ID: 954085538

View in Genome Browser
Species Human (GRCh38)
Location 3:48241260-48241282
Sequence CGCAGGCGCCGCGCAGGCGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 135}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954085529_954085538 0 Left 954085529 3:48241237-48241259 CCTCCCCCATTCGGTGCTCCAGC 0: 1
1: 0
2: 1
3: 14
4: 174
Right 954085538 3:48241260-48241282 CGCAGGCGCCGCGCAGGCGTCGG 0: 1
1: 0
2: 1
3: 9
4: 135
954085531_954085538 -4 Left 954085531 3:48241241-48241263 CCCCATTCGGTGCTCCAGCCGCA 0: 1
1: 0
2: 3
3: 3
4: 88
Right 954085538 3:48241260-48241282 CGCAGGCGCCGCGCAGGCGTCGG 0: 1
1: 0
2: 1
3: 9
4: 135
954085527_954085538 11 Left 954085527 3:48241226-48241248 CCGCGAGATCGCCTCCCCCATTC 0: 1
1: 0
2: 1
3: 3
4: 52
Right 954085538 3:48241260-48241282 CGCAGGCGCCGCGCAGGCGTCGG 0: 1
1: 0
2: 1
3: 9
4: 135
954085532_954085538 -5 Left 954085532 3:48241242-48241264 CCCATTCGGTGCTCCAGCCGCAG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 954085538 3:48241260-48241282 CGCAGGCGCCGCGCAGGCGTCGG 0: 1
1: 0
2: 1
3: 9
4: 135
954085533_954085538 -6 Left 954085533 3:48241243-48241265 CCATTCGGTGCTCCAGCCGCAGG 0: 1
1: 0
2: 0
3: 11
4: 102
Right 954085538 3:48241260-48241282 CGCAGGCGCCGCGCAGGCGTCGG 0: 1
1: 0
2: 1
3: 9
4: 135
954085530_954085538 -3 Left 954085530 3:48241240-48241262 CCCCCATTCGGTGCTCCAGCCGC 0: 1
1: 0
2: 0
3: 7
4: 83
Right 954085538 3:48241260-48241282 CGCAGGCGCCGCGCAGGCGTCGG 0: 1
1: 0
2: 1
3: 9
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954085538 Original CRISPR CGCAGGCGCCGCGCAGGCGT CGG Intronic