ID: 954087428

View in Genome Browser
Species Human (GRCh38)
Location 3:48256408-48256430
Sequence AACAGGGCGTTCATGGCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 98}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954087428_954087446 30 Left 954087428 3:48256408-48256430 CCCAAGGCCATGAACGCCCTGTT 0: 1
1: 0
2: 0
3: 3
4: 98
Right 954087446 3:48256461-48256483 TGAGGGTGCGGGGACCCCAGTGG 0: 1
1: 0
2: 1
3: 22
4: 240
954087428_954087444 19 Left 954087428 3:48256408-48256430 CCCAAGGCCATGAACGCCCTGTT 0: 1
1: 0
2: 0
3: 3
4: 98
Right 954087444 3:48256450-48256472 GTAGATGGGCATGAGGGTGCGGG 0: 1
1: 0
2: 1
3: 32
4: 397
954087428_954087441 12 Left 954087428 3:48256408-48256430 CCCAAGGCCATGAACGCCCTGTT 0: 1
1: 0
2: 0
3: 3
4: 98
Right 954087441 3:48256443-48256465 TTTTTTTGTAGATGGGCATGAGG 0: 1
1: 0
2: 1
3: 41
4: 752
954087428_954087442 13 Left 954087428 3:48256408-48256430 CCCAAGGCCATGAACGCCCTGTT 0: 1
1: 0
2: 0
3: 3
4: 98
Right 954087442 3:48256444-48256466 TTTTTTGTAGATGGGCATGAGGG 0: 1
1: 1
2: 0
3: 51
4: 500
954087428_954087445 20 Left 954087428 3:48256408-48256430 CCCAAGGCCATGAACGCCCTGTT 0: 1
1: 0
2: 0
3: 3
4: 98
Right 954087445 3:48256451-48256473 TAGATGGGCATGAGGGTGCGGGG 0: 1
1: 0
2: 1
3: 38
4: 314
954087428_954087439 5 Left 954087428 3:48256408-48256430 CCCAAGGCCATGAACGCCCTGTT 0: 1
1: 0
2: 0
3: 3
4: 98
Right 954087439 3:48256436-48256458 GGAGGCCTTTTTTTGTAGATGGG 0: 1
1: 0
2: 0
3: 12
4: 159
954087428_954087443 18 Left 954087428 3:48256408-48256430 CCCAAGGCCATGAACGCCCTGTT 0: 1
1: 0
2: 0
3: 3
4: 98
Right 954087443 3:48256449-48256471 TGTAGATGGGCATGAGGGTGCGG 0: 1
1: 0
2: 7
3: 49
4: 453
954087428_954087438 4 Left 954087428 3:48256408-48256430 CCCAAGGCCATGAACGCCCTGTT 0: 1
1: 0
2: 0
3: 3
4: 98
Right 954087438 3:48256435-48256457 GGGAGGCCTTTTTTTGTAGATGG 0: 1
1: 0
2: 0
3: 13
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954087428 Original CRISPR AACAGGGCGTTCATGGCCTT GGG (reversed) Intronic
900546279 1:3231015-3231037 AAGAGGGCACTCATGTCCTTGGG - Intronic
902300988 1:15502613-15502635 AGCAGGGCTTCCAAGGCCTTTGG - Intronic
902610183 1:17592587-17592609 AACAGGGCGCTGGTGGCCTGTGG + Intronic
909235873 1:73152371-73152393 AAGTGGGCTTCCATGGCCTTGGG + Intergenic
912759891 1:112357623-112357645 AACAGCCCCTTCAGGGCCTTGGG + Intergenic
918854864 1:189738946-189738968 AACACGGCCTTCAAGGCCATAGG - Intergenic
924158844 1:241209200-241209222 AACAGTGCTTTGATGGCCTGGGG + Intronic
1070830251 10:79413651-79413673 AACCGGGAGTTCAGGGCCCTGGG + Intronic
1070870139 10:79744202-79744224 AACTGGGCGCCCATAGCCTTGGG - Intergenic
1071637060 10:87266422-87266444 AACTGGGCGCCCATAGCCTTGGG - Intergenic
1071658184 10:87471532-87471554 AACTGGGCGCCCATAGCCTTGGG + Intergenic
1074762352 10:116676434-116676456 AAAAGGGCGTTCATGGCATCTGG + Exonic
1076776053 10:132698979-132699001 GACACGGCGTCCTTGGCCTTGGG - Intronic
1083511542 11:63213424-63213446 TACTGGACCTTCATGGCCTTAGG + Intronic
1084204943 11:67585762-67585784 ACCAGTGGGTTCAAGGCCTTCGG - Intronic
