ID: 954089973

View in Genome Browser
Species Human (GRCh38)
Location 3:48276584-48276606
Sequence TGGCTTCTCTGAAGGGGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 376
Summary {0: 2, 1: 2, 2: 5, 3: 30, 4: 337}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954089973_954089983 5 Left 954089973 3:48276584-48276606 CCTCTGCCCCTTCAGAGAAGCCA 0: 2
1: 2
2: 5
3: 30
4: 337
Right 954089983 3:48276612-48276634 CCCGTGCCTTGCTTATGGCGGGG 0: 1
1: 0
2: 0
3: 1
4: 36
954089973_954089981 4 Left 954089973 3:48276584-48276606 CCTCTGCCCCTTCAGAGAAGCCA 0: 2
1: 2
2: 5
3: 30
4: 337
Right 954089981 3:48276611-48276633 CCCCGTGCCTTGCTTATGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 146
954089973_954089989 28 Left 954089973 3:48276584-48276606 CCTCTGCCCCTTCAGAGAAGCCA 0: 2
1: 2
2: 5
3: 30
4: 337
Right 954089989 3:48276635-48276657 GTACCAAGGCACCCCAAGTTGGG 0: 1
1: 1
2: 3
3: 6
4: 143
954089973_954089988 27 Left 954089973 3:48276584-48276606 CCTCTGCCCCTTCAGAGAAGCCA 0: 2
1: 2
2: 5
3: 30
4: 337
Right 954089988 3:48276634-48276656 GGTACCAAGGCACCCCAAGTTGG 0: 1
1: 1
2: 2
3: 4
4: 81
954089973_954089979 3 Left 954089973 3:48276584-48276606 CCTCTGCCCCTTCAGAGAAGCCA 0: 2
1: 2
2: 5
3: 30
4: 337
Right 954089979 3:48276610-48276632 ACCCCGTGCCTTGCTTATGGCGG 0: 1
1: 0
2: 0
3: 11
4: 79
954089973_954089987 14 Left 954089973 3:48276584-48276606 CCTCTGCCCCTTCAGAGAAGCCA 0: 2
1: 2
2: 5
3: 30
4: 337
Right 954089987 3:48276621-48276643 TGCTTATGGCGGGGGTACCAAGG 0: 1
1: 0
2: 3
3: 5
4: 48
954089973_954089985 6 Left 954089973 3:48276584-48276606 CCTCTGCCCCTTCAGAGAAGCCA 0: 2
1: 2
2: 5
3: 30
4: 337
Right 954089985 3:48276613-48276635 CCGTGCCTTGCTTATGGCGGGGG 0: 1
1: 0
2: 0
3: 3
4: 45
954089973_954089978 0 Left 954089973 3:48276584-48276606 CCTCTGCCCCTTCAGAGAAGCCA 0: 2
1: 2
2: 5
3: 30
4: 337
Right 954089978 3:48276607-48276629 CTGACCCCGTGCCTTGCTTATGG 0: 1
1: 0
2: 0
3: 10
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954089973 Original CRISPR TGGCTTCTCTGAAGGGGCAG AGG (reversed) Intronic
900181275 1:1312054-1312076 TGGGTCCTCAGAAGGGGCGGCGG + Exonic
900246031 1:1636535-1636557 TGTCTTCTCTGACGGGACACAGG - Intronic
900257257 1:1703678-1703700 TGTCTTCTCTGACGGGACACAGG - Intronic
900507020 1:3034813-3034835 TGACTACTCTGGAGGTGCAGGGG - Intergenic
900525257 1:3125403-3125425 TGGCTACTCTGGGGGGTCAGAGG - Intronic
900766634 1:4510236-4510258 AGGCTTCTTTGTAGGGCCAGGGG + Intergenic
900808992 1:4786946-4786968 TGGCTTTGTGGAAGGGGCAGGGG - Exonic
901433748 1:9234120-9234142 GGGCTTCTCTGTAGGGTGAGAGG - Intergenic
902518939 1:17004980-17005002 GGGCTTCTGGGAAGGGGCAATGG + Intronic
902527303 1:17067568-17067590 GCGCATCACTGAAGGGGCAGAGG + Exonic
902701861 1:18177912-18177934 GAGTTTATCTGAAGGGGCAGGGG + Intronic
903372281 1:22844393-22844415 TGCTGTCTCTGCAGGGGCAGGGG + Intronic
903445615 1:23420865-23420887 TGGCTTCTAGGAAGGGGCTGGGG - Intronic
903471150 1:23588239-23588261 GGGCTGCTCTGGAGGGGCAAAGG + Intronic
903919182 1:26787608-26787630 TGGTTTCTGTGAAGAGGCTGCGG + Intronic
904809069 1:33151529-33151551 TGACTTCTCAGAGGGGGAAGGGG - Intronic
904934001 1:34113575-34113597 TGGCTTCTGCTGAGGGGCAGTGG + Intronic
905618407 1:39418138-39418160 TGGCTTCTGTGTTGGGGCTGAGG + Intronic
905894543 1:41536603-41536625 ATCCCTCTCTGAAGGGGCAGTGG + Intronic
905901231 1:41583176-41583198 TGGCTTCTCAGGAGAGGCACAGG + Exonic
906035264 1:42746866-42746888 AGGCCTCTCTGAATGGGCAGGGG - Exonic
906295223 1:44645395-44645417 TGGCATCTCTGCTGGGACAGAGG - Exonic
