 CTGCTTTTTCAGAATGGCCTGGG - Intergenic
973941092 4:55911329-55911351 CAGGATTTCAAGACTAGCCTGGG - Intergenic
974397266 4:61353647-61353669 CAGGAGTTAGAGACTGGCCTAGG - Intronic
974768214 4:66376358-66376380 CTGAATTTAAAGACTGACTTGGG - Intergenic
976296978 4:83482498-83482520 CAGGAGTTAAAGACTAGCCTGGG + Intronic
978267574 4:106844725-106844747 CAGGAGTTCAAGACTGGCCTAGG - Intergenic
978444270 4:108765607-108765629 CTTTATTTAAAGACTGTCCTTGG - Intergenic
978570150 4:110127997-110128019 CAGGAGTTCAAGACTGGCCTGGG + Intronic
979703739 4:123695983-123696005 CAGCAGTTCAAGACTAGCCTAGG - Intergenic
980074547 4:128280805-128280827 CAGCAGTTCAAGACTAGCCTGGG - Intronic
980083304 4:128367102-128367124 CAGGAGTTCAAGACTGGCCTGGG + Intergenic
980131155 4:128817251-128817273 CTGGAGTTCAAGACTAGCCTGGG - Intronic
980594198 4:134931003-134931025 TTTTATTTAAAAACTGGCCTTGG - Intergenic
980762535 4:137254688-137254710 ACTCTTTTAAAGACTGGCCTAGG - Intergenic
981799304 4:148637185-148637207 CTGCTTTAACAGACTGGCATTGG + Intergenic
981947076 4:150360199-150360221 CAGGAGTTCAAGACTGGCCTGGG - Intronic
981996707 4:150983246-150983268 CAGAAGTTCAAGACTGGCCTGGG + Intronic
982381515 4:154754034-154754056 ATGTATTTCAAGACTGGCCCTGG - Intergenic
982715653 4:158804619-158804641 CAGGATTTAAAGACCAGCCTGGG - Intronic
984680080 4:182597192-182597214 CAGGAGTTCAAGACTGGCCTGGG + Intronic
984796173 4:183661971-183661993 CAGGAGTTCAAGACTGGCCTGGG - Intronic
985998905 5:3614716-3614738 CTGCCTATAAAGAATGACCTAGG - Intergenic
987063660 5:14266879-14266901 CTGCCTTTAAGGACTCCCCTGGG + Intronic
987378530 5:17260969-17260991 CAGGAGTTAAAGACTAGCCTGGG + Intronic
987593500 5:19964370-19964392 CAGGATTTCAAGACTAGCCTGGG + Intronic
987776759 5:22376729-22376751 CAGGATTTTGAGACTGGCCTGGG - Intronic
988883004 5:35524530-35524552 CTTGATTTCAAGACTAGCCTGGG - Intergenic
989351224 5:40488967-40488989 CTGCATCTGAAGACTGGGCCAGG - Intergenic
993805990 5:92410153-92410175 CAGGAGTTAAAGACTAGCCTGGG + Intergenic
994531643 5:100980224-100980246 CTGAAGTTCAAGAATGGCCTGGG - Intergenic
995851843 5:116554604-116554626 CTGCATTTTAAGACTTGCTTTGG + Intronic
996784780 5:127227086-127227108 CTGGAGTTTAAGACTAGCCTGGG + Intergenic
996870967 5:128192915-128192937 CAGGATTTCAATACTGGCCTTGG + Intergenic
997399188 5:133589365-133589387 CTGCTTTTAAGAATTGGCCTTGG - Intronic
997801249 5:136864908-136864930 CTGCAGTTAGAGACAAGCCTGGG + Intergenic
997967611 5:138371754-138371776 CAGAAGTTCAAGACTGGCCTGGG + Intronic
998046514 5:138991255-138991277 CTGCATTTAATCAGTTGCCTTGG - Intronic
998669228 5:144334986-144335008 CAGGAGTTAGAGACTGGCCTGGG - Intronic
999204544 5:149838640-149838662 CTGCATTCATAGAATTGCCTGGG + Intronic
999458147 5:151735122-151735144 CAGGAGTTCAAGACTGGCCTGGG + Intergenic
1000579412 5:163016864-163016886 CAGGAATTCAAGACTGGCCTCGG - Intergenic
1000755637 5:165155674-165155696 ATGCATTTCTACACTGGCCTTGG + Intergenic
1001552264 5:172611652-172611674 CTGCATCTACAGACAGACCTGGG - Intergenic
1001697055 5:173678761-173678783 CTGGATTTCAAGACCAGCCTGGG - Intergenic
1001905825 5:175472302-175472324 CAGGAGTTCAAGACTGGCCTGGG - Intergenic
