ID: 954089974

View in Genome Browser
Species Human (GRCh38)
Location 3:48276590-48276612
Sequence GGTCAGTGGCTTCTCTGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 3, 1: 1, 2: 6, 3: 18, 4: 173}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954089974_954089981 -2 Left 954089974 3:48276590-48276612 CCCCTTCAGAGAAGCCACTGACC 0: 3
1: 1
2: 6
3: 18
4: 173
Right 954089981 3:48276611-48276633 CCCCGTGCCTTGCTTATGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 146
954089974_954089979 -3 Left 954089974 3:48276590-48276612 CCCCTTCAGAGAAGCCACTGACC 0: 3
1: 1
2: 6
3: 18
4: 173
Right 954089979 3:48276610-48276632 ACCCCGTGCCTTGCTTATGGCGG 0: 1
1: 0
2: 0
3: 11
4: 79
954089974_954089988 21 Left 954089974 3:48276590-48276612 CCCCTTCAGAGAAGCCACTGACC 0: 3
1: 1
2: 6
3: 18
4: 173
Right 954089988 3:48276634-48276656 GGTACCAAGGCACCCCAAGTTGG 0: 1
1: 1
2: 2
3: 4
4: 81
954089974_954089987 8 Left 954089974 3:48276590-48276612 CCCCTTCAGAGAAGCCACTGACC 0: 3
1: 1
2: 6
3: 18
4: 173
Right 954089987 3:48276621-48276643 TGCTTATGGCGGGGGTACCAAGG 0: 1
1: 0
2: 3
3: 5
4: 48
954089974_954089985 0 Left 954089974 3:48276590-48276612 CCCCTTCAGAGAAGCCACTGACC 0: 3
1: 1
2: 6
3: 18
4: 173
Right 954089985 3:48276613-48276635 CCGTGCCTTGCTTATGGCGGGGG 0: 1
1: 0
2: 0
3: 3
4: 45
954089974_954089989 22 Left 954089974 3:48276590-48276612 CCCCTTCAGAGAAGCCACTGACC 0: 3
1: 1
2: 6
3: 18
4: 173
Right 954089989 3:48276635-48276657 GTACCAAGGCACCCCAAGTTGGG 0: 1
1: 1
2: 3
3: 6
4: 143
954089974_954089983 -1 Left 954089974 3:48276590-48276612 CCCCTTCAGAGAAGCCACTGACC 0: 3
1: 1
2: 6
3: 18
4: 173
Right 954089983 3:48276612-48276634 CCCGTGCCTTGCTTATGGCGGGG 0: 1
1: 0
2: 0
3: 1
4: 36
954089974_954089978 -6 Left 954089974 3:48276590-48276612 CCCCTTCAGAGAAGCCACTGACC 0: 3
1: 1
2: 6
3: 18
4: 173
Right 954089978 3:48276607-48276629 CTGACCCCGTGCCTTGCTTATGG 0: 1
1: 0
2: 0
3: 10
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954089974 Original CRISPR GGTCAGTGGCTTCTCTGAAG GGG (reversed) Intronic
900531632 1:3156684-3156706 GGACGGAGGCTTCTCTGAACGGG - Intronic
903266802 1:22162738-22162760 CCTCAGTGTCTTCTCAGAAGGGG + Intergenic
904853597 1:33478405-33478427 TGGCAGTGCCTTCACTGAAGGGG + Intronic
906801134 1:48737978-48738000 GGTCAGAGACATCTCTGGAGAGG + Intronic
907996227 1:59635581-59635603 GAACAGTGGCTATTCTGAAGTGG + Intronic
908650284 1:66325514-66325536 GGTCAGTGGCCTTTCAGATGTGG - Intronic
909395804 1:75169504-75169526 GGTGGGTGGGTGCTCTGAAGTGG + Intergenic
909869621 1:80722924-80722946 GGCCAGGGGCTTATCTGTAGTGG + Intergenic
909955966 1:81779303-81779325 GGTCAGGGTCCTCTCTGAAGTGG + Intronic