906603869 1:47151412-47151434 TGGCCACCCTGATGGGGCAGGGG + Intergenic
907132684 1:52110500-52110522 TGTTCTCTCTGAAGGGTCAGTGG - Intergenic
909346917 1:74600893-74600915 TGGCTTCTCTGTGGGGGAGGGGG + Intronic
910297442 1:85664164-85664186 TGGCATCCCTGAAGGGGATGGGG - Intronic
910558764 1:88566949-88566971 AGGCTTCTTTGTTGGGGCAGAGG - Intergenic
911563287 1:99432499-99432521 TGGCTCCTGTGAAGAGGCACAGG - Intergenic
914091761 1:144506789-144506811 TGGCTTTACTGAAGGGGAGGTGG - Intergenic
915146340 1:153797897-153797919 CGGCTCCTCTGCAGGAGCAGAGG + Intergenic
915274397 1:154777922-154777944 TGGCTTCCCTGAATGGGAAAAGG + Intronic
915567999 1:156727326-156727348 AGCCTTTTTTGAAGGGGCAGGGG + Exonic
915943699 1:160135130-160135152 TGGCTTCTCTGGAGGGTGGGTGG - Exonic
916545018 1:165796001-165796023 TGGCCTCCCTAAAGGGGCAGAGG - Intronic
917095182 1:171392636-171392658 TGCCTACTTTGAAGGGACAGTGG - Intergenic
917173148 1:172200519-172200541 TGGCATCCCTGAAAGGGAAGAGG - Intronic
918084034 1:181230116-181230138 TGGCTGCTCAGAAGGGGAAGGGG + Intergenic
918678899 1:187326435-187326457 TGGCTTCACTGTAGGTACAGGGG + Intergenic
919229202 1:194751645-194751667 TGGTTTCTTTGCAGGGGTAGGGG + Intergenic
920314771 1:205069689-205069711 TGGATTCGCGTAAGGGGCAGCGG - Intronic
922277254 1:224090463-224090485 TGGCTTCTCTGATGAGGCCTCGG - Intergenic
922726929 1:227927001-227927023 TGGCTCCTGTGGAGGGGCTGTGG - Intronic
923182365 1:231531954-231531976 TGGCTACTCCGGAGGGGCTGGGG + Intronic
923633646 1:235673374-235673396 TGGCTTCCCTGGAGGGGCAGAGG - Intronic
1062912070 10:1217769-1217791 TGGCTCCTGTGAAGGTGCTGGGG + Intronic
1064056643 10:12103395-12103417 TGGCTTCTAGGAAGGGACAGAGG + Intronic
1067203606 10:44195442-44195464 TGGCCTCTCAGGAGGGGCCGGGG + Intergenic
1069358675 10:67616473-67616495 TGGCTTCTTTGAGGAAGCAGTGG + Intronic
1069530446 10:69214818-69214840 TAGCCTCACTGAAGGGGAAGGGG - Intergenic
1069599006 10:69691364-69691386 AGCTTTATCTGAAGGGGCAGGGG - Intronic
1069922583 10:71825567-71825589 TGGCTGGCCTGAACGGGCAGAGG + Intronic
1070321710 10:75359475-75359497 TGGCTTCTCTGGAGGCCCACAGG - Intergenic
1070401813 10:76059390-76059412 TGGCAGCTCTGATGAGGCAGTGG + Intronic
1070851889 10:79570976-79570998 TGACAGCTCTGAAGGAGCAGTGG + Intergenic
1071240450 10:83699206-83699228 TGGAGTCACTTAAGGGGCAGTGG + Intergenic
1072041463 10:91611061-91611083 TGGCTACTCTGGGAGGGCAGAGG - Intergenic
1073969442 10:109030680-109030702 TGTCTTCCCTGAAGGGGCTTTGG + Intergenic
1075034365 10:119051418-119051440 TGGCATGACAGAAGGGGCAGTGG - Intronic
1075375654 10:121975827-121975849 TGATTTCTGTGAGGGGGCAGCGG - Intergenic
1076454556 10:130580877-130580899 TGGGTTCTCTGAACTGGCAAGGG + Intergenic
1077212881 11:1381657-1381679 TGGCTTCTCTCAACAGGAAGAGG + Intergenic
1077319212 11:1933613-1933635 GGGCTTCTCTGCTGGGGCAAAGG + Intronic
1077685042 11:4283333-4283355 TTACTTCTCAGAAGGGGCGGCGG - Intergenic
1077690146 11:4334597-4334619 TTACTTCTCAGAAGGGGCGGCGG + Intergenic
1077825707 11:5806321-5806343 TGGTTTCTCTGAAGGGGCAGAGG + Intronic
1078366463 11:10710730-10710752 TGCCTGCTCTGTGGGGGCAGGGG - Intergenic
1078432413 11:11298170-11298192 TGGCTTCTTTGGAGGGCTAGAGG - Intronic
1078447940 11:11418928-11418950 GGGCTTCCCTTAAGGGGCATTGG - Intronic
1078454895 11:11467356-11467378 AGGGCTCTGTGAAGGGGCAGGGG - Intronic
1079376422 11:19896064-19896086 AGGCTTCGGTGAAGGAGCAGGGG - Intronic
1079997944 11:27316161-27316183 TAGCTCCTCTGAAGGGGCTGGGG - Intergenic
1081259617 11:40943647-40943669 TGTTTTCTGTGAAGGGGAAGGGG + Intronic
1081862392 11:46340710-46340732 TGTCTCCTCTGTGGGGGCAGAGG + Intronic