1002255807 5:177957989-177958011 CAGGATTTCAAGACTAGCCTGGG - Intergenic
1003023593 6:2533277-2533299 CTGCAGTTCAAGACCAGCCTGGG + Intergenic
1003871377 6:10405398-10405420 CCGCAGTTCAAAACTGGCCTTGG - Intronic
1004357198 6:14940269-14940291 CAGGAGTTCAAGACTGGCCTGGG + Intergenic
1004478478 6:15996829-15996851 CTGGAGTTCAAGACTAGCCTGGG - Intergenic
1004626581 6:17383015-17383037 CAGGAGTTCAAGACTGGCCTGGG - Intergenic
1004773591 6:18816089-18816111 CAGGAGTTAGAGACTGGCCTGGG + Intergenic
1005386812 6:25293585-25293607 CAGGAGTTTAAGACTGGCCTAGG - Intronic
1005490800 6:26345283-26345305 CAGCAGTTAAAGACCAGCCTGGG - Intergenic
1005952167 6:30639923-30639945 CTGGAGTTTGAGACTGGCCTGGG + Intronic
1006453183 6:34117255-34117277 GGGGATTTAGAGACTGGCCTCGG + Intronic
1006591038 6:35157845-35157867 CAGGATTTCAAGACTAGCCTGGG + Intergenic
1006696843 6:35938280-35938302 CAGGAGTTCAAGACTGGCCTGGG + Intergenic
1006848821 6:37082492-37082514 CAGGATTTCAAGATTGGCCTGGG + Intergenic
1009609897 6:65927870-65927892 CTGGAGTTTGAGACTGGCCTGGG - Intergenic
1011464553 6:87642085-87642107 CAGGAGTTAAAGACTGGCCTAGG + Intronic
1011604833 6:89092909-89092931 CAGGAGTTCAAGACTGGCCTGGG - Intergenic
1011689455 6:89852955-89852977 CAGGATTTCAAGACTAGCCTGGG - Intronic
1012471945 6:99582194-99582216 CAGCAGTTCAAGACTAGCCTGGG + Intergenic
1012496264 6:99836585-99836607 CAGGAGTTTAAGACTGGCCTGGG - Intergenic
1012541613 6:100367940-100367962 CGGGATTTCAAGACTAGCCTGGG + Intergenic
1012942677 6:105432037-105432059 CAGGATCTCAAGACTGGCCTGGG - Intergenic
1012968231 6:105698586-105698608 CTGCAATAGAAGAATGGCCTAGG - Intergenic
1013095830 6:106944213-106944235 CAGGAGTTCAAGACTGGCCTGGG + Intergenic
1013544349 6:111140996-111141018 CTGGAATTCGAGACTGGCCTAGG - Intronic
1014512750 6:122344673-122344695 CTGCAGTAAAAGACTTGCCAGGG + Intergenic
1014899684 6:126947641-126947663 CTGCTCTTATAGACTTGCCTTGG - Intergenic
1016294915 6:142563971-142563993 CTCCATTCAAAAACTGGCCAAGG + Intergenic
1016370729 6:143371524-143371546 CAGAATTTCAAGACCGGCCTGGG - Intergenic
1017575441 6:155797278-155797300 CTGTATTTAAATACTGGAATAGG + Intergenic
1018738452 6:166707950-166707972 CAGCAGTTCAAGACCGGCCTAGG - Intronic
1018814296 6:167319360-167319382 CTGCATTTTAAGCTTGGTCTAGG - Intergenic
1019465894 7:1188714-1188736 CAGGAGTTTAAGACTGGCCTGGG + Intergenic
1019990778 7:4689184-4689206 CAGGAGTTCAAGACTGGCCTGGG - Intronic
1020206145 7:6118183-6118205 CAGGATTTCAAGACTAGCCTGGG + Intronic
1020381812 7:7556085-7556107 CTGTATTTAAAGATTAGCATTGG - Intergenic
1021168255 7:17367001-17367023 CTACCTTTGAAGACTGGCTTAGG - Intergenic
1021177459 7:17466333-17466355 TTCCATTTAAAGACTTTCCTTGG - Intergenic
1021510180 7:21426569-21426591 CCACATGTAAATACTGGCCTTGG - Intergenic
1022095734 7:27139849-27139871 CTGCAATTAAAGTTAGGCCTGGG + Intronic
1022407707 7:30107097-30107119 CTGAATTTATAGACTGACTTTGG + Intronic
1023007543 7:35888609-35888631 CAGGAGTTCAAGACTGGCCTGGG + Intronic
1023234469 7:38069270-38069292 GTGCATTTAAACACTGGAGTAGG + Intergenic
1023495010 7:40785877-40785899 CAGCAGTTCAAGACCGGCCTGGG + Intronic
1024479094 7:49845609-49845631 CTGTATTTGAAGACTGACTTTGG - Intronic