910950861 1:92646860-92646882 TGTCAGTGGTTTACCTGAAGTGG - Intronic
912646782 1:111400504-111400526 GCACAGTGGCTTCTATGTAGAGG + Intergenic
912648208 1:111415016-111415038 GGTCAGGGCCTTCTCTCCAGGGG + Exonic
912944618 1:114074789-114074811 GGTCAGTGGTTTCCCTCAAAGGG - Intergenic
915507296 1:156366062-156366084 GGTCAGGGGCTTCTCAGAGGAGG + Intronic
915805925 1:158849794-158849816 GGTAATTGGTTTCTCTGAAGGGG + Intergenic
919934948 1:202245280-202245302 GGGCAGAGGCTGCTCTGAGGTGG + Intronic
923549785 1:234954458-234954480 AGGCAGTGGCTTCTCTGACATGG - Intergenic
1064893900 10:20211708-20211730 GGACAGTGGATGCCCTGAAGAGG + Exonic
1067860780 10:49845515-49845537 GAGCTGAGGCTTCTCTGAAGAGG - Intronic
1072001462 10:91199538-91199560 GCCCAAAGGCTTCTCTGAAGAGG + Intronic
1073171411 10:101512041-101512063 TGTCTTTGCCTTCTCTGAAGAGG - Intronic
1074869457 10:117565287-117565309 GGAGAGTGTCTTCTCTCAAGGGG + Intergenic
1075707803 10:124512248-124512270 GGTCGGGGGCCTCTCTGATGTGG + Intronic
1076518125 10:131061614-131061636 TCTCAGGGGCTTCTATGAAGGGG - Intergenic
1077451090 11:2645953-2645975 GGTCAGGGGGTTCTCTGACTAGG + Intronic
1077825706 11:5806315-5806337 GGTCAGTGGTTTCTCTGAAGGGG + Intronic
1081423879 11:42903678-42903700 GGCCAGATACTTCTCTGAAGGGG - Intergenic
1083285256 11:61654643-61654665 GGTAAGTCACTTCTCTGCAGGGG - Intergenic
1083290277 11:61686116-61686138 GGGCAGTGGCCACTCTGCAGGGG + Intronic
1084771986 11:71349337-71349359 CCTCAGTTGCTTCTGTGAAGTGG - Intergenic
1086503507 11:87478348-87478370 TGTCAGTGGTTTATATGAAGTGG - Intergenic
1088245321 11:107812760-107812782 AGTCCGTGGCTTGTCAGAAGTGG - Intronic
1092284811 12:7122560-7122582 GGTCAGTGGAGTCTCGGCAGAGG - Intergenic
1092605231 12:10111507-10111529 GGTCGGTGGGTTCCCTGAGGCGG + Intronic
1092855603 12:12670785-12670807 GGTAAATGGCTTTTGTGAAGGGG + Intronic
1099976380 12:89549910-89549932 AGTCGTAGGCTTCTCTGAAGAGG - Intergenic
1100005728 12:89892799-89892821 GGTCAGTGGCTGATCTGAAGTGG + Intergenic
1100391827 12:94150472-94150494 GTTCAATGGCTTCTCTGCCGAGG - Intronic
1103011534 12:117461983-117462005 TGTAAGTGGCTTGTCTGTAGCGG - Exonic
1103821592 12:123702969-123702991 GTTCTATGGCTCCTCTGAAGGGG - Intronic
1104203556 12:126615120-126615142 GGTCAGTGGCTTCTCTGAAGGGG + Intergenic
1104264460 12:127218671-127218693 GGTGAGTGCCTTGTCTGAGGTGG + Intergenic
1104356936 12:128095255-128095277 GGTGAGTGGCTTTTCTCCAGGGG + Intergenic
1104430375 12:128711189-128711211 AGGCAGTGGCTTTTGTGAAGTGG - Intergenic
1107051463 13:36055072-36055094 GGTCACTGGGTTCGCTGAAAAGG + Intronic
1108418832 13:50228305-50228327 AGACAGTGGCTTTTCTGTAGGGG - Intronic
1112760976 13:102692872-102692894 TGTCAGTGGCTTCCCAAAAGAGG - Intronic