1083267466 11:61553437-61553459 TGGCCTCGGGGAAGGGGCAGCGG - Intronic
1083470479 11:62880858-62880880 CGGCCTCTGGGAAGGGGCAGCGG - Intronic
1083625431 11:64069667-64069689 TGGCTTCCCTGCAGGGGCACAGG + Intronic
1084259463 11:67966082-67966104 CGGCCTCTCAGAAGGGGAAGCGG - Intergenic
1084288982 11:68149706-68149728 TGTTTTCTCTCATGGGGCAGAGG - Intergenic
1084552300 11:69851995-69852017 TTGCCTCTGTGAAGGGTCAGGGG + Intergenic
1084612177 11:70210216-70210238 TGGCTTCTAAGAAGAGTCAGGGG - Intergenic
1084648641 11:70475180-70475202 TGGTTTCTATGAAGGGTCTGTGG - Intronic
1084754985 11:71232487-71232509 TGCCTTCTCAGAGGCGGCAGAGG - Intronic
1085054110 11:73394158-73394180 GGGGTTCTCTGCTGGGGCAGGGG + Intronic
1086833997 11:91599385-91599407 TGGCATCTCTGGAGGGACTGTGG + Intergenic
1087158620 11:94927913-94927935 TGGTCTCTCTGAAGGATCAGGGG - Intergenic
1088863229 11:113821558-113821580 AGCATTCTTTGAAGGGGCAGGGG + Intronic
1089784603 11:120898969-120898991 GGGCTGCTGGGAAGGGGCAGGGG - Intronic
1090153820 11:124414683-124414705 AGACTGCTCTGAAGGGGGAGAGG - Intergenic
1091203106 11:133797729-133797751 TGGCTTCTCTGGCGTGGGAGGGG - Intergenic
1091339736 11:134801013-134801035 TGGATTCACTGAGTGGGCAGTGG + Intergenic
1092855605 12:12670791-12670813 TGGCTTTTGTGAAGGGGCCTGGG + Intronic
1096257477 12:50072280-50072302 TGCTTTCTCTGCAGGGCCAGAGG - Intronic
1096478175 12:51921273-51921295 TGGCAGCTCTGGTGGGGCAGTGG - Intronic
1097106859 12:56630775-56630797 AGGCTGCACTGAAGGGACAGAGG - Intronic
1097324851 12:58265024-58265046 TGGCTTTCATGAAGTGGCAGTGG + Intergenic
1097493016 12:60294406-60294428 TGGCTTCCCTTAAGGGAGAGAGG + Intergenic
1101529721 12:105562975-105562997 TGTCTTTTTTGATGGGGCAGGGG + Intergenic
1101938333 12:109078481-109078503 TGCCTTCTCTTAAGAGGCTGAGG + Intronic
1101953458 12:109194063-109194085 TGGTCTCTCTGAAGGCGCTGGGG + Intronic
1102801792 12:115741493-115741515 AGGCTTCTCTCCAGAGGCAGAGG + Intergenic
1103955447 12:124573969-124573991 TGTCTTAACTGAAGGAGCAGAGG - Intergenic
1104203557 12:126615126-126615148 TGGCTTCTCTGAAGGGGCAGAGG + Intergenic
1105921808 13:24970536-24970558 TCACTTCTCAGACGGGGCAGCGG + Intergenic
1106180739 13:27367414-27367436 CGGCAGCTCTGAAGAGGCAGGGG - Intergenic
1106673696 13:31934547-31934569 TCTCTCCTCTAAAGGGGCAGTGG - Intergenic
1106971246 13:35144617-35144639 GGACATCTCTGAAGGGGAAGGGG - Intronic
1107180788 13:37456445-37456467 TGCTTTCTCTGAAGGTGCTGGGG - Intergenic
1107670651 13:42743333-42743355 CGGCTTCTCCGACAGGGCAGAGG + Intergenic
1108412332 13:50162337-50162359 TTGCAGCTGTGAAGGGGCAGGGG - Intronic
1108456548 13:50620772-50620794 TGGCTCCTCTCAGGGGGCTGTGG - Intronic
1110753853 13:79147761-79147783 TGGCTTCTCTATAGCAGCAGTGG + Intergenic
1111828091 13:93294449-93294471 TGTCTTTTTTGCAGGGGCAGGGG - Intronic
1112527197 13:100161450-100161472 TGGCTTCCCTGCAGGGTCATTGG + Intronic
1112802545 13:103128428-103128450 TGACTTCTCTGGAGGGAAAGGGG + Intergenic
1113068066 13:106391858-106391880 TAGCTAATCTGAAGAGGCAGTGG + Intergenic
1113657239 13:112074647-112074669 TGGTTGCTCTGAAGTGGCCGAGG - Intergenic
1113895978 13:113764695-113764717 AGGATGCTCTGCAGGGGCAGGGG + Intronic
1114402293 14:22420992-22421014 AGGCTTCCCTGAAGAGGAAGTGG - Intergenic
1116490186 14:45495972-45495994 TGACTTCTGGGAAGGGGAAGTGG + Intergenic
1117707686 14:58488728-58488750 TGGCATCTGTGAGGGGGAAGGGG - Exonic
1119500881 14:75126723-75126745 TGGCTTCCCCGAAGGCGCCGCGG + Exonic
1121610340 14:95274390-95274412 TGGCTGCTGTGCATGGGCAGGGG - Intronic