1025897073 7:65712654-65712676 CAGGAGTTCAAGACTGGCCTGGG - Intergenic
1025968043 7:66293291-66293313 CAGGATTTCAAGACTAGCCTGGG + Intronic
1026743904 7:72996646-72996668 CAGGAGTTCAAGACTGGCCTGGG - Intergenic
1027099832 7:75368437-75368459 CAGGAGTTCAAGACTGGCCTGGG + Intergenic
1027252404 7:76407521-76407543 CAGGATTTCAAGACCGGCCTAGG + Intronic
1028380941 7:90197689-90197711 CAGCATTTCAAGTCTAGCCTGGG + Intronic
1028944324 7:96559489-96559511 CTGGATTTCAAGACCAGCCTGGG - Intronic
1029122865 7:98280404-98280426 CAGCAGTTTGAGACTGGCCTGGG + Intronic
1029814015 7:103075338-103075360 CTGCATTTACAGGCTGACCCGGG + Exonic
1029837941 7:103332830-103332852 CTGTAGTTCAAGACTAGCCTGGG - Intronic
1030045931 7:105495544-105495566 CAGGAGTTCAAGACTGGCCTGGG + Intronic
1031908087 7:127483621-127483643 CAGGAGTTCAAGACTGGCCTGGG + Intergenic
1032031646 7:128489220-128489242 CAGGAGTTCAAGACTGGCCTAGG + Intronic
1032323553 7:130905726-130905748 CTGCAATAAAAGACTTGCTTTGG - Intergenic
1032654836 7:133916475-133916497 CAGGAGTTCAAGACTGGCCTCGG - Intronic
1033113543 7:138605005-138605027 CAGGAGTTCAAGACTGGCCTGGG + Intronic
1034254703 7:149718196-149718218 CAGGAGTTCAAGACTGGCCTGGG + Intronic
1034582448 7:152057063-152057085 CAGGAATTCAAGACTGGCCTGGG - Intronic
1034608777 7:152345191-152345213 CAGCATTTCAAGACCAGCCTGGG + Intronic
1035368237 7:158362107-158362129 CTGCATTTCTAGTCTGGGCTGGG - Intronic
1035849312 8:2899433-2899455 CAGCATTTCAAGACCAGCCTGGG + Intergenic
1037230633 8:16653655-16653677 CAGCAGTTTGAGACTGGCCTGGG + Intergenic
1037376046 8:18230105-18230127 CAGGAGTTCAAGACTGGCCTGGG + Intergenic
1037780731 8:21867348-21867370 CAGGAGTTCAAGACTGGCCTGGG - Intergenic
1038283493 8:26186551-26186573 CTGCCTGTAAGCACTGGCCTGGG - Intergenic
1038399223 8:27270334-27270356 CAGCAGTTGAAGACTAGCCTAGG - Intergenic
1038563223 8:28598297-28598319 CAGGATTTTGAGACTGGCCTGGG + Intergenic
1039081177 8:33735419-33735441 CAGGAGTTTAAGACTGGCCTGGG + Intergenic
1039558468 8:38494265-38494287 CAGCAGTTCAAGACTAGCCTGGG + Intergenic
1039895579 8:41714370-41714392 CTCCAAGTTAAGACTGGCCTGGG - Intronic
1039951157 8:42173782-42173804 CTGCATTTATTTACTGGCCTAGG + Intergenic
1041340040 8:56835292-56835314 CAGGAGTTCAAGACTGGCCTGGG + Intergenic
1042210981 8:66380209-66380231 CTGCATTCAGAAGCTGGCCTTGG - Intergenic
1042444871 8:68872124-68872146 CTGGAGTTCAAGACTAGCCTAGG - Intergenic
1042861399 8:73317710-73317732 CAGGAGTTCAAGACTGGCCTGGG + Intronic
1043460408 8:80454711-80454733 CAGGAGTTCAAGACTGGCCTGGG - Intergenic
1044273321 8:90272144-90272166 CAGTATCTAAAGTCTGGCCTGGG - Intergenic
1044461007 8:92443845-92443867 CTTCATTTATGGAGTGGCCTGGG + Intergenic
1045110744 8:98937829-98937851 CTGCATTCAAATATTGGCCTTGG + Intronic
1046038389 8:108872851-108872873 CTGGATTTCAAGACCAGCCTGGG + Intergenic
1046039234 8:108882108-108882130 CAGCATTTACAGACTGTTCTGGG - Intergenic
1046640268 8:116721755-116721777 CTGGATTTCAAGACTTGCCTGGG + Intronic
1047255153 8:123208486-123208508 CTGCTGCTCAAGACTGGCCTGGG - Exonic
1047467581 8:125132701-125132723 CAGCAGTTCAAGACTAGCCTGGG - Intronic
