ID: 954085538

View in Genome Browser
Species Human (GRCh38)
Location 3:48241260-48241282
Sequence CGCAGGCGCCGCGCAGGCGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 135}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954085527_954085538 11 Left 954085527 3:48241226-48241248 CCGCGAGATCGCCTCCCCCATTC 0: 1
1: 0
2: 1
3: 3
4: 52
Right 954085538 3:48241260-48241282 CGCAGGCGCCGCGCAGGCGTCGG 0: 1
1: 0
2: 1
3: 9
4: 135
954085531_954085538 -4 Left 954085531 3:48241241-48241263 CCCCATTCGGTGCTCCAGCCGCA 0: 1
1: 0
2: 3
3: 3
4: 88
Right 954085538 3:48241260-48241282 CGCAGGCGCCGCGCAGGCGTCGG 0: 1
1: 0
2: 1
3: 9
4: 135
954085532_954085538 -5 Left 954085532 3:48241242-48241264 CCCATTCGGTGCTCCAGCCGCAG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 954085538 3:48241260-48241282 CGCAGGCGCCGCGCAGGCGTCGG 0: 1
1: 0
2: 1
3: 9
4: 135
954085533_954085538 -6 Left 954085533 3:48241243-48241265 CCATTCGGTGCTCCAGCCGCAGG 0: 1
1: 0
2: 0
3: 11
4: 102
Right 954085538 3:48241260-48241282 CGCAGGCGCCGCGCAGGCGTCGG 0: 1
1: 0
2: 1
3: 9
4: 135
954085529_954085538 0 Left 954085529 3:48241237-48241259 CCTCCCCCATTCGGTGCTCCAGC 0: 1
1: 0
2: 1
3: 14
4: 174
Right 954085538 3:48241260-48241282 CGCAGGCGCCGCGCAGGCGTCGG 0: 1
1: 0
2: 1
3: 9
4: 135
954085530_954085538 -3 Left 954085530 3:48241240-48241262 CCCCCATTCGGTGCTCCAGCCGC 0: 1
1: 0
2: 0
3: 7
4: 83
Right 954085538 3:48241260-48241282 CGCAGGCGCCGCGCAGGCGTCGG 0: 1
1: 0
2: 1
3: 9
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954085538 Original CRISPR CGCAGGCGCCGCGCAGGCGT CGG Intronic
900119196 1:1041333-1041355 CGCAGGCGCGGCGCAGGAGCTGG - Exonic
901064456 1:6488345-6488367 CTCAGGCACAGGGCAGGCGTGGG + Intronic
907053467 1:51344973-51344995 CGCAGGTACCGGGCAGGGGTGGG - Exonic
911348122 1:96721616-96721638 CGAAGGCGCGGAGGAGGCGTCGG + Intergenic
914393561 1:147243007-147243029 CCCGCGCGCCGCGCAGGCGGGGG - Intronic
922851288 1:228735774-228735796 CGGAGGCGCCTCGCAGCGGTCGG - Exonic
1063443033 10:6088997-6089019 CGCAGGCGGGGCGCAGGCGCGGG + Intronic
1064030768 10:11881204-11881226 CTCAGGCGCAGCACAGGCATGGG + Intergenic
1067091156 10:43266510-43266532 CGCACGCGGCGGGCGGGCGTGGG - Intronic
1067474397 10:46556507-46556529 CGCCGGGGCCGCGCAGGCGGGGG + Intergenic
1072562308 10:96587149-96587171 GGCAGCCGGCGCGCAGGCGGCGG - Intronic
1073099600 10:100999784-100999806 CGGGGGCGCCGCGGAGGCGGAGG + Exonic
1076372365 10:129963862-129963884 CGCAGGCGCCGAGCAGGGCGAGG - Intergenic
1076600671 10:131654992-131655014 CGCAGGTGCAGGGCAGGCCTGGG + Intergenic
1076913190 10:133402499-133402521 CGCAGGTGCCAGGCAGGAGTGGG + Intronic
1083741346 11:64713096-64713118 CGGTGGCGCCGCGCAGGCCCTGG + Exonic
1083900495 11:65641065-65641087 CGCTGCCGCTGCGCAGGAGTGGG - Exonic
1084331632 11:68433774-68433796 CGCCGTCGCAGCGCAGGCGCAGG - Exonic
1085555041 11:77411965-77411987 CGAAGGCGCCGCGTCGGGGTTGG + Intronic