1113521839 13:110947038-110947060 GGCCAGGAGCTTCTCTGAAGTGG - Intergenic
1113706052 13:112433664-112433686 GGCCAAGAGCTTCTCTGAAGTGG + Intronic
1113882948 13:113637991-113638013 GGTCTGTGGCTGCTCTGACGTGG + Intronic
1113990600 14:16024603-16024625 GGTCAGTGGCTCCTCTTTCGCGG - Intergenic
1116097988 14:40396518-40396540 GCTCAGTGTATTCTCAGAAGTGG + Intergenic
1117488802 14:56225753-56225775 AGTCAGAGGCTTCTCTGGATAGG - Intronic
1122782120 14:104148072-104148094 GGGCAGTGGCTTGGCTGGAGTGG + Intronic
1125657125 15:41367204-41367226 GGTCAGGGGCTTCTCTGCAGGGG + Intronic
1127536690 15:59896392-59896414 GGTCAGTTGATTGCCTGAAGGGG + Intergenic
1129691428 15:77715850-77715872 TGTCCCTGGCTGCTCTGAAGGGG + Intronic
1130062413 15:80579342-80579364 GTTCAGTGGCTTATATAAAGGGG - Intronic
1130559193 15:84945285-84945307 GTCCTGTGGCTTCCCTGAAGAGG - Exonic
1131425078 15:92339402-92339424 TGGCAGTGCCTTCTCTGAAAGGG - Intergenic
1132878769 16:2151908-2151930 GGTCAGTGGCTTTCCTGGTGGGG + Exonic
1133220740 16:4318135-4318157 GGTCAGTGGCTTCTGGGGATTGG + Intronic
1136253679 16:29024267-29024289 GGTCAGTGTCCTCTGTGAAATGG + Intergenic
1136378784 16:29881180-29881202 GCTCAGTGGCTTCCCTCCAGAGG - Intronic
1138661669 16:58522757-58522779 GGTCAGGAGTTTCTCTGAGGTGG - Intronic
1139953552 16:70683061-70683083 GCACAGTGGCTGCTCTGGAGTGG + Intronic
1141050598 16:80759617-80759639 CTTCTGTGGCTTCTCTGAGGTGG + Intronic
1143745601 17:8991922-8991944 GGTCAGAGGATTCACTGAGGAGG - Intergenic
1144357945 17:14463508-14463530 GGTCTGTGGCTCCTCTAAAAAGG + Intergenic
1144463701 17:15479501-15479523 GGTCAATGGCTTCTTAAAAGTGG + Intronic
1145366336 17:22269527-22269549 GATGAGTGGCTTCTTTGCAGAGG - Intergenic
1146403161 17:32516313-32516335 GGTGAGTGGTTTCTGTGATGTGG - Intronic
1149569501 17:57662532-57662554 GGATAGTAGCTTATCTGAAGTGG + Intronic
1151506021 17:74527692-74527714 GGTCTGTTGCTGCTTTGAAGTGG + Intronic
1157831112 18:50857812-50857834 GGACAGTGGCTTCTCTGTTGAGG - Intergenic
1158225760 18:55199470-55199492 GCTCACTGGCTTCCTTGAAGAGG - Intergenic
1160398165 18:78587533-78587555 GTTCAGCAACTTCTCTGAAGTGG - Intergenic
1161755092 19:6127118-6127140 GGTCCGTGGCTTTTCAAAAGTGG - Intronic
1162728414 19:12703263-12703285 TGTGATTGGCTTCTCTAAAGAGG - Intronic
1163421552 19:17216173-17216195 GGCCAGTGCTTTCTCTGAGGAGG - Exonic
1166442869 19:42831260-42831282 GGTTTGTGTTTTCTCTGAAGAGG - Intronic
926901302 2:17754095-17754117 GGTCAGTCACTTCCCGGAAGAGG + Intronic
927295383 2:21447157-21447179 GTTCAGTGTCCTCTCTGCAGTGG - Intergenic
931063720 2:58560688-58560710 GGTAAGTAGTTTCTCTGCAGAGG - Intergenic
931505679 2:62923454-62923476 GGTCAGGGACTTTTCTGTAGAGG - Intronic
932302098 2:70674732-70674754 GGTCAGTGAGTTGGCTGAAGGGG + Exonic