1121893447 14:97621463-97621485 TGGCCTCTGTGTATGGGCAGGGG - Intergenic
1122877921 14:104677385-104677407 GGGCTACTCTGAAGGGGGTGCGG - Intergenic
1123207271 14:106725687-106725709 GGGCTTCTCTGCAGGCTCAGAGG + Intergenic
1124354586 15:28985227-28985249 TGGCTGCACTGCAGGGGCACGGG + Intronic
1124636285 15:31366840-31366862 TGGCCCCTCTGAAGGGTCTGAGG - Intronic
1124841102 15:33243024-33243046 TGGGTTCACTGAATGGGCACTGG - Intergenic
1125547471 15:40517090-40517112 TAGCTACTCAGAAGGGGCAGGGG - Intergenic
1127793996 15:62423024-62423046 TGGCTTCTCCCAGGGGGAAGAGG + Intronic
1127908525 15:63395751-63395773 TGGCTATTTTAAAGGGGCAGGGG + Intergenic
1128929231 15:71689295-71689317 CAGCGTCTGTGAAGGGGCAGGGG + Intronic
1129691433 15:77715856-77715878 TGGCTGCTCTGAAGGGGGCTGGG + Intronic
1130632767 15:85585687-85585709 TGGCATTTCTGAAAGTGCAGGGG - Exonic
1133365671 16:5207204-5207226 TGGCTTCTCGGAAGGGGAGGCGG + Intergenic
1134677153 16:16098762-16098784 TGTCTTTTCTAAAGGGGGAGAGG - Intronic
1135989401 16:27208578-27208600 TGGCTTCTCATAAAGGCCAGTGG - Intronic
1136640769 16:31563426-31563448 AGGCTTTTCTGAAGTGGCAGTGG + Intergenic
1136664196 16:31793886-31793908 AGGCTTTTCTGAAGTGGTAGTGG - Intronic
1137581654 16:49637295-49637317 TGTCTTCCCCGAAGCGGCAGCGG - Exonic
1138294640 16:55875796-55875818 TGGCAACTATGAAGGGCCAGAGG - Intronic
1138350447 16:56343764-56343786 CGGCTTCTGTGAAGGCGCTGGGG - Exonic
1139346491 16:66307059-66307081 TAGCTTCTCTGCAGGGGTACAGG - Intergenic
1139653884 16:68375987-68376009 CGGCTTCTATGCAGAGGCAGGGG - Intronic
1139728576 16:68922879-68922901 TCTCTTCTCTAAAGGGGAAGGGG + Intronic
1139784593 16:69382142-69382164 TGGCTTCTCTGAAAGGGTCCTGG + Intronic
1140485262 16:75288400-75288422 TTCCTCCTCTGAAAGGGCAGAGG + Intergenic
1140592477 16:76370333-76370355 TTGTTTCTCTGATGGGGCACTGG - Intronic
1140697931 16:77553328-77553350 TGTCTGCTCTGAAGGGGCACTGG - Intergenic
1142327133 16:89423055-89423077 TTGGTTGTCTGAAGGAGCAGCGG - Intronic
1143679011 17:8462110-8462132 CGGATGCTCTCAAGGGGCAGAGG - Intronic
1144336660 17:14277668-14277690 TGTGTGCTATGAAGGGGCAGGGG + Intergenic
1148174214 17:45550048-45550070 TGGCATCTCTGAGGAAGCAGAGG + Intergenic
1148275048 17:46295399-46295421 TGGCATCTCTGAGGAAGCAGAGG - Exonic
1148297155 17:46512978-46513000 TGGCATCTCTGAGGAAGCAGAGG - Exonic
1148361711 17:47017458-47017480 TGGCATCTCTGAGGAAGCAGAGG - Intronic
1148625706 17:49067455-49067477 TGGCATCTCAGCAGTGGCAGGGG + Intergenic
1148855633 17:50577855-50577877 TGGCTTCTGGGAAGGGGAAGGGG + Intronic
1149866703 17:60155052-60155074 GGGCTTCCCTGGAGGGCCAGTGG + Intronic
1150218703 17:63484044-63484066 TGGCTGCTCTGATGGGGTGGGGG + Intergenic
1150405432 17:64896970-64896992 TGGCATCTCTGAGGAAGCAGAGG + Exonic
1151516935 17:74602666-74602688 GGGCTGCTCTGAGGGGGCACGGG - Intergenic
1153539677 18:6140225-6140247 TGGCCCCTCAGAAGGGGCTGAGG - Intronic
1153756794 18:8292117-8292139 TGGCTTCTCTGAATATTCAGTGG + Intronic
1154168717 18:12035522-12035544 TGGCATCTCACAAGGAGCAGAGG + Intergenic
1157174953 18:45443135-45443157 TAGGTTCACTGAAGGGGAAGGGG + Intronic
1158801627 18:60917469-60917491 TGGCTGCCCTGGGGGGGCAGAGG - Intergenic
1160493239 18:79355123-79355145 TTGCTGCTGTGCAGGGGCAGGGG - Intronic
1161763019 19:6188242-6188264 AGGCTGCTCTGAGGGGGAAGAGG - Intronic
1162172350 19:8801358-8801380 TGACAGCTCTGAAGGAGCAGTGG - Intergenic
1162647399 19:12059796-12059818 TGGATTCTGAGAAGGTGCAGAGG + Intergenic
1162672153 19:12266366-12266388 CGGCTTCTCTGAAAGTGCTGAGG - Intronic
1164464363 19:28475051-28475073 AAGCTTCTCTGAGGGAGCAGGGG - Intergenic
