ID: 954082324

View in Genome Browser
Species Human (GRCh38)
Location 3:48219864-48219886
Sequence GGATGAACAAACTGCCTGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954082308_954082324 22 Left 954082308 3:48219819-48219841 CCTGGGATTCCCATCCCAGGACT No data
Right 954082324 3:48219864-48219886 GGATGAACAAACTGCCTGCTTGG No data
954082314_954082324 -1 Left 954082314 3:48219842-48219864 CCCTCCCCAGTGCTCCCCAAGGG No data
Right 954082324 3:48219864-48219886 GGATGAACAAACTGCCTGCTTGG No data
954082318_954082324 -5 Left 954082318 3:48219846-48219868 CCCCAGTGCTCCCCAAGGGGATG No data
Right 954082324 3:48219864-48219886 GGATGAACAAACTGCCTGCTTGG No data
954082319_954082324 -6 Left 954082319 3:48219847-48219869 CCCAGTGCTCCCCAAGGGGATGA No data
Right 954082324 3:48219864-48219886 GGATGAACAAACTGCCTGCTTGG No data
954082320_954082324 -7 Left 954082320 3:48219848-48219870 CCAGTGCTCCCCAAGGGGATGAA No data
Right 954082324 3:48219864-48219886 GGATGAACAAACTGCCTGCTTGG No data
954082311_954082324 8 Left 954082311 3:48219833-48219855 CCCAGGACTCCCTCCCCAGTGCT No data
Right 954082324 3:48219864-48219886 GGATGAACAAACTGCCTGCTTGG No data
954082310_954082324 12 Left 954082310 3:48219829-48219851 CCATCCCAGGACTCCCTCCCCAG No data
Right 954082324 3:48219864-48219886 GGATGAACAAACTGCCTGCTTGG No data
954082316_954082324 -2 Left 954082316 3:48219843-48219865 CCTCCCCAGTGCTCCCCAAGGGG No data
Right 954082324 3:48219864-48219886 GGATGAACAAACTGCCTGCTTGG No data
954082312_954082324 7 Left 954082312 3:48219834-48219856 CCAGGACTCCCTCCCCAGTGCTC No data
Right 954082324 3:48219864-48219886 GGATGAACAAACTGCCTGCTTGG No data
954082309_954082324 13 Left 954082309 3:48219828-48219850 CCCATCCCAGGACTCCCTCCCCA No data
Right 954082324 3:48219864-48219886 GGATGAACAAACTGCCTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954082324 Original CRISPR GGATGAACAAACTGCCTGCT TGG Intergenic
No off target data available for this crispr