932520098 2:72403326-72403348 GGCAAGTGTCTTCACTGAAGTGG + Intronic
934938048 2:98479436-98479458 AGTCAGTGGCATCTCTGCATGGG + Intronic
935183362 2:100709458-100709480 TGGCAAAGGCTTCTCTGAAGTGG - Intergenic
936957502 2:118037739-118037761 GTGCCGTGGCTTCTCTTAAGGGG + Intergenic
937334002 2:121049625-121049647 TGTCAGGGGCTTCTCTGAAGTGG - Intergenic
940797859 2:158099517-158099539 GGGCAGTGTCTTCTGGGAAGGGG + Intronic
944294736 2:198049420-198049442 TCTCTGTGGCTTCTCTGAAAAGG - Intronic
946129525 2:217595174-217595196 AGTTAGTGGCTTCTGGGAAGAGG - Intronic
946947620 2:224837848-224837870 GTTCAGTGGCCTTTCTGGAGAGG + Intronic
947548792 2:231031891-231031913 GATAAGAGGCTTCTCTAAAGTGG + Intergenic
948865274 2:240771862-240771884 GGGCTGTGACATCTCTGAAGTGG + Intronic
1171221436 20:23401520-23401542 GATCAGTGGCCTCTCTGAAATGG + Intronic
1173482809 20:43416578-43416600 GGCCAGGGGCTTGTCTGTAGGGG - Intergenic
1174159955 20:48543511-48543533 GGTCTGGGGCATCTCTGCAGGGG - Intergenic
1174325307 20:49774124-49774146 CTTCAGTTTCTTCTCTGAAGTGG - Intergenic
1174525308 20:51165696-51165718 AGCCCGTGGCTTCTCTGATGAGG + Intergenic
1175897806 20:62347083-62347105 GCTCAGTCCCTTCCCTGAAGGGG + Intronic
1177766441 21:25462801-25462823 GTACAGTGGCTTATATGAAGAGG + Intergenic
1180316670 22:11282923-11282945 GGTCAGTGGCTCCTCTTTCGCGG + Intergenic
1180661008 22:17467275-17467297 GTTCACTGGCTTCTCATAAGAGG - Intronic
1181319251 22:21991850-21991872 GGTAAATGGCTTCCCTGATGAGG - Intergenic
1184244115 22:43227295-43227317 GGACAGTGGCTTTTCTGAGGTGG - Intronic
1185304714 22:50108208-50108230 TCTCAGTGGCTTCACTGAGGTGG - Exonic
950438641 3:12994666-12994688 GGCCAGTGGCTTCCCTGCTGTGG - Intronic
950614886 3:14150509-14150531 GGTGAATGGCTTCTCAGAAAGGG - Intronic
952954851 3:38550554-38550576 GGGCAGCGGCCTCTCCGAAGAGG - Exonic
953643266 3:44729232-44729254 TGTCAGGGGTTTCTGTGAAGAGG + Intergenic
953760500 3:45683225-45683247 GGACAGGGACATCTCTGAAGGGG + Exonic
954089974 3:48276590-48276612 GGTCAGTGGCTTCTCTGAAGGGG - Intronic
955694677 3:61624017-61624039 GTTCAGTGGCTGCTCTTTAGGGG - Intronic
958481921 3:94654099-94654121 GGTCAGGGTCATGTCTGAAGAGG + Intergenic
959491111 3:106989462-106989484 GTACAGTGGTTTCTCTGAGGAGG - Intergenic
960572532 3:119199291-119199313 GGACAGTGGGTTCTCTTGAGAGG + Intronic
960659595 3:120043507-120043529 GGTCAGTGGCTTTTCTGGAGGGG - Intronic
961516924 3:127443816-127443838 GGCCTGTGGCTTGCCTGAAGTGG - Intergenic
963077275 3:141358836-141358858 TGTCAGTGGCTTCTTTGATTTGG + Intronic
963645147 3:147904544-147904566 AGCCACTGGCTTATCTGAAGTGG - Intergenic
965143780 3:164871303-164871325 GGTAAATGGATTCTCTGTAGAGG - Intergenic
