ID: 954082663

View in Genome Browser
Species Human (GRCh38)
Location 3:48221699-48221721
Sequence CAGGCCAAACAGAAGGATCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 118}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954082655_954082663 17 Left 954082655 3:48221659-48221681 CCTGGTTGGAGGTCAGGGAAAGC 0: 1
1: 0
2: 1
3: 44
4: 248
Right 954082663 3:48221699-48221721 CAGGCCAAACAGAAGGATCGGGG 0: 1
1: 0
2: 0
3: 8
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954082663 Original CRISPR CAGGCCAAACAGAAGGATCG GGG Intergenic
901737542 1:11321998-11322020 CAGGCTCAGCAGAAGGATGGAGG - Intergenic
904503453 1:30931172-30931194 CAGCCCAAACAGAGGAAACGCGG + Intergenic
904903359 1:33875251-33875273 CAGGGCAAACATAAGGGGCGGGG + Intronic
907912260 1:58836897-58836919 CAGTCCAAAGAGAAGGTTGGTGG - Intergenic
909614963 1:77597406-77597428 CAGGCCACACTGAAGGAATGGGG - Intronic
913172233 1:116243405-116243427 CAGGCCAAACAGACCCAGCGGGG - Intergenic
913597196 1:120389542-120389564 CAGGTCAAACAGAAGGCAAGCGG - Intergenic
914090128 1:144489764-144489786 CAGGTCAAACAGAAGGCAAGCGG + Intergenic
914308480 1:146444458-146444480 CAGGTCAAACAGAAGGCAAGCGG - Intergenic
914514277 1:148361035-148361057 CAGGTCAAACAGAAGGCAAGCGG + Intergenic
914593629 1:149128675-149128697 CAGGTCAAACAGAAGGCAAGCGG + Intergenic
920382203 1:205541690-205541712 AAGTCCAAACAGAGGGAACGTGG - Intergenic
920815064 1:209323601-209323623 CAGGCCAGAGAGAAGGATTTCGG - Intergenic
1073122925 10:101133027-101133049 CAGCCCGGACGGAAGGATCGTGG - Intronic
1077860822 11:6178272-6178294 CAGGCCACACAGAAGGAGTTGGG + Intergenic
1085642345 11:78200361-78200383 GAGGCCAAGCAGCTGGATCGTGG + Intronic
1091165429 11:133471695-133471717 GAGGTAAAACAGAAGGATTGAGG + Intronic
1091883840 12:4001895-4001917 CAGGCCAGATAGAAGGATATGGG - Intergenic
1092054812 12:5500039-5500061 CAGCCTAAACAGAAGGAGCCGGG + Intronic
1092483180 12:8879062-8879084 CAGGACAGACACAAGGATGGAGG - Intronic
1094399244 12:30043722-30043744 CATGACCAACAGAAGGATGGTGG + Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096715145 12:53486740-53486762 TAGGCCAAGAAGAAGGTTCGAGG + Intronic
1100673003 12:96836309-96836331 CAGGGAAAACATAAGGATTGAGG + Intronic
1102618178 12:114172924-114172946 CAGGCCATACAGGGGGATTGGGG + Intergenic
1103298901 12:119912182-119912204 GAAGCTAAACAGAAGGATTGAGG - Intergenic
1111244852 13:85523561-85523583 AAAGCCAAACAGAAGGCTCAGGG + Intergenic
1118491268 14:66263137-66263159 CATTCCAAGCAGAAGGATCCTGG - Intergenic
1120796547 14:88639436-88639458 AAACCAAAACAGAAGGATCGTGG - Intronic
1121757427 14:96414712-96414734 CAGGCCAAGAAGACGGATGGAGG + Intronic
1122330875 14:100911633-100911655 AAGGCTAAAGAGAAGGGTCGAGG - Intergenic
1123440245 15:20285779-20285801 CAGGCCAAACTGGAGACTCGGGG - Intergenic
1124121640 15:26893682-26893704 CAGGGGAAACAGGAGGATCTGGG + Intronic
1125707285 15:41750076-41750098 GAGGCCAAAGAGAAGGAATGTGG + Exonic
1136844922 16:33568655-33568677 CAGGCCAAACTGGAGACTCGGGG + Intergenic
1138311570 16:56028117-56028139 CAGGCCAAAAAGAGGGACCAGGG - Intergenic