1164970971 19:32532173-32532195 TTACATCTCTGCAGGGGCAGAGG + Intergenic
1165678896 19:37756019-37756041 AGGCTTCCCTGAAGGGTCAGTGG - Intronic
1165815661 19:38640469-38640491 TGGCTGCTCTGCAAGGGAAGAGG + Intergenic
1166803700 19:45472782-45472804 TGGCTGGTCTGGAAGGGCAGGGG - Exonic
1167643944 19:50695794-50695816 GGGCTTCTCTGGTGGGGGAGGGG - Intronic
925218405 2:2117069-2117091 TGGGTGCTCTGCAGGGGGAGAGG - Intronic
925715769 2:6782945-6782967 TGGCTTCTCTGACTGGATAGCGG + Intergenic
926175651 2:10589347-10589369 TGGTTTCTCTGAAGCAGCACTGG + Intronic
926341210 2:11906221-11906243 GGACTTCTCTGAAGGGACAGCGG + Intergenic
927015991 2:18962236-18962258 GGGCTTCTCTGTAGCCGCAGGGG - Intergenic
927087707 2:19687887-19687909 TGCTTTCTCTGAAAAGGCAGAGG + Intergenic
927971972 2:27311600-27311622 TGGCATATCTGGAGGGACAGTGG - Intronic
928060373 2:28106622-28106644 TGCCTTCTCTCAAGTGGCAGAGG + Intronic
929581045 2:43082080-43082102 TGACTTCTCTGAAGGAGATGGGG - Intergenic
931025775 2:58112529-58112551 ACGCTTCTCTGAAGGGTCACTGG + Intronic
932157860 2:69434644-69434666 TGGCTCCTATGAAGTGGCAGTGG - Intronic
932476163 2:72007514-72007536 TGGCTGCTCAGCAAGGGCAGTGG + Intergenic
934623079 2:95827846-95827868 TGGCATCTCTGAAAGGGAGGTGG - Intergenic
934810690 2:97274239-97274261 TGGCATCTCTGAAAGGGAGGTGG + Intergenic
934827002 2:97433700-97433722 TGGCATCTCTGAAAGGGAGGTGG - Intergenic
934962423 2:98688394-98688416 TGCCTGCACTCAAGGGGCAGAGG - Intronic
936250249 2:110862797-110862819 TGCCCTCTGTGAAGGGGCCGTGG + Intronic
936623333 2:114122571-114122593 TGGCTTCTCTGAATCTGCTGGGG - Intergenic
937358545 2:121213291-121213313 TAGTTTCTCTGTTGGGGCAGAGG + Intergenic
937761745 2:125612649-125612671 TTCCTTCTCTGAAGTGGGAGGGG + Intergenic
938863987 2:135399208-135399230 TTGCTTCTCGGAAGGGGCCTGGG - Intronic
939627102 2:144491145-144491167 TGGAGTCTCTGAAGGAGCTGGGG + Intronic
941564633 2:167091297-167091319 TGGAGTCTCAGAAGTGGCAGGGG - Intronic
942148721 2:173053422-173053444 TTGCTGCTCTGAAGGGGCACTGG + Intergenic
944192967 2:197022975-197022997 TGGATACTCTGCAAGGGCAGAGG + Intronic
944539202 2:200740559-200740581 TGGCTTCTTTGGATGGGAAGAGG - Intergenic
946357745 2:219199155-219199177 TGCCTTTTCTGGGGGGGCAGTGG + Intronic
946384610 2:219374948-219374970 TGGCTTCTCGGCTGGGGCTGCGG - Exonic
946852873 2:223924235-223924257 TTGCTTCTCTAAAAGTGCAGAGG - Intronic
947155252 2:227155728-227155750 TGGTTTCCATGTAGGGGCAGTGG - Intronic
947300530 2:228683916-228683938 AGGCTTCTGTAAAGAGGCAGGGG + Intergenic
947830790 2:233140090-233140112 TGGCTTCCTGGAAAGGGCAGGGG - Intronic
948205854 2:236162556-236162578 TGGGTTCTCCAATGGGGCAGGGG + Intergenic
948395832 2:237644334-237644356 TGGCTTTCCTGTTGGGGCAGGGG + Intronic
948622668 2:239246315-239246337 TGGTTTCTCCGACGGGGGAGGGG - Intronic
948826645 2:240576332-240576354 GGGCTTCTGTGAAGGGGTACAGG - Intronic
948887666 2:240892222-240892244 TGCCTTCTCTGCAGGGGAGGAGG + Intronic
948908995 2:240993703-240993725 TTGCCTCCATGAAGGGGCAGGGG - Intergenic
949008659 2:241666103-241666125 TGGCTCCTCTGAGTGGGGAGTGG + Intronic
1169049146 20:2561740-2561762 TGGCTTCTGAGCAGGGGAAGGGG + Intronic
1169878372 20:10322078-10322100 TGGTTTCTCTGAGGAGGTAGAGG - Intergenic
1169915043 20:10674969-10674991 TGCCTTCTCTGGGGTGGCAGTGG + Intergenic
1170813288 20:19691982-19692004 TGGCCTCTCTTAAAGGGCCGAGG - Intronic
1171935394 20:31270200-31270222 TGGCATCACTGAAGGTACAGTGG - Intergenic
1172656393 20:36541209-36541231 TTGCCTCTCTGGAGGGGAAGGGG + Intergenic
1172843212 20:37914645-37914667 TGGCTTCTCTAAGGGGTCCGTGG - Intronic