969145095 4:5115626-5115648 GGTCAGGAGCTTCTCTGCACTGG - Intronic
969328859 4:6461369-6461391 GCCCAGTGGCTACTCTGCAGTGG - Intronic
969882318 4:10185070-10185092 GGTCAAAGGATTCTCTAAAGTGG - Intergenic
970373504 4:15433047-15433069 GGACAGTGGCTTCTCAGACATGG - Intronic
970872323 4:20830094-20830116 GGTCAGAGTCATCTCTGAATAGG + Intronic
971219700 4:24693511-24693533 GGTCAGTGTGTTCTATGAATGGG - Intergenic
971628311 4:28953631-28953653 AGTCATTGGCTCCTATGAAGAGG - Intergenic
977718875 4:100215354-100215376 GGTCAGAGGCTTGCCAGAAGGGG + Intergenic
979171961 4:117611227-117611249 GATGAGTGGCACCTCTGAAGTGG - Intergenic
979632114 4:122915021-122915043 GGTCAGGGGCTTTTCTGAGAAGG + Intronic
980508912 4:133759737-133759759 GGTCAGCGTCCTGTCTGAAGAGG + Intergenic
981076599 4:140598556-140598578 GGTCAGTGGCTTCTCTGAAGTGG + Intergenic
992552289 5:77870233-77870255 GGTCAGGGGCTTCTCAGTGGAGG + Intergenic
992945343 5:81803850-81803872 GGCCAGGGGCTTCTCTGCAGGGG - Intergenic
997574618 5:134964830-134964852 TGACAGTGGTTTCTCTGATGTGG + Exonic
998288057 5:140883339-140883361 GCTGAGTGTCTTCTCTGATGGGG - Exonic
1000809708 5:165845814-165845836 GGTCAGTGCCTTCTCCAAACTGG + Intergenic
1001553434 5:172620515-172620537 GGTCATTGGCTTCTAAGAAGTGG + Intergenic
1001917865 5:175576424-175576446 GGTCAGTGGCTTGTCCGAGGTGG - Intergenic
1002103119 5:176867142-176867164 GGTCATTGGCTTATCAGAAAGGG - Intronic
1003362694 6:5443950-5443972 TTTCAGTGGCTTCTCTGCAGAGG - Intronic
1003637461 6:7846013-7846035 GGTCATTGGCTTCTGTGTATTGG - Intronic
1003812125 6:9796079-9796101 GGTCAGGGGCTGCCCTGCAGAGG + Intronic
1007330477 6:41103107-41103129 GGTCATAGGCTCCTCTGAGGAGG + Intergenic
1007955003 6:45909877-45909899 GATCTGGGGCTTCTCTGAATGGG - Intronic
1010017778 6:71124442-71124464 GCTCAGTGGGGTCTCTGAAAGGG + Intergenic
1010872072 6:81055851-81055873 AGTTAGTGGCTTCTCTTAAGAGG + Intergenic
1011211991 6:84965083-84965105 GGTCAGCAGCTTCTCTGAAGGGG + Intergenic
1013514218 6:110870946-110870968 GCTTAGTGACTTCTCAGAAGAGG + Intronic
1019322203 7:420866-420888 GTGCAGGGGCTTCTCTGCAGGGG + Intergenic
1019452564 7:1107375-1107397 AGTCACTGGCTTCTGTGTAGTGG - Intronic
1019857915 7:3627790-3627812 GATGAGTGCCTTATCTGAAGTGG + Intronic
1022479499 7:30733759-30733781 AGTCAGTGGCTGCTGTGACGAGG + Intronic
1030788766 7:113696957-113696979 GGTCTGTGGTTGCTCTGCAGAGG + Intergenic
1033951543 7:146790874-146790896 GGTCAGTGATTTCTATGCAGGGG + Intronic
1034669562 7:152847778-152847800 GGCCAGTGGGTTTTCCGAAGAGG + Intronic
1034740267 7:153467013-153467035 GTTGAGTGGCTTCTCTGCATAGG + Intergenic
1034982450 7:155487753-155487775 GAACAGTGGCTTCTCTGAGGAGG + Intronic
1035567669 8:652111-652133 GGGCAATCGCTTGTCTGAAGAGG - Intronic
