ID: 954078966

View in Genome Browser
Species Human (GRCh38)
Location 3:48201550-48201572
Sequence CTCCATCTTGAATCGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954078959_954078966 26 Left 954078959 3:48201501-48201523 CCTCAGTCCCTAGTTGCTGGGAC No data
Right 954078966 3:48201550-48201572 CTCCATCTTGAATCGGAGCTGGG No data
954078961_954078966 18 Left 954078961 3:48201509-48201531 CCTAGTTGCTGGGACTGTCAGAG No data
Right 954078966 3:48201550-48201572 CTCCATCTTGAATCGGAGCTGGG No data
954078960_954078966 19 Left 954078960 3:48201508-48201530 CCCTAGTTGCTGGGACTGTCAGA No data
Right 954078966 3:48201550-48201572 CTCCATCTTGAATCGGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954078966 Original CRISPR CTCCATCTTGAATCGGAGCT GGG Intergenic
No off target data available for this crispr