1047985205 8:130226084-130226106 CTGGATTTTGAGACTAGCCTGGG - Intronic
1048270761 8:133026374-133026396 CTCCTTTTAAACACTGGGCTGGG - Intronic
1050439175 9:5642498-5642520 CAGCATTTCTGGACTGGCCTGGG - Intronic
1051624907 9:19090045-19090067 CTGGAGTTCAAGACTAGCCTGGG - Intronic
1052301105 9:26953717-26953739 CAGGAGTTCAAGACTGGCCTGGG - Intronic
1053127161 9:35591532-35591554 CTGGAGTTCAAGACTGACCTGGG - Intergenic
1053452793 9:38207219-38207241 CAGGAGTTCAAGACTGGCCTGGG - Intergenic
1054978973 9:71181917-71181939 CTGCATTTATTGAGTGGCCCAGG - Intronic
1055023686 9:71696560-71696582 CAGGAGTTAGAGACTGGCCTGGG + Intronic
1055052806 9:71996721-71996743 CAGAAGTTCAAGACTGGCCTGGG + Intergenic
1056956675 9:91087841-91087863 CAGGAGTTCAAGACTGGCCTGGG - Intergenic
1057105602 9:92412293-92412315 CAGAAGTTCAAGACTGGCCTAGG - Intronic
1057738837 9:97693026-97693048 CTGCAACTAAAGACTGGAATAGG + Intronic
1057771437 9:97971431-97971453 CAGGATTTAGAGACTAGCCTGGG + Intergenic
1058029870 9:100183582-100183604 CAGCATTTCAAGACTGCCCTGGG + Intronic
1058634207 9:107020500-107020522 CTCCATTTATAGTGTGGCCTTGG + Intergenic
1058691295 9:107522748-107522770 CAGGAGTTCAAGACTGGCCTGGG - Intergenic
1059108426 9:111531890-111531912 CAGGAGTTCAAGACTGGCCTGGG - Intronic
1059443090 9:114321813-114321835 CTGGAGTTCAAGACTAGCCTGGG - Intergenic
1059603219 9:115804108-115804130 CTGGATTTCAAGACCAGCCTGGG + Intergenic
1060634091 9:125186535-125186557 CAGGAGTTCAAGACTGGCCTGGG + Intronic
1061776785 9:132971071-132971093 CAGGAGTTCAAGACTGGCCTGGG - Intronic
1062335316 9:136062704-136062726 CAGCAGTTCAAGACTAGCCTGGG + Intronic
1185826075 X:3251135-3251157 CTGGATTTGAGGACTAGCCTAGG - Intergenic
1186191573 X:7071997-7072019 CAGGAGTTAAAGACTAGCCTGGG - Intronic
1186908199 X:14133631-14133653 CTGCATTTTAAGACTGCCTCAGG - Intergenic
1187395107 X:18912556-18912578 CAGGAGTTCAAGACTGGCCTGGG + Intronic
1188505109 X:30873963-30873985 CAGGAGTTCAAGACTGGCCTGGG + Intronic
1189475940 X:41355685-41355707 CAGAAATTCAAGACTGGCCTGGG - Intronic
1190045036 X:47104506-47104528 CAGCAGTTAAAGACCAGCCTGGG + Intergenic
1190294250 X:49015376-49015398 CTGGAATTCAAGACTAGCCTGGG + Intergenic
1190792371 X:53712229-53712251 CTGGAGTTCAAGACTAGCCTGGG - Intergenic
1192108367 X:68338864-68338886 CAGGAGTTCAAGACTGGCCTGGG + Intronic
1193535130 X:82705596-82705618 TTTCATTTAAAGATTGGCTTTGG - Intergenic
1195218939 X:102728258-102728280 CAGGAATTCAAGACTGGCCTGGG - Intronic
1196195948 X:112838979-112839001 CTACATTTTATAACTGGCCTGGG - Intronic
1196421593 X:115527834-115527856 CAGGAATTCAAGACTGGCCTGGG - Intergenic
1196988558 X:121302102-121302124 CTGATTTTTAACACTGGCCTTGG - Intergenic
1197387680 X:125821281-125821303 CTGCTTTCATAGACTGGCATTGG + Intergenic
1198169421 X:134091161-134091183 CAGGAGTTCAAGACTGGCCTGGG - Intergenic
1198295937 X:135286482-135286504 CTGAATGTAAGGACAGGCCTAGG - Exonic
1198382298 X:136095363-136095385 CAGGAGTTCAAGACTGGCCTGGG + Intergenic
1199001817 X:142647912-142647934 CTCCCTTTAAAGACATGCCTTGG - Intergenic
1200777760 Y:7184805-7184827 CAGGATTTGAAGACTAGCCTGGG + Intergenic
1202589439 Y:26466998-26467020 CAGCAGTTCAAGACTAGCCTGGG - Intergenic