1091381829 12:66852-66874 CGCAGGCAGGGCGCAGGCGGCGG + Exonic
1091823169 12:3491301-3491323 CGCCGCCGCCGCGGAGGCTTCGG + Exonic
1104049558 12:125186480-125186502 CGCAGGAGCCGCGGCGGCGGCGG + Intergenic
1106340264 13:28820311-28820333 CGCAGCCGCGGCGCGGGCGTGGG + Intergenic
1107467570 13:40664893-40664915 CGCCGGCGCTCCGCAGGCGGTGG + Intronic
1107891443 13:44918093-44918115 TGCAGACTCCGCGCAGGCGCAGG - Intergenic
1110318744 13:74136188-74136210 CGCGGGCGCAGCGAGGGCGTCGG + Intergenic
1111911997 13:94323156-94323178 GGCAGGCTCCGCTCAGGGGTTGG - Intronic
1119410313 14:74426159-74426181 CGCCGCCGCCGCGCAGCCCTCGG + Intergenic
1121168827 14:91836326-91836348 CGCCGGCCCAGCGCGGGCGTGGG - Intronic
1122905778 14:104800829-104800851 TGGAGGCGGCGCGGAGGCGTGGG + Intronic
1123024039 14:105415222-105415244 AGCAGGAGCCGCGCGGGCGGGGG + Intronic
1130522272 15:84672380-84672402 CGCAGGCACCGGGCAGGCTGAGG - Intronic
1133242808 16:4425784-4425806 CGCATGCGTCGCGCACGCGCAGG - Exonic
1135077937 16:19410509-19410531 ACCAGACGCCGCGCAGGCCTGGG - Intronic
1138016615 16:53434453-53434475 CGCAGGCGCGGTGCGGGCGGCGG + Exonic
1139520723 16:67481267-67481289 CGGAAGCGCGGTGCAGGCGTGGG + Intergenic
1140427895 16:74875900-74875922 CACAGGCTCCGCGCAGGGCTAGG - Intronic
1145041370 17:19580152-19580174 AGCGGCCGCCGCGCAGGGGTGGG + Intergenic
1146955860 17:36936117-36936139 CGGAGGCGCGGCGCCGGCGCGGG - Intergenic
1150133332 17:62680776-62680798 TGCAGGAGCAGCGCGGGCGTGGG - Intronic
1150216991 17:63476641-63476663 CGCAGGCGCCGCTCGTGCGGCGG - Intergenic
1150293981 17:63998295-63998317 GGCGGGCTCCGCGCATGCGTGGG + Intergenic
1152514788 17:80816912-80816934 CGCAGCCGCCTCGCAGGAATGGG - Intronic
1203159922 17_GL000205v2_random:39456-39478 TGCAGGCACAGGGCAGGCGTTGG - Intergenic
1156245091 18:35290260-35290282 CGCAGGCGCAGGGCGGGGGTGGG - Intergenic
1159040283 18:63318412-63318434 CGCAGGCCCCGCGGCGGCGCCGG + Exonic
1160024929 18:75209227-75209249 CGCCGGCGCCGGGGAGGCGGGGG - Exonic
1160739660 19:680052-680074 CGCAGGCGCAGCGCGGACCTCGG + Intronic
1160775365 19:852871-852893 CCCAGGCACCGCGCTGGCCTCGG + Exonic
1160790402 19:920310-920332 CGCAGGCGCCGTGCGGGCCAAGG + Exonic
1160875755 19:1295540-1295562 CGCAGGTTCCACGCAGGCGCGGG + Exonic
1161445754 19:4318325-4318347 CGCTGGGGCCGGGCAGACGTGGG - Exonic
1161615633 19:5268686-5268708 CCCAGGCGCAGCGCAGGCAACGG + Intronic
1161864356 19:6822530-6822552 CGCATGCGCCCGGCAGGCGCTGG - Intronic
1162470889 19:10871552-10871574 CGCAGCCGCCGTGCAGGCCGAGG - Exonic
1162591976 19:11597804-11597826 CGCAGGCGTCGCGCAGGGACGGG - Intronic
1162630806 19:11925470-11925492 CGCAGTCGCCGCGCAGGGACGGG - Intronic
1162646258 19:12052579-12052601 CGCAGTCGCCGCGCAGGGACCGG + Intronic
1162664133 19:12195341-12195363 CGCAGGCGTCGCGCAGGAACGGG - Intergenic
1162687633 19:12400856-12400878 CGCAGTCGCCGCGCAGGAACGGG + Intronic
1162691955 19:12440700-12440722 CGCAGTCGCCGCGCAGGAACGGG + Intronic