1036480535 8:9135202-9135224 TGTCAGTGGCTCTACTGAAGGGG - Intergenic
1037446191 8:18968168-18968190 AGCCAGTGGCTGCCCTGAAGTGG - Intronic
1039241749 8:35564756-35564778 GGACACTGGATTCTCAGAAGTGG - Intronic
1039547454 8:38420337-38420359 GGTCTGTGTCATCTCTGTAGGGG + Intronic
1039770492 8:40681550-40681572 GGTGAGGTGCTTCCCTGAAGAGG - Intronic
1040474246 8:47763031-47763053 GGGCACAGGCTTCTCTGCAGGGG - Intergenic
1040876609 8:52158933-52158955 TGTCTGTGGCTTCCCTGCAGCGG + Exonic
1041137789 8:54778812-54778834 GGTCAGTGGCTACTTGGAGGTGG + Intergenic
1042345400 8:67721682-67721704 GATCAATGGCTTCTCAAAAGTGG + Intronic
1043614231 8:82105481-82105503 TGTCAGTGTCTTGTCTGAATAGG + Intergenic
1044029789 8:87222373-87222395 AGTCAGTTTCTTCTCTCAAGAGG + Intronic
1044700282 8:94959374-94959396 GGTCAATGGGTTCTTGGAAGGGG + Intronic
1046051011 8:109022698-109022720 GGTCTGTGGCTTTCCTGAAATGG + Intergenic
1046829672 8:118730667-118730689 GGGCATAGTCTTCTCTGAAGAGG - Intergenic
1048558006 8:135500457-135500479 GAACAGAGGCTACTCTGAAGAGG + Intronic
1048791339 8:138106915-138106937 GGTCACACGCTTCTCTGAGGAGG + Intergenic
1050148627 9:2596986-2597008 GATCAGCGGCTTCTGTGAAGGGG + Intergenic
1050729661 9:8694346-8694368 GGTTAGAGGCTTCTCTAAATTGG - Intronic
1053587159 9:39471154-39471176 TGGCAGGCGCTTCTCTGAAGAGG + Intergenic
1054579146 9:66894079-66894101 TGGCAGGGGCTTCTCTGAAGAGG - Intronic
1055707231 9:79018809-79018831 GGTTGGTGGTTTCTCTGCAGTGG + Intergenic
1056074236 9:83022033-83022055 GGTAAGAGGCCTCTTTGAAGGGG - Intronic
1057972371 9:99570408-99570430 AGTCAGTGGCTGCTCTGAAAGGG - Intergenic
1059533125 9:115056295-115056317 AGACAGTGCCTTCTCTGGAGAGG - Intronic
1060315220 9:122503575-122503597 GTTCAGTGTCTTCTCTGAAGTGG + Intergenic
1060321113 9:122562084-122562106 GGTCAGGGTCTTGCCTGAAGAGG + Intergenic
1060490400 9:124079957-124079979 GGTCTGTTTCTTCTCTGAAATGG + Intergenic
1060553806 9:124498314-124498336 GGTCACCAGCTTCTCTAAAGGGG - Intronic
1060962380 9:127690301-127690323 GGTCAGTGGATTCTCCCAGGGGG + Intronic
1185503577 X:616761-616783 GGGCAGGGTCTTCTCTGAAATGG - Intergenic
1186265983 X:7834264-7834286 TATTAGAGGCTTCTCTGAAGTGG - Intergenic
1188446828 X:30262394-30262416 GGTCTGTGGGTTGGCTGAAGTGG - Intergenic
1191858211 X:65644645-65644667 GGTCAGGGACTTCTCAGATGAGG + Intronic
1195670579 X:107466450-107466472 GGTCATTGGCTTCTCAGCTGGGG + Intergenic
1196757982 X:119174425-119174447 GGTCAGAGGCCTCTGTGATGTGG - Intergenic
1198040283 X:132844257-132844279 AGTCAGTGGCTTCCCTGAAAAGG - Intronic
1199582152 X:149371167-149371189 GGCAAGTGGCTTCTCTGGAATGG - Intergenic
1200150004 X:153946712-153946734 GGACAGAGGCTTCCCAGAAGAGG + Intergenic