ID: 954087787

View in Genome Browser
Species Human (GRCh38)
Location 3:48259595-48259617
Sequence CAGGGTAATCAGAGGCAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 177}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954087781_954087787 19 Left 954087781 3:48259553-48259575 CCTGAGAATAGGAGGAAGAAGCT 0: 1
1: 0
2: 2
3: 29
4: 333
Right 954087787 3:48259595-48259617 CAGGGTAATCAGAGGCAGCTGGG 0: 1
1: 0
2: 1
3: 17
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954087787 Original CRISPR CAGGGTAATCAGAGGCAGCT GGG Intronic
900285709 1:1899360-1899382 CAGGGGGAGCAGAGGCTGCTGGG + Intergenic
902232397 1:15036302-15036324 CAGGCTAGGCAGAGGGAGCTGGG - Intronic
903183261 1:21615685-21615707 GAGGGTCAGAAGAGGCAGCTGGG - Intronic
903967874 1:27101293-27101315 CGGGGTGAGCACAGGCAGCTGGG + Intronic
904833931 1:33322898-33322920 GAGGGGAAAAAGAGGCAGCTTGG - Intergenic
907550178 1:55298536-55298558 CAGAGTAAGCAGGGGCAGATGGG + Intergenic
908450814 1:64252602-64252624 CAGGAAAAGCAGAGGCAACTAGG + Intronic
916344764 1:163775336-163775358 CACGGGAGTCAGAGGGAGCTGGG + Intergenic
918109134 1:181440545-181440567 CAGGGTAGGCAGAGGCAGAAAGG + Intronic
920436547 1:205950513-205950535 CAGGGAGCTCAGAGGCAGCAGGG + Intergenic
924170343 1:241332915-241332937 CAGGGAAAACAAAGGCTGCTGGG - Intronic
924703959 1:246482898-246482920 CTGGGGAATCAGAGGCTCCTTGG - Intronic
1062961984 10:1579071-1579093 CAGGGTAAACTGAGGCAGTGTGG - Intronic
1064638723 10:17394270-17394292 CAGGGTCTTCAGAGTCAGCAAGG + Intronic
1066550710 10:36553263-36553285 CAGTGTGATCAGAGGCAGGGTGG + Intergenic
1068110335 10:52672668-52672690 CAGGGTAATCACTTGAAGCTGGG + Intergenic
1068213745 10:53955343-53955365 CAGGGTAATCAGACTGAGTTAGG - Intronic
1068957000 10:62827319-62827341 CTAGGTCATCAGAGGCAGGTTGG + Intronic
1069876605 10:71566966-71566988 CAGGGTGGGAAGAGGCAGCTGGG - Intronic
1070527849 10:77310603-77310625 AAGGCTGCTCAGAGGCAGCTGGG - Intronic
1071672351 10:87620532-87620554 CTGGTTGATCAGAGGAAGCTCGG + Intergenic
1072690549 10:97570103-97570125 CAGGGCTGTCAGAGTCAGCTTGG - Intronic
1074370156 10:112894246-112894268 CACAGGAATCAGAGACAGCTAGG - Intergenic
1075518926 10:123132462-123132484 CAGGCTAATCTCAGGCAGATGGG - Intergenic
1075789171 10:125071183-125071205 GAGGGGAAACAGAGGCAGCGAGG + Intronic
1076026006 10:127114029-127114051 CAGGGCAATCACAGGCCTCTTGG - Intronic
1076484194 10:130805253-130805275 CAGGTTTATCAGAGGAAGCTAGG - Intergenic
1077549972 11:3195841-3195863 CTGGGCAGTCAGAGGCAGCCTGG + Intergenic
1077746763 11:4915436-4915458 CAGGTCAATCAGAGCCAGCATGG + Exonic
1078871228 11:15346924-15346946 CAGGTGTTTCAGAGGCAGCTGGG - Intergenic
1081296017 11:41390435-41390457 CAGGGTAGTGACAGGCAGGTGGG - Intronic
1083843247 11:65316283-65316305 CAGGGCAATCACAGAGAGCTAGG + Intronic
1086083781 11:82934002-82934024 CAGGGAAATGATAGGCAGCAAGG - Exonic