1173177046 20:40772408-40772430 TGGATTCTCTGCTGGGTCAGTGG - Intergenic
1173181971 20:40812683-40812705 AAGCTTCTTTCAAGGGGCAGTGG - Intergenic
1173519778 20:43690520-43690542 TGGATTCGCTGTAGGGACAGAGG + Intronic
1174180315 20:48670303-48670325 AGGGTTCTCAGCAGGGGCAGGGG - Intronic
1174201087 20:48806923-48806945 TGGCTTCTCAGAAGAGGTATAGG + Intronic
1175187864 20:57190798-57190820 TGGCTTCTGTGCAGGAGCAGTGG - Intronic
1175915717 20:62424805-62424827 TGGCCACTCAGAGGGGGCAGAGG + Intronic
1175960109 20:62631583-62631605 TGTCTTCCCTGCAGTGGCAGTGG + Intergenic
1176220360 20:63966733-63966755 CGGCCTCGCAGAAGGGGCAGGGG + Exonic
1179133061 21:38656052-38656074 TGGGGCCTCTGCAGGGGCAGTGG - Intronic
1179224274 21:39439733-39439755 TGGCTTTCCTGCAGAGGCAGTGG + Intronic
1179266961 21:39812408-39812430 TGGCACCACTGAAGGGGTAGGGG + Intergenic
1179459606 21:41524998-41525020 TGGACTCTCTGACTGGGCAGCGG - Intronic
1179514755 21:41898906-41898928 GGGCATTTCTGGAGGGGCAGGGG + Intronic
1179708404 21:43195527-43195549 TGTTATCTCCGAAGGGGCAGCGG + Intergenic
1179880415 21:44291268-44291290 TGGCTTCCCTTCAGGGTCAGTGG - Intronic
1180875800 22:19174785-19174807 TGGCTTCTCTGCACAGCCAGGGG + Intergenic
1184113665 22:42409741-42409763 TTGCTTCTCTGTAAGGACAGGGG + Intronic
1184720351 22:46308992-46309014 TGGCTTCTGTGAGAGGGCTGAGG - Intronic
1184997817 22:48223287-48223309 TCTCTACTGTGAAGGGGCAGTGG - Intergenic
952924236 3:38309469-38309491 TGGCTTCACTGCAGTGGCAGAGG + Intronic
953561947 3:43998820-43998842 TGGCATCTATGAAGTGGCAGTGG + Intergenic
953742565 3:45550096-45550118 TGTCCTCTCTGCAGGGGCAGTGG + Intergenic
954035994 3:47851504-47851526 GGGCTTCTCTGGAGGGGGATTGG - Intronic
954089973 3:48276584-48276606 TGGCTTCTCTGAAGGGGCAGAGG - Intronic
954116728 3:48470637-48470659 TGACTTCTAGGAGGGGGCAGTGG + Intronic
954202574 3:49032841-49032863 TGGCTCCTCTGAAGCACCAGTGG - Intronic
954798622 3:53174411-53174433 TGGCCACTCTGCAGGGCCAGGGG - Intronic
954967659 3:54625532-54625554 TGGCTGCTCTGATGGGCCAGAGG + Intronic
956565416 3:70631546-70631568 TGGGATCTCTGAAGGGGCTGCGG + Intergenic
956767601 3:72497052-72497074 TGGCCCATCTGAAGGGGCAGAGG - Intergenic
957074416 3:75590511-75590533 CGGCCTCTCTGAAGGGGAGGCGG - Intergenic
957614927 3:82514905-82514927 TGTCTTCTCTTCAGGGCCAGAGG - Intergenic
957954084 3:87161318-87161340 TTGCACCTCGGAAGGGGCAGGGG - Intergenic
960659594 3:120043501-120043523 TGGCTTTTCTGGAGGGGCAGAGG - Intronic
960866106 3:122201767-122201789 TCACTTCTCAGACGGGGCAGCGG + Intronic
960945125 3:122961139-122961161 TGGCTTCTCTCACTGGTCAGGGG - Exonic
961864671 3:129944944-129944966 TGGCTGCTCTGGAGGTGCACGGG + Intergenic
961955938 3:130804251-130804273 TGGCATATTTGAAGGTGCAGAGG - Intergenic
964612040 3:158625189-158625211 TGGCTTCTCTGAAGGAGCAGAGG + Intergenic
964740429 3:159959709-159959731 TGTCTTCAATAAAGGGGCAGGGG - Intergenic
967127280 3:186435589-186435611 TCACATCTCAGAAGGGGCAGCGG + Intergenic
968546480 4:1201334-1201356 TCGCTTCCCTGAAGAGGCTGTGG + Intronic
968934355 4:3602181-3602203 TGGCTGCACTGAAAAGGCAGTGG - Intergenic
969384774 4:6837222-6837244 TCACTTCTCAGAAGGGGCGGCGG + Intronic
969390912 4:6890802-6890824 AGGCCTCTCTGAAATGGCAGTGG - Intergenic
969500787 4:7551555-7551577 TTGCTTCTCTCCTGGGGCAGTGG - Intronic
970119727 4:12740184-12740206 TGGCTTATCAGTAGGGGAAGGGG + Intergenic
971230271 4:24795783-24795805 TGGCTGCTCTGAGGGGTTAGTGG + Intronic
972248933 4:37278664-37278686 TGGTTTCTATGAAGGTTCAGGGG - Intronic
973149537 4:46869989-46870011 TGGCATCTCTGAAAGGGAGGAGG - Intronic