1162705330 19:12551112-12551134 CGCAGTCGCCGCGCAGGGACGGG + Intronic
1162713180 19:12611203-12611225 CGCAGTCGCCGCGCAGGGACGGG - Intronic
1165311332 19:35030803-35030825 AGCACGCGCCGCGCAGCCATGGG + Exonic
1165854226 19:38870243-38870265 CGCAGGCCCCGCGCTGGAGACGG - Exonic
1166539567 19:43596187-43596209 CGCAGGCGCGGCGAAGGGCTGGG - Intergenic
1168235874 19:55062899-55062921 CGCAGGGGCCGGGAAGGCGGCGG - Intronic
1168409109 19:56127517-56127539 CACAGGGGCCGGGCAGGGGTGGG + Intergenic
927054923 2:19358731-19358753 CGCAGGCGCAGGGCAGGGTTGGG - Intergenic
932330563 2:70896300-70896322 CTCCGGCGGTGCGCAGGCGTCGG - Intergenic
944933620 2:204545492-204545514 CGCGGGCGCCGCAGAGGAGTTGG + Intergenic
948402291 2:237692608-237692630 CGCAGGTGCCCGGGAGGCGTGGG + Intronic
1169801490 20:9516161-9516183 CGCAGGCTCCGCGTGGGTGTGGG + Intronic
1172474524 20:35226876-35226898 CCCGGGCGCCGCGCGGGCGGCGG + Exonic
1173243430 20:41317597-41317619 CGCAGGCCCCGCAGAGGCGGCGG + Intronic
1175784875 20:61706132-61706154 AGCAGGCGCCGGGCAGGCGTCGG - Intronic
1175911443 20:62407157-62407179 CGCAGGCGCTGCGGAGGCGCGGG - Exonic
1176177926 20:63737434-63737456 CGCAGGAGCCCCGCAGCCGCGGG + Intronic
1176283372 20:64327981-64328003 CGCAGGCAGGGCGCAGGCGGCGG - Intergenic
1178513838 21:33229910-33229932 CGCGGGCGCCGCGCCGCCGCCGG - Intronic
1182532131 22:30968873-30968895 CGCGGGCGGCGCGCGGGCGGCGG - Intergenic
1183294086 22:37019636-37019658 CGCGGGGGCCGCGCGGGCCTGGG + Intronic
1183351138 22:37335293-37335315 CGGAGGCGCGGGGCCGGCGTAGG - Intergenic
1184796821 22:46737859-46737881 CGCAGGCGCCAGGGAGGGGTCGG - Intronic
949089615 3:11741-11763 CGCAGGCGCAGCGCCGGCGCAGG + Intergenic
949896011 3:8768125-8768147 CGGCGGCGCGGCGCTGGCGTTGG + Exonic
950742248 3:15061329-15061351 CGCAGGCGCTGGGCAGGCTGAGG - Intronic
954085538 3:48241260-48241282 CGCAGGCGCCGCGCAGGCGTCGG + Intronic
954633160 3:52057618-52057640 CGCAGGCGGCGCGCTTGCGTAGG + Intergenic
962071199 3:132035121-132035143 CTCAGGCCCCGCCCAGGCCTTGG + Exonic
964451511 3:156817062-156817084 CGCAGGCGGCGCGGCGGCCTGGG + Intergenic
968562194 4:1289988-1290010 CGCCTGCGCCGCGCAGGCTGAGG + Intronic
969239064 4:5887860-5887882 CGCAGGCCTCGCGCGGGGGTGGG - Intronic
972552783 4:40148333-40148355 CGCAGGCACTGGGCAGGCGGAGG + Intronic
985467604 5:12460-12482 CAAAGGCGCCGCGCCGGCGCAGG + Intergenic
986320969 5:6632806-6632828 CGCCGCCGCCTCGCAGGCCTCGG + Intronic
990176067 5:53109824-53109846 CGCATGCTCCGTGCAGGCGCAGG - Intronic
1002047312 5:176549364-176549386 GGCAGGCGCCGGACAGGCGCTGG - Intronic
1002211152 5:177600131-177600153 CGGAGGCGCCGCGTAGGCCCGGG + Exonic
1002524364 5:179807031-179807053 CGCCGGCGCCGCGAGGGGGTGGG + Intronic
1003459919 6:6320151-6320173 GGCAGGCGATGCGCAGGAGTGGG + Intronic
1011075170 6:83430997-83431019 CGCACGCGCGGTGCAGGCGGCGG + Exonic
1013366373 6:109440995-109441017 CGCAGGCGGCGCGCACAGGTGGG - Exonic