1089610092 11:119664241-119664263 CAGTGAAATCTGATGCAGCTGGG - Exonic
1090228265 11:125084471-125084493 GAGGGTCAGCAGAGGCACCTTGG + Intronic
1091305486 11:134533253-134533275 CAGGGTACACAGGGCCAGCTTGG - Intergenic
1091501115 12:1018970-1018992 CATGGAAACCAGAGACAGCTTGG + Intronic
1091882498 12:3990900-3990922 CAGGGAAAGCAGAGGCCGCCTGG + Intergenic
1097055664 12:56247757-56247779 CAGTGTGGCCAGAGGCAGCTAGG + Exonic
1097283934 12:57863401-57863423 AAGGGGAGACAGAGGCAGCTGGG - Intergenic
1116695047 14:48164289-48164311 AAGGGTAATCAGAAGAAGCCTGG - Intergenic
1117572129 14:57058026-57058048 CAGGGCACTCAGATGCAGTTGGG - Intergenic
1118266766 14:64302118-64302140 CAGGGTCATAAGAGTCACCTGGG + Intronic
1118429637 14:65703641-65703663 CAATGGAAGCAGAGGCAGCTGGG + Intronic
1119825096 14:77651151-77651173 CAGGGTACTGGGAGGCAGCGGGG - Intergenic
1122365272 14:101191442-101191464 CAGGGTCCTGAGAGTCAGCTTGG - Intergenic
1124378004 15:29140832-29140854 CAGGGCAAACAGAGCCACCTGGG - Intronic
1124801230 15:32834818-32834840 CAAGGTGATCAGAGGGAACTAGG - Intronic
1125188914 15:36966868-36966890 AAGTGTAGTCAGAGCCAGCTAGG + Intronic
1129250407 15:74305633-74305655 CAGGGAAAGGAGAGACAGCTGGG - Intronic
1130128147 15:81111660-81111682 CAGGGTGATGAGAGGCAGAGGGG - Intronic
1131703649 15:94969168-94969190 CAGGATAAGGAGAGGGAGCTGGG + Intergenic
1133576206 16:7093232-7093254 CACAGTAATCAGAGTCTGCTGGG - Intronic
1134666037 16:16019479-16019501 CAGGGTAAACAGAGTCTGGTTGG + Intronic
1135918420 16:26626304-26626326 CAGGGTACTCAGAGGCTGTTAGG + Intergenic
1136084908 16:27877815-27877837 CAGTTTATTCAAAGGCAGCTAGG + Intronic
1137925372 16:52535493-52535515 CAGGATAGCTAGAGGCAGCTTGG + Intronic
1141178412 16:81735794-81735816 CAAGGTCATCAGAGGCACTTTGG - Intergenic
1143410508 17:6705623-6705645 CAGGGGAATCTGAGGCACCAAGG + Intronic
1143620047 17:8075556-8075578 CTGGGCAATCAGGGGGAGCTGGG - Intronic
1144936162 17:18900837-18900859 CAGTGGTATCAGAGGCAGCCTGG - Intronic
1145900029 17:28484663-28484685 CAGGGTCAAGAGAGGAAGCTGGG + Intronic
1147139689 17:38454072-38454094 CAGGGCAGCCAGAGGCAGCGCGG - Intronic
1147747239 17:42702334-42702356 GAGGGGAGACAGAGGCAGCTAGG - Exonic
1147855404 17:43475925-43475947 CAGGGCAATAGGAGCCAGCTGGG + Intergenic
1151337036 17:73446090-73446112 CAGGGTAAACTGAGTCACCTAGG + Intronic
1152439384 17:80296308-80296330 CAGGGTATTCAGACCCAGCACGG - Intronic
1152464385 17:80457696-80457718 CAGGTGAGTCAGAGGCAGCTGGG - Intergenic
1153230038 18:2926434-2926456 CAGGGGGAGCAGAGGCACCTGGG + Intronic
1154355981 18:13623592-13623614 CACGATGACCAGAGGCAGCTCGG + Intronic
1156278631 18:35610281-35610303 CAGGGCAATGAGAAGCAGCCTGG - Intronic
1156361229 18:36386392-36386414 CAGGGGCCTCAGAGGCTGCTGGG + Intronic
1158243863 18:55408411-55408433 CAGGGTAATCAGAGATGGATGGG - Intronic