1141883526 16:86875604-86875626 ATAGCCAAACAGAGGGATCGTGG + Intergenic
1203155090 16_KI270728v1_random:1868953-1868975 CAGGCCAAACTGGAGACTCGGGG + Intergenic
1143329417 17:6122273-6122295 CTGGCCAAACTGAAGGTTGGAGG - Exonic
1147312464 17:39603651-39603673 GAGGCCAAACAGAGGGACCCTGG - Intronic
1148193703 17:45698303-45698325 CATGCCAAAGAGAAGGCTAGAGG - Intergenic
1148607869 17:48943956-48943978 CAGGCCAAGTATAAGGAGCGAGG - Exonic
1149871586 17:60186867-60186889 AGGGACAAACAGAAGGATCCCGG - Intronic
1150062252 17:62078525-62078547 AAGGGCAAACAGAGGGATGGTGG - Intergenic
1151310793 17:73291375-73291397 CAGGCCACCCAGCAGGATTGAGG + Intronic
1152188724 17:78875300-78875322 AAGGACAAACAGAAGGAAAGAGG + Intronic
1152900367 17:82937653-82937675 CAGGGCACACAGGAGAATCGGGG - Intronic
1153364972 18:4245890-4245912 CAGGCAAAACAGATGAGTCGGGG - Intronic
1153469443 18:5427648-5427670 CAGGACAAACAGAAAGAGCATGG + Intronic
1153565344 18:6413654-6413676 CAGCTCCAACAGAAGGATCCAGG + Intronic
1155457585 18:26035272-26035294 CAAACCAAACAGAAGGATTTCGG + Intronic
1155612707 18:27684762-27684784 CAGCCAAAACAGTAGGATTGGGG + Intergenic
1158311643 18:56165885-56165907 CAAGCCAAAAAGAATGATCGTGG + Intergenic
1161412941 19:4126954-4126976 TAGGCAAAACAGAAGGAACATGG - Intergenic
1162523498 19:11194941-11194963 CTGGCCACACGGAAGGATGGGGG + Intronic
1163152272 19:15422525-15422547 CAGGCCCCACAGAGGGAGCGTGG + Exonic
1167705693 19:51079684-51079706 CAGGGCAACCTGAAGGATCCTGG + Exonic
927096685 2:19752616-19752638 AAGGCCAGACAGAAGAATCAGGG - Intergenic
928096533 2:28408409-28408431 CAGGCCAGAGAGAAGGAGCTGGG - Intronic
929995897 2:46826019-46826041 CAGACCACACAGAGGGATTGCGG + Intronic
935070175 2:99687140-99687162 CAGAACAAAGAGAAGGATCTAGG + Intronic
937998868 2:127716100-127716122 GAGGCTATACAGAAGGAACGTGG - Intronic
938054962 2:128208082-128208104 CAGGCCGCACAGCAGGAGCGGGG - Intergenic
1174308333 20:49631196-49631218 AAAACCAAACAGAAGGAACGAGG - Intergenic
1174502312 20:50994552-50994574 TGGGACAAACAGAAGGAACGTGG - Intergenic
1175470798 20:59226091-59226113 CTGGCCAAGTAGAAGGTTCGGGG - Intronic
1175746803 20:61462700-61462722 CAGGCCAATGACAAGGATGGAGG - Intronic
1182213184 22:28693564-28693586 CAGGCCAAACAGGAGACTCGGGG + Intronic
950617175 3:14169883-14169905 CAGGCCAGACAGAAGGAATCAGG + Intronic
952463177 3:33551340-33551362 CTGGCCAAACAGATGGATCCAGG - Exonic
953436559 3:42881875-42881897 CAGGAAAAACAGAAGGAACCTGG - Intronic
953916402 3:46923559-46923581 CAGGACACACAGAAGCAGCGAGG + Intronic
954082663 3:48221699-48221721 CAGGCCAAACAGAAGGATCGGGG + Intergenic
954652435 3:52173353-52173375 GAGGCAAAACAGAAGGATGCAGG + Intergenic
956458189 3:69444202-69444224 CTGGCCAAGCAGAAGGATTGGGG - Intronic
960169968 3:114448452-114448474 GAGGGCAAACAGATGGATCAAGG + Intronic
963744536 3:149113078-149113100 CAGGCAAAACAAAATGATCTTGG - Intergenic
964027132 3:152088161-152088183 CAGGAAAAACAGCAGGATGGGGG + Intergenic
967764349 3:193261955-193261977 GAGGACAGACAGAAGGATAGTGG + Intronic
969461308 4:7330562-7330584 CATGCCAAGCAGAAGGAGCCAGG - Intronic
979184407 4:117770746-117770768 CAGGCCCCACAGAAGCATCAAGG - Intergenic
