ID: 954064158

View in Genome Browser
Species Human (GRCh38)
Location 3:48092574-48092596
Sequence CAGAGGAAACAATATGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954064158_954064165 23 Left 954064158 3:48092574-48092596 CCCTCCTCATATTGTTTCCTCTG No data
Right 954064165 3:48092620-48092642 TGATTTTCTACCAGGCATAGTGG No data
954064158_954064164 15 Left 954064158 3:48092574-48092596 CCCTCCTCATATTGTTTCCTCTG No data
Right 954064164 3:48092612-48092634 GATTAATATGATTTTCTACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954064158 Original CRISPR CAGAGGAAACAATATGAGGA GGG (reversed) Intergenic
No off target data available for this crispr