1158542650 18:58370692-58370714 CCGGGTAAGCAGAGGCAACTGGG - Intronic
1161094420 19:2381313-2381335 CAGGGTCAGCAGAGGCAGCTGGG + Intergenic
1162073878 19:8171751-8171773 CAGGGGAAACTGAGGCAGCCTGG - Intronic
1162156466 19:8681423-8681445 AAGGGTAATCAGATGCATGTGGG + Intergenic
1164011847 19:21210507-21210529 CAGGGGAATGAGGAGCAGCTGGG - Intergenic
1164383281 19:27753175-27753197 CAGTCTAATGAGAGACAGCTGGG - Intergenic
1165012913 19:32861857-32861879 CAGCCAAATCAGAGGCAGCCAGG - Intronic
1166099138 19:40560630-40560652 GAGGGTAATAATAGGCAACTGGG - Intronic
926607643 2:14913691-14913713 CAGGGGAAACAGAACCAGCTTGG + Intergenic
926628775 2:15118246-15118268 CAGGGATTTCAGGGGCAGCTGGG + Intergenic
926697793 2:15782782-15782804 CGGGGTACCCAGAGGCTGCTTGG + Intergenic
927270794 2:21208303-21208325 CAGGTTATTCAGAGGCAACATGG + Intergenic
927699448 2:25258670-25258692 GAAGGAACTCAGAGGCAGCTGGG + Intronic
927972537 2:27314913-27314935 CAGCCTAGTCAGTGGCAGCTGGG + Intronic
929771896 2:44899298-44899320 CAGGAGAGTGAGAGGCAGCTGGG + Intergenic
930019360 2:46992122-46992144 AAGGGAAAGCAGAGGCTGCTGGG - Intronic
930940346 2:57005305-57005327 CAGGACTTTCAGAGGCAGCTTGG + Intergenic
931046365 2:58358313-58358335 AAGGATAATCAGATGCAGATAGG - Intergenic
931879110 2:66548104-66548126 CAGGGAAAGCAGTGGCAACTGGG - Intronic
932720856 2:74138219-74138241 ATGGGTAATAAGATGCAGCTTGG + Intronic
933582965 2:84148007-84148029 CACCATAATCAGAGGCAGCTTGG + Intergenic
933980606 2:87547305-87547327 CAGGGTAAGCATAGGAAGCACGG + Intergenic
936313221 2:111403486-111403508 CAGGGTAAGCATAGGAAGCACGG - Intergenic
937640613 2:124206664-124206686 CAGCGGCATCAGAGGCACCTAGG + Intronic
940904938 2:159160715-159160737 CAGGGTTCTCAGAGGCAGGGAGG - Intronic
944906152 2:204264221-204264243 CTGGGTAATTAGAGTCAGCAGGG - Intergenic
947793123 2:232878953-232878975 AAGGGTGGGCAGAGGCAGCTGGG + Exonic
948121303 2:235532756-235532778 AAGGGTAAGCTGAGGCAGGTAGG - Intronic
1170571573 20:17635680-17635702 CAAGGGCATCAGAGGCAGCTCGG + Intronic
1171225690 20:23440293-23440315 CAGGGCAATCAGCAGCAGCAGGG - Exonic
1171467568 20:25341284-25341306 CAGGGTGATCTGAGCTAGCTGGG + Intronic
1173341401 20:42155828-42155850 CAGGGACAACAGAGGCAGGTAGG - Intronic
1178055413 21:28792868-28792890 CAGGTAAATCAGGGGCACCTAGG + Intergenic
1179804296 21:43827094-43827116 CAGGGCGAGCAGAAGCAGCTGGG + Intergenic
1181541212 22:23574184-23574206 CAGGGGCATCAGAGGCTGCTGGG - Intronic
1181797171 22:25319146-25319168 CAGGGGCATCAGAGGCTGCTGGG + Intergenic
1181957884 22:26601508-26601530 CAGGGAAATCAGAAGCTTCTGGG - Intronic
1184042031 22:41949952-41949974 CAGGGTCATCAGAGTCCTCTGGG + Intergenic
1184570025 22:45316998-45317020 CATTGTAATCAGATGCTGCTTGG + Intronic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
951450573 3:22833222-22833244 CAGGGAAATCAGAAACAGCATGG + Intergenic
954087787 3:48259595-48259617 CAGGGTAATCAGAGGCAGCTGGG + Intronic