991034496 5:62114593-62114615 GAGGCTAAACAGAAGGAATGTGG - Intergenic
992598995 5:78377458-78377480 CAGGCCCAACAGAAGCAACTCGG - Intronic
994691908 5:103030130-103030152 GAGGCCAAGCAGAAGGATTGTGG + Intronic
995741416 5:115359577-115359599 CAGGACAACTTGAAGGATCGGGG - Intergenic
995834885 5:116390183-116390205 GAGGCCCAACAGAAAGATAGTGG - Intronic
995964079 5:117882961-117882983 AAGACCAAACAGAAGGATCATGG - Intergenic
997625412 5:135327608-135327630 CAGGCCACACAGCAGGAACCTGG - Intronic
998691808 5:144595596-144595618 CAGGCCAATCAGCAGGATGTGGG + Intergenic
1003042130 6:2698157-2698179 CAGGCCAGATAGAAGAATGGAGG + Intronic
1005369087 6:25111527-25111549 AAGGTCAGACAGAAGGGTCGGGG + Intergenic
1005997501 6:30940308-30940330 CAGGCCACCCAGAAGGACCGAGG - Intergenic
1007229239 6:40336868-40336890 CAGAGCAACCAGAAGGATGGGGG + Intergenic
1012358923 6:98351942-98351964 AAGGCCAACCAGAAGGAACTGGG + Intergenic
1012556643 6:100521687-100521709 CAGGCCAAACTGGAGGATGTGGG + Intronic
1012937246 6:105380805-105380827 CATGCAAATCAGAAGGATCAGGG - Intronic
1015255832 6:131178729-131178751 CAGGTCAAACAGAAGGAGATAGG - Intronic
1015383023 6:132591399-132591421 CAGGTCAAAAAGAAGGAAGGAGG + Intergenic
1015526090 6:134176160-134176182 CAGGCCCCACAGAGGAATCGAGG - Intronic
1018004999 6:159613495-159613517 CAGGACAAACCAAAGGATGGAGG + Intergenic
1027542697 7:79487925-79487947 CATGACAAACAGATGGATGGAGG - Intergenic
1032782884 7:135178248-135178270 CAGTTCAAACAGTAGGATCATGG + Intergenic
1034405865 7:150902105-150902127 CAGGACACACAGAAGGAAGGAGG + Intergenic
1035014735 7:155755285-155755307 CAGGACACACAGAAGGACAGGGG - Intronic
1035522282 8:284473-284495 CAGCCCAGACAGAAGGATGAGGG - Intergenic
1035749336 8:1984860-1984882 AAGGCCAAACAGCAGCAACGTGG - Intronic
1041628837 8:60062034-60062056 CAGGCCTAAGAGAAGGTTTGTGG - Intergenic
1044964697 8:97563589-97563611 CAGGCCAAGGAGTAGGATCAGGG - Intergenic
1045062490 8:98421971-98421993 CAGGCCAGACTGGAGGATCTGGG + Intronic
1048498709 8:134956920-134956942 CAGGGCAAACAGAAGGGAGGTGG + Intergenic
1049867214 8:144946828-144946850 CAGGCCCAACAGCAGGATACAGG - Intronic
1049867258 8:144947011-144947033 CAGGCCCAACAGCAGGATACAGG - Intronic
1050062449 9:1724133-1724155 CAGGGCAAACAGAGGTATCAGGG - Intergenic
1050623027 9:7474417-7474439 CCAGCAAAACAGAAGGATGGGGG + Intergenic
1052784191 9:32813620-32813642 CAGGCCAAACAGAAGGCGCTAGG - Intergenic
1056450951 9:86716294-86716316 CAGGACTAACAGAATGATGGGGG - Intergenic
1057412028 9:94825288-94825310 CAGGCAAAACAGCAGGATGCGGG - Intronic
1058763534 9:108159864-108159886 AACGCCAAATAGAAGGATCCTGG + Intergenic
1059136081 9:111807805-111807827 CAGGCCAAAGAGACAGATCAAGG - Intergenic
1059547854 9:115196835-115196857 CAGGCCACACAGAGTGATGGAGG - Intronic
1060375145 9:123110485-123110507 CAGGCCAGACAGATGGGTCCAGG + Intronic
1186383261 X:9083565-9083587 TAGTCCACACAGAAGGATTGAGG - Intronic
1192627167 X:72741943-72741965 AAGGCCAAAAAGAAGGAAAGGGG - Intergenic
1192654541 X:72978870-72978892 AAGGCCAAAAAGAAGGAAAGGGG + Intergenic
1199728835 X:150610610-150610632 CAGGCCAAACTGCAAGATCCAGG - Intronic