974184842 4:58431713-58431735 TGGCTTCCCTGAGGGAGGAGAGG + Intergenic
976183001 4:82416820-82416842 TGACTTTTCAGAAGGAGCAGTGG - Intergenic
976224671 4:82786324-82786346 TTGGTTCTCTGAAGAGACAGTGG - Intronic
978219415 4:106253099-106253121 TGTCTTCTCTGGAGGAACAGGGG - Intronic
979189951 4:117844275-117844297 TGGCTGCTGTGACGGGTCAGTGG + Intergenic
982306331 4:153935073-153935095 TAGCTTCTCTTAAGAGGCTGAGG - Intergenic
984765986 4:183400842-183400864 GGGCATCTGTGTAGGGGCAGTGG - Intergenic
984891541 4:184498609-184498631 TGTCTTCTTGGAAGGAGCAGGGG - Intergenic
985054870 4:186027433-186027455 TGGTCTCTCTGAAGGCTCAGAGG + Intergenic
985622113 5:961196-961218 TGGATTCTCTGGAAGGACAGTGG - Intergenic
988482671 5:31642740-31642762 TGCCTTCTCTGGAAGGCCAGAGG + Intronic
988795084 5:34646230-34646252 TGACAGCTCTGAAGGAGCAGTGG - Intergenic
994742182 5:103633983-103634005 TGGCATCCCTGAAGGGTAAGAGG - Intergenic
997061508 5:130509929-130509951 TGGCTTCTCTGAAGTCACAGAGG + Intergenic
997353160 5:133245169-133245191 AGGCTCCCCTGATGGGGCAGTGG - Intronic
997640090 5:135443342-135443364 TTGCTTCTCTGAGGGATCAGGGG - Intergenic
998530385 5:142879088-142879110 GCGATCCTCTGAAGGGGCAGAGG - Intronic
998614773 5:143727930-143727952 TGGCTGCACTGAGGGGGCCGAGG + Intergenic
998748698 5:145292385-145292407 TGGTTTGTGTGCAGGGGCAGGGG + Intergenic
999401367 5:151266895-151266917 TTACTTCTTTGAAGGGACAGTGG - Exonic
999947911 5:156617580-156617602 TGGCTTCTCCCACTGGGCAGTGG - Intronic
1001084473 5:168690712-168690734 TGGCATATCTGAGGGGGCATGGG + Intronic
1002192244 5:177484365-177484387 TGGCAAGTCTGAAGGCGCAGTGG - Intronic
1002395804 5:178953182-178953204 AGGAGTCACTGAAGGGGCAGGGG - Intronic
1003108068 6:3230174-3230196 TGGCTGCCCGGAAGGGGCAGGGG - Intronic
1003830520 6:10005228-10005250 TGGCTTCTCTTAAGGGGCTGAGG - Intronic
1005947647 6:30605990-30606012 TTTCTTCTCTGCAGGGGGAGTGG + Exonic
1006083559 6:31581141-31581163 GCGCTCCGCTGAAGGGGCAGGGG - Exonic
1006792663 6:36714100-36714122 AGGCCTCCCTGGAGGGGCAGAGG - Intronic
1007633673 6:43285837-43285859 CTGCTTCTCTGAAGGGGTGGGGG - Exonic
1007643598 6:43363511-43363533 TGGCTTCCATGGAGGGGCTGGGG + Intronic
1009522544 6:64701682-64701704 TGGAGTCTCAGAAGGGTCAGAGG + Intronic
1011211992 6:84965089-84965111 CAGCTTCTCTGAAGGGGCAGAGG + Intergenic
1011254746 6:85408741-85408763 TGGCTACTCTGAGGGAGCTGGGG + Intergenic
1012784710 6:103609085-103609107 TGGCTTCTTAGAAGGCACAGAGG + Intergenic
1016428497 6:143958811-143958833 TGGCTTTTCTGAAAGGGGAAAGG + Intronic
1017700095 6:157061014-157061036 TGGCACCTCTGGATGGGCAGAGG + Intronic
1018037454 6:159893445-159893467 GGGCATCTGTGCAGGGGCAGGGG + Intergenic
1018124847 6:160671877-160671899 TGGCATCTCTGAAAGGGATGGGG + Intergenic
1018436897 6:163768442-163768464 TTGCTTCTCTCAAGAGCCAGTGG - Intergenic
1018937858 6:168285317-168285339 TGGGTTCTCTGAAGGAGCAGGGG - Intergenic
1019322204 7:420872-420894 GGGCTTCTCTGCAGGGGCTCCGG + Intergenic
1019340135 7:504979-505001 GGGCTTGTCTGAGGAGGCAGTGG - Intronic
1020130566 7:5556561-5556583 CTGCTTCTCCGAAGGGGCGGCGG + Intronic
1020971761 7:14952212-14952234 TTGCTCCTCTGAAGGTGCTGAGG - Intronic
1021827812 7:24572834-24572856 TGGAGTCTGTGAAGGGGGAGGGG + Intergenic
1022814935 7:33904959-33904981 TGGCCTCCCTGGAGGGGCTGGGG + Exonic
1025260620 7:57415272-57415294 TGTCTTCACAGAAGGAGCAGAGG + Intergenic
1028609769 7:92697621-92697643 GGGCTTCTCTGCAGTGGTAGAGG - Intronic
1030658097 7:112190521-112190543 TGGCATCTCTGAGGAGCCAGTGG + Intronic
1031144186 7:117979439-117979461 TCTCTTCTCTAAAGGGACAGAGG - Intergenic