956019666 3:64920775-64920797 CAGGGTACTCACAGGCATGTGGG + Intergenic
956210324 3:66795687-66795709 CTGGGTAATCTGAGGCTCCTGGG + Intergenic
959565014 3:107825325-107825347 CAGGTTAAGCAGAGGCAAGTGGG - Intergenic
966875161 3:184317398-184317420 CAGGGTAGACATGGGCAGCTGGG - Exonic
968695658 4:2024957-2024979 CAGGATAAACAGTGGCAGCATGG + Intronic
970439930 4:16071891-16071913 CAGGGTGATCAGAGGAAGTTAGG - Intronic
970655716 4:18228365-18228387 CAGGGTCTTGAGAGGCAGCCAGG + Intergenic
971105972 4:23524591-23524613 CTGGGAAATCTGAGGCAACTAGG + Intergenic
972058230 4:34831311-34831333 CAAGGCAATCACAAGCAGCTTGG - Intergenic
973739710 4:53907993-53908015 CAGGATAATCAGTTGCACCTGGG - Intronic
975127841 4:70802116-70802138 CATGATAAACAGAGGCAACTTGG - Intronic
977747647 4:100569468-100569490 CAGGGCAAGCAGAGGGAGATGGG - Intronic
981080012 4:140630474-140630496 CAGGGGAATGAGAAGCAGTTGGG - Intronic
984278644 4:177640208-177640230 CAGGGTAAGCAGAGCCAGAAAGG - Intergenic
985588518 5:753045-753067 CAGGTTAAACACAGGCAGCAGGG - Intronic
985603185 5:845484-845506 CAGGTTAAACACAGGCAGCAGGG - Intronic
985645654 5:1083596-1083618 CAGGCTCATCAGCAGCAGCTGGG + Intronic
986937413 5:12906452-12906474 CAGGATAATAAAAGGCATCTTGG - Intergenic
988260649 5:28882586-28882608 CAGGGCAATCAGAGGGCTCTGGG - Intergenic
988854431 5:35214141-35214163 CAGGCAAACCAGAGCCAGCTGGG - Intronic
990812548 5:59745472-59745494 GAGCGTCATCAGAGTCAGCTGGG + Intronic
997226492 5:132213239-132213261 CAAGGTCATCAGTGGCCGCTTGG - Intronic
998145471 5:139725285-139725307 CAGAGCCATCAGAAGCAGCTGGG + Intergenic
998172601 5:139881326-139881348 CAGGAGAGGCAGAGGCAGCTGGG - Intronic
998183618 5:139962350-139962372 AAGGGTGATCAGAGCCAGCTTGG + Intronic
998265246 5:140663191-140663213 CAGGGTAGACAGTGGCAGCGTGG - Intergenic
999257964 5:150220336-150220358 GAGGGGAATCAGGGGCAGGTGGG + Intronic
999365056 5:151017995-151018017 GAGGGCAATCAGAAGCAGCCTGG + Intergenic
999493304 5:152072732-152072754 CAGATGAACCAGAGGCAGCTGGG + Intergenic
1001091960 5:168748270-168748292 CAGGGTGCTTGGAGGCAGCTGGG + Intronic
1001976850 5:176007178-176007200 CAGGGTGACCAGAGACAGGTGGG - Intronic
1002240578 5:177836602-177836624 CAGGGTGACCAGAGACAGGTGGG + Intergenic
1002648316 5:180673377-180673399 CAGGCAAATCAGAGGAGGCTCGG - Intergenic
1006642083 6:35494763-35494785 AAGGGTGCTCAGAGGCCGCTTGG - Intronic
1008599593 6:53078021-53078043 TAGGTAAATAAGAGGCAGCTGGG + Intronic
1010277068 6:73981107-73981129 CAGGGTAGGGAGAGGGAGCTGGG - Intergenic
1010869661 6:81021788-81021810 CAGGATTAACAGAGGCAGCATGG + Intergenic
1012093596 6:94931366-94931388 CAGGATAAACCGAGGCAACTAGG - Intergenic
1018147021 6:160900798-160900820 CAGGGTACTGAGAGGGAGCATGG + Intergenic
1018294982 6:162336047-162336069 CAGGGTAAGCAAGGGCAGCAAGG + Intronic