1085801187 11:79591276-79591298 AACAGGGCTTTCACAGCCTCTGG - Intergenic
1086833187 11:91591722-91591744 AACAGAGCCTTCAAAGCCTTTGG - Intergenic
1089314425 11:117581811-117581833 AGAAGGGCGTGCATGGACTTTGG - Intronic
1091450399 12:569165-569187 CACACGGCGTTCAGGGCCTTTGG + Intronic
1104057456 12:125241470-125241492 AACAGGGGGTCCAGGGCCTGGGG - Intronic
1113769359 13:112898550-112898572 AGCAGGGCCTGCATGGCCGTGGG - Intronic
1115309659 14:31966392-31966414 AGCAGTGCCCTCATGGCCTTGGG + Intergenic
1123552599 15:21397619-21397641 AGCAGGGTGTTCACTGCCTTTGG - Intergenic
1123588845 15:21835007-21835029 AGCAGGGTGTTCACTGCCTTTGG - Intergenic
1126084203 15:44995999-44996021 AAGAGTGAGTTCATGTCCTTTGG + Intergenic
1202960948 15_KI270727v1_random:124839-124861 AGCAGGGTGTTCACTGCCTTTGG - Intergenic
1136644164 16:31595249-31595271 CCCATGGCGTTCATGGGCTTTGG - Intergenic
1143939644 17:10526779-10526801 GCCAGGGCGTTCTTGGCCTATGG + Exonic
1144265205 17:13562141-13562163 GACAGGGTGGTCATGGCCATGGG - Intronic
1148106734 17:45122871-45122893 AACGGAGAGTCCATGGCCTTTGG + Intronic
1152392124 17:80009386-80009408 ACGAGGGCCCTCATGGCCTTGGG - Intronic
1154453512 18:14501019-14501041 AGCAGGGTGTTCACTGCCTTTGG - Intergenic
1154454033 18:14504210-14504232 AGCAGGGTGTACATTGCCTTTGG - Intergenic
1155507104 18:26545165-26545187 ATTAAGGCGTGCATGGCCTTGGG - Intronic
1156688988 18:39683759-39683781 AACAGGGTTTTCATTGCCTATGG + Intergenic
1156693359 18:39735536-39735558 GTTAGGGCTTTCATGGCCTTGGG + Intergenic
1161952884 19:7477489-7477511 CACAGGGCATTCAGGGGCTTGGG - Intronic
1161999657 19:7735240-7735262 ACCAGAGTGGTCATGGCCTTGGG - Intergenic
1162439140 19:10682010-10682032 ATCAGGGCATTCATAGCCTGGGG - Exonic
1166801563 19:45460862-45460884 AGCAGGTCGTTCAGGGCCTCAGG + Intronic
1167292400 19:48631367-48631389 AACAAGGCCTTCATGGTCTGAGG + Intronic
1167503603 19:49860405-49860427 AGCAGGGCGACCTTGGCCTTGGG + Exonic
1167810054 19:51821801-51821823 CAGAGGGAATTCATGGCCTTGGG - Intronic
939980011 2:148768657-148768679 AACCTGGCCTTTATGGCCTTTGG + Intronic
941849451 2:170164672-170164694 AGCAGGGCTTTCCTGGCTTTGGG + Intergenic
941934877 2:170974502-170974524 AGCATGGCATTCAAGGCCTTCGG - Intergenic
943004687 2:182375497-182375519 AGGTGGGCTTTCATGGCCTTGGG + Intronic
1172207793 20:33176723-33176745 AACAGAGCCTTCATGACCATGGG - Intronic
1176820140 21:13649086-13649108 AGCAGGGTGTACATTGCCTTTGG + Intergenic
1176820670 21:13652286-13652308 AGCAGGGTGTTCACTGCCTTTGG + Intergenic
1182326834 22:29519616-29519638 AAAAGGCCTGTCATGGCCTTTGG - Intronic
952197081 3:31087020-31087042 AACATGGTGTTCATGTACTTAGG + Intergenic
953136173 3:40183560-40183582 CACAGGGGCTTCATGGCCCTCGG - Intronic
954087428 3:48256408-48256430 AACAGGGCGTTCATGGCCTTGGG - Intronic
955095098 3:55789273-55789295 AACACGGCATCCATGGCCCTAGG - Intronic
955930994 3:64056769-64056791 AACAGGGAGCTCAGGGCCATGGG - Intergenic
957857334 3:85895196-85895218 AAGTGGGCTTCCATGGCCTTAGG - Intronic
962259302 3:133893003-133893025 AACAGGCTTTTCAGGGCCTTGGG + Intronic