1019111980 6:169724132-169724154 CGCGGGCGGCGCGCTGGCGACGG - Intronic
1019200006 6:170306598-170306620 CGGACGCGGCGCGCAGGCGCCGG - Intronic
1021313186 7:19117176-19117198 AGCAGGCGCAGCGCGGGCGGCGG - Exonic
1022096271 7:27143362-27143384 GGCGGGCGCCGCGCTGGCGCTGG + Exonic
1023220424 7:37916213-37916235 CGCAGTCGTCGCGCGCGCGTTGG + Exonic
1025004728 7:55344904-55344926 CGCAGGCGCCGCGCCCCCGCGGG - Intergenic
1030739062 7:113086560-113086582 CGCAGGGGCCGCGGCGGCGGCGG + Intronic
1034219414 7:149432465-149432487 CGCAGCCTCCGCGCACGCGGTGG + Exonic
1034578875 7:152025740-152025762 GCCAGGCGTCGCGCAGGCGCTGG - Intronic
1035153389 7:156893191-156893213 GGCGGGCGCCGCGCAGTCGGGGG + Exonic
1035167311 7:156999721-156999743 CGGGGGCGCCGCTCAGGCCTGGG - Intronic
1035553012 8:544649-544671 CGCCGCCGCCGCCCAGGCGCAGG - Exonic
1035751846 8:2002050-2002072 CGCGGCCGGCGCGCAGGCGGCGG - Exonic
1036786797 8:11693024-11693046 CGCAGAGGCCCCGCAGGCGCTGG - Intronic
1038544044 8:28412086-28412108 TGCAGGCGGCGCGCAGGGGTGGG - Intronic
1039620861 8:38996280-38996302 CGCTGGCGCCGCCCAGCCGGAGG - Exonic
1046848944 8:118951752-118951774 CCCAGGCGCCGGGCACCCGTCGG + Intronic
1048981194 8:139703989-139704011 CGCATGAGCCGCGCGGGGGTCGG + Intergenic
1049548570 8:143246223-143246245 CGTGGGCGCCGCGGAGGCGGGGG + Intergenic
1052970040 9:34371791-34371813 AGCCGGCGTCGCGCAGGCGGCGG + Exonic
1057432242 9:95004969-95004991 CTCAGGCGCGGCGCGGGCGGCGG - Intronic
1061000444 9:127899477-127899499 AGCAGGCGCCGCGCGGGAGCAGG - Intronic
1062341052 9:136094231-136094253 CGGAGGCCCCGCGCGGGGGTTGG + Intronic
1185447747 X:268334-268356 TGCAGGCCCCGCCCAGGCGGAGG - Intergenic
1185447764 X:268389-268411 TGCAGGCCCCGCCCAGGCGGAGG - Intergenic
1185447797 X:268499-268521 TGCAGGCCCCGCCCAGGCGGAGG - Intergenic
1185447813 X:268554-268576 TGCAGGCCCCGCCCAGGCGGAGG - Intergenic
1185447861 X:268719-268741 TGCAGGCCCCGCCCAGGCGGAGG - Intergenic
1185447956 X:269049-269071 TGCAGGCCCCGCCCAGGCGGAGG - Intergenic
1185447973 X:269104-269126 TGCAGGCCCCGCCCAGGCGGAGG - Intergenic
1185447989 X:269159-269181 TGCAGGCCCCGCCCAGGCGGAGG - Intergenic
1185448021 X:269269-269291 TGCAGGCCCCGCCCAGGCGGAGG - Intergenic
1185448037 X:269324-269346 TGCAGGCCCCGCCCAGGCGGAGG - Intergenic
1185448054 X:269379-269401 TGCAGGCCCCGCCCAGGCGGAGG - Intergenic
1185448152 X:269709-269731 TGCAGGCCCCGCCCAGGCGGAGG - Intergenic
1185448219 X:269929-269951 TGCAGGCCCCGCCCAGGCGGAGG - Intergenic
1185448252 X:270039-270061 TGCAGGCCCCGCCCAGGCGGAGG - Intergenic
1185448300 X:270204-270226 TGCAGGCCCCGCCCAGGCGGAGG - Intergenic
1185448375 X:270479-270501 TGCAGGCCCCGCCCAGGCGGAGG - Intergenic
1185448423 X:270644-270666 TGCAGGCCCCGCCCAGGCGGAGG - Intergenic
1190542990 X:51496944-51496966 CGCAGGCGCCCCGCACCCCTGGG + Intergenic
1192699119 X:73448552-73448574 AGCAGGCGTCTCTCAGGCGTGGG + Intronic
1200249751 X:154546755-154546777 GGCGGGCGCCGCGCAGGCGGAGG - Intronic