1024221969 7:47295970-47295992 TGGGGAAATCAGAAGCAGCTCGG - Intronic
1024343518 7:48290468-48290490 CCAGGTAAGCAGAGGCATCTAGG - Intronic
1026110101 7:67452113-67452135 GAGGGTAGACTGAGGCAGCTTGG + Intergenic
1029443850 7:100602350-100602372 CAGGATAATCAGCGCCAGATGGG - Exonic
1032712610 7:134473898-134473920 CAGGCTACTGAGAGGCAACTGGG - Intergenic
1038419957 8:27427636-27427658 CTGGGTGATTATAGGCAGCTTGG - Intronic
1040404593 8:47087420-47087442 CTGGAAAATCTGAGGCAGCTAGG - Intergenic
1041648229 8:60275365-60275387 CAGAGTAAACAGAGACAGGTAGG + Intronic
1042039463 8:64577184-64577206 CAGGGGTATGGGAGGCAGCTCGG - Intergenic
1042078083 8:65018008-65018030 CAGGGAAAACAGAGGTAGCTAGG + Intergenic
1043495887 8:80799505-80799527 CAGGAAAAACTGAGGCAGCTAGG + Intronic
1044288639 8:90441007-90441029 CATGGTGATCAGAGTCAGCTAGG - Intergenic
1044855390 8:96470021-96470043 CAGGGTAACCAGGGACAGCCTGG + Intergenic
1045684639 8:104699960-104699982 CTGGGTCATCCGAGGCATCTTGG + Intronic
1047878558 8:129168035-129168057 CAGGTTAAACTAAGGCAGCTGGG + Intergenic
1049477278 8:142802588-142802610 CAGGGAAGCCAGAGGCAGCTGGG + Intergenic
1053330230 9:37199236-37199258 TAGAGAAATCAGAGCCAGCTAGG - Intronic
1056454176 9:86744465-86744487 CAGGGCAATCAGAGACAGCGGGG - Intergenic
1057088526 9:92234635-92234657 CAGGGTAACCTGAGACAGCCAGG + Intronic
1057353728 9:94319339-94319361 CAGGGAAGCCTGAGGCAGCTGGG + Intronic
1057654022 9:96938253-96938275 CAGGGAAGCCTGAGGCAGCTGGG - Intronic
1060645870 9:125279117-125279139 CAGGGTAATCACTGGAACCTGGG + Intronic
1060984311 9:127810767-127810789 CAGGGTATACTGAGGCAGATGGG + Intronic
1061415633 9:130445495-130445517 CAGGGTAAACTGAGGCTGCGGGG - Intronic
1062150433 9:135015663-135015685 CTGAGTAGACAGAGGCAGCTGGG + Intergenic
1062568992 9:137175849-137175871 CAGGGTCAGCACGGGCAGCTCGG + Intronic
1185557784 X:1034978-1035000 CGGGGTGATTAGAGGCAGCTTGG - Intergenic
1185864446 X:3610637-3610659 CAGGGAAAGTAGGGGCAGCTGGG + Intronic
1186123229 X:6385056-6385078 AAGGGAAATCAGAGGCAACTGGG + Intergenic
1186920087 X:14269317-14269339 CTGGGTAATTTGAGGCAGATAGG - Intergenic
1187697180 X:21934291-21934313 CAGGGCGATCAGAGTCAGCAAGG + Intergenic
1189703793 X:43739266-43739288 CAGGATAGTCAGAGGAAGTTTGG - Intronic
1190451482 X:50585569-50585591 CAGGTCAATTAGAGGGAGCTGGG + Intergenic
1192203654 X:69082536-69082558 TAGGGTAATGAGATCCAGCTGGG - Intergenic
1193533603 X:82686400-82686422 CAGATTAATCAGAGCCAGCAGGG + Intergenic
1197708830 X:129652296-129652318 CGGGGTGATGAGAGGCAGCGTGG + Intronic
1198613430 X:138427048-138427070 GAGGATAACCAGAGGCTGCTTGG + Intergenic
1198614994 X:138447314-138447336 CATGGTTATCAGAGGCTGGTGGG - Intergenic
1198639529 X:138741507-138741529 CAGTGGAATTACAGGCAGCTAGG - Intronic
1199664356 X:150084652-150084674 CAGGTTACTCAGAGGCAGATGGG - Intergenic
1200940373 Y:8774252-8774274 CAGGGTAAAGAGAGGCAGTGAGG - Intergenic