966910478 3:184556951-184556973 AACAGGGCATTAATTGGCTTTGG + Intronic
967519805 3:190416381-190416403 AACTGGGCTCCCATGGCCTTGGG + Intergenic
969620773 4:8277724-8277746 AGCAGGGCATTCAAGGCCTGGGG - Intronic
977426002 4:96867888-96867910 TCCAGGGCTTTTATGGCCTTAGG - Intergenic
979050759 4:115928701-115928723 AACAGAGCTTTAATGGCTTTAGG - Intergenic
980579671 4:134732928-134732950 AGGTGGGCTTTCATGGCCTTGGG - Intergenic
984872978 4:184343735-184343757 AGCAGGGCGTTCCTGGGCTCTGG - Intergenic
985965064 5:3333256-3333278 AGCAGGACGTGCATGGTCTTTGG - Intergenic
997596981 5:135113565-135113587 AACAGGGCGAGCAAGGTCTTGGG - Intronic
998261249 5:140633403-140633425 AACAGGGCATTCACCGCCTGGGG - Exonic
1000557791 5:162748265-162748287 AACAGGACTTTTATAGCCTTGGG - Intergenic
1005205834 6:23403539-23403561 AACAGAACGTTCAAAGCCTTAGG + Intergenic
1007029455 6:38615003-38615025 AACTGGGCCTTCAAGGCCTGTGG + Intronic
1007632102 6:43278179-43278201 AACTGGGCTCTCATGCCCTTGGG - Intronic
1012493413 6:99808298-99808320 AACATGGATTTCATGTCCTTTGG - Intergenic
1018969846 6:168519521-168519543 AACAGGAGATTCAGGGCCTTCGG + Intronic
1029597317 7:101544835-101544857 AACAGGGTCTTCAGGGGCTTCGG + Intronic
1029655652 7:101922733-101922755 GACAGGGTGTGCCTGGCCTTGGG + Intronic
1035028505 7:155842740-155842762 AAGAGGGAGTTCAGGGCCTCAGG + Intergenic
1035426523 7:158779860-158779882 AACAAGGGGTTCTTGGCCCTGGG + Intronic
1036760635 8:11506443-11506465 ATGAGGGCGTTCCTGGCCTCTGG + Intronic
1039610386 8:38914549-38914571 CAGAGGGCCTTCATGGGCTTGGG + Intronic
1044378454 8:91503821-91503843 AACTGGTCATTCATGTCCTTCGG - Intergenic
1044729635 8:95219555-95219577 AACAGTGGGTTCCAGGCCTTAGG - Intergenic
1050684103 9:8147646-8147668 AACAGGGCCATCTTGGCCTGTGG + Intergenic
1051102924 9:13542808-13542830 AGTAGGGCCTTCATGGCCCTAGG - Intergenic
1051267596 9:15323692-15323714 AAGTGGGCTCTCATGGCCTTGGG - Intergenic
1056803498 9:89710672-89710694 AACATGGCGTGCATGGCCCAGGG - Intergenic
1203526686 Un_GL000213v1:97279-97301 AGCAGGGTGTTCACTGCCTTTGG - Intergenic
1203527220 Un_GL000213v1:100465-100487 AGCAGGGTGTACATTGCCTTTGG - Intergenic
1187268503 X:17759247-17759269 AACAGGGATTTTATGGACTTCGG - Intergenic
1187392962 X:18897606-18897628 AACAGGGCGAGCACGGGCTTGGG + Intronic
1188003930 X:25004925-25004947 AACAGCGCGGTCATGGCCTCGGG + Intronic
1190105676 X:47559547-47559569 AACAGGCCATTCATGGTGTTGGG + Intergenic
1193455804 X:81730002-81730024 AAGTGGGCTCTCATGGCCTTGGG - Intergenic
1200684772 Y:6248270-6248292 TCCAGGACGTTCATGGCATTGGG + Intronic
1200990302 Y:9339535-9339557 TCCAGGACGTTCATGGCATTGGG + Intronic
1200992963 Y:9359850-9359872 TCCAGGACGTTCATGGCATTGGG + Intronic
1200995617 Y:9380128-9380150 TCCAGGACGTTCATGGCATTGGG + Intronic
1200998282 Y:9400474-9400496 TCCAGGACGTTCATGGCATTGGG + Intronic
1201000790 Y:9469006-9469028 TCCAGGACGTTCATGGCATTGGG + Intronic
1201003458 Y:9489338-9489360 TCCAGGACGTTCATGGCATTGGG + Intronic
1201006114 Y:9509620-9509642 TCCAGGACGTTCATGGCATTGGG + Intergenic
1201008772 Y:9529933-9529955 TCCAGGACGTTCATGGCATTGGG + Intronic