1032522122 7:132553383-132553405 TGGCTTTTCTGATGGGTCTGGGG - Intronic
1033741172 7:144276908-144276930 TGGCTCCTCGGAGGAGGCAGAGG - Intergenic
1033752733 7:144372706-144372728 TGGCTCCTCGGAGGAGGCAGAGG + Exonic
1034982452 7:155487759-155487781 TGGCTTCTCTGAGGAGGAGGCGG + Intronic
1035025621 7:155823461-155823483 TCGCTGCTCGGGAGGGGCAGGGG - Intergenic
1035405273 7:158592963-158592985 ACTCTTCTCTGAAGCGGCAGGGG - Intergenic
1035415993 7:158686993-158687015 TGGCTTCTCGGAAGAGCCTGTGG - Intronic
1036633054 8:10528995-10529017 TGGCTTTTCTGAGGGGCCAGTGG - Intronic
1036901900 8:12676242-12676264 TGGCCTCTCGGAAGGGGAGGCGG - Intergenic
1037822000 8:22139581-22139603 TGGCTTCTCAGAATCTGCAGAGG - Intronic
1038930401 8:32187681-32187703 TGGCTTTTCTGGGGGAGCAGAGG + Intronic
1039503230 8:38032869-38032891 TGGCTTCTCTGCCCTGGCAGAGG - Intronic
1040621928 8:49101259-49101281 TGGCCTCCCTGGAGGGGCAGAGG - Intergenic
1041561945 8:59227801-59227823 TGGCATCCCTGAAAGGGAAGGGG + Intergenic
1042188121 8:66157109-66157131 TTGCTTCTCTGAGGCTGCAGAGG + Intronic
1043605102 8:81990619-81990641 TGACAGCTCTGAAGGAGCAGTGG - Intergenic
1044700283 8:94959380-94959402 TGGGTTCTTGGAAGGGGAAGAGG + Intronic
1047849747 8:128843776-128843798 TGCCATCTCGGAAGTGGCAGGGG - Intergenic
1048472560 8:134716527-134716549 TAGCTTCTTTGAAGGGGCCCTGG - Intergenic
1049110855 8:140642288-140642310 CCGCTTCTCTGAAGAGGCAGCGG + Intergenic
1049207102 8:141368649-141368671 AGGCTTCCTGGAAGGGGCAGAGG + Intergenic
1049540829 8:143208044-143208066 TGGCCCCACTGGAGGGGCAGGGG - Intergenic
1049593105 8:143471524-143471546 TGGCTCCTGTGGTGGGGCAGAGG - Intronic
1049975939 9:861618-861640 TCACTTCCCAGAAGGGGCAGCGG + Intronic
1051368793 9:16340639-16340661 TTCCTTCTTTGAAGGGCCAGTGG - Intergenic
1060540875 9:124429274-124429296 TGGCTTCTCGACAGGGGAAGCGG + Intergenic
1060995312 9:127872428-127872450 TGGCTAGTCTGAGGGGACAGAGG + Intronic
1061820727 9:133226005-133226027 TGGCTTCTCCCATGGGGAAGAGG + Intergenic
1061919881 9:133776815-133776837 TGGAACCTCTGAAGGTGCAGGGG - Intronic
1061987216 9:134136533-134136555 GTCCTTCCCTGAAGGGGCAGTGG - Intronic
1062238547 9:135524061-135524083 TGGCTTCTCCCATGGGGAAGAGG - Intronic
1186092230 X:6062374-6062396 AGGCTTGTCTGTAGGGGCAAAGG - Intronic
1188860127 X:35245164-35245186 TGCCCTCTCTGAAGTGGCCGAGG + Intergenic
1189660336 X:43290223-43290245 TGGCTTCCAAGAAGTGGCAGTGG - Intergenic
1190574873 X:51825184-51825206 TTGCTACTCTGAAGGGGAAGAGG + Intronic
1193425341 X:81335693-81335715 TGGCCTCTCTAGAGAGGCAGGGG + Intergenic
1194753317 X:97707989-97708011 TGGCTTCTCTGAAGTTTCTGGGG - Intergenic
1196714010 X:118793817-118793839 TGGCTTCTCTGAGGAAGCTGGGG + Exonic
1196794421 X:119490776-119490798 TGGCTTCTCTGCACCTGCAGAGG - Intergenic
1197349701 X:125369329-125369351 TGGTTTTTCTGAAAGGGGAGAGG + Intergenic
1197987601 X:132283611-132283633 TGGCGTCTCAGAAGGGGGAAGGG - Intergenic
1198312443 X:135435610-135435632 AGGCCTCTCTGAGGGAGCAGCGG + Intergenic
1198571329 X:137960282-137960304 TGACAGCTCTGAAGGAGCAGTGG + Intergenic
1199861742 X:151807107-151807129 AGGCTTCCCTGAAGGAGGAGAGG - Intergenic
1200073324 X:153539466-153539488 GGGCTTCTGAGGAGGGGCAGGGG - Intronic
1200125500 X:153812260-153812282 TGGCTTCTCCTCAAGGGCAGTGG - Intronic
1200703151 Y:6419300-6419322 AGGCCTCTGTGAAGGTGCAGTGG - Intergenic
1201030959 Y:9745407-9745429 AGGCCTCTGTGAAGGTGCAGTGG + Intergenic
1201485999 Y:14495280-14495302 TTGCTTCTCTGACAAGGCAGGGG + Intergenic
1201625575 Y:16011466-16011488 TGGTTTTTGTGAAGGGCCAGAGG - Intergenic