ID: 954089975

View in Genome Browser
Species Human (GRCh38)
Location 3:48276591-48276613
Sequence GGGTCAGTGGCTTCTCTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 3, 1: 0, 2: 3, 3: 19, 4: 181}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954089975_954089989 21 Left 954089975 3:48276591-48276613 CCCTTCAGAGAAGCCACTGACCC 0: 3
1: 0
2: 3
3: 19
4: 181
Right 954089989 3:48276635-48276657 GTACCAAGGCACCCCAAGTTGGG 0: 1
1: 1
2: 3
3: 6
4: 143
954089975_954089978 -7 Left 954089975 3:48276591-48276613 CCCTTCAGAGAAGCCACTGACCC 0: 3
1: 0
2: 3
3: 19
4: 181
Right 954089978 3:48276607-48276629 CTGACCCCGTGCCTTGCTTATGG 0: 1
1: 0
2: 0
3: 10
4: 88
954089975_954089983 -2 Left 954089975 3:48276591-48276613 CCCTTCAGAGAAGCCACTGACCC 0: 3
1: 0
2: 3
3: 19
4: 181
Right 954089983 3:48276612-48276634 CCCGTGCCTTGCTTATGGCGGGG 0: 1
1: 0
2: 0
3: 1
4: 36
954089975_954089979 -4 Left 954089975 3:48276591-48276613 CCCTTCAGAGAAGCCACTGACCC 0: 3
1: 0
2: 3
3: 19
4: 181
Right 954089979 3:48276610-48276632 ACCCCGTGCCTTGCTTATGGCGG 0: 1
1: 0
2: 0
3: 11
4: 79
954089975_954089981 -3 Left 954089975 3:48276591-48276613 CCCTTCAGAGAAGCCACTGACCC 0: 3
1: 0
2: 3
3: 19
4: 181
Right 954089981 3:48276611-48276633 CCCCGTGCCTTGCTTATGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 146
954089975_954089987 7 Left 954089975 3:48276591-48276613 CCCTTCAGAGAAGCCACTGACCC 0: 3
1: 0
2: 3
3: 19
4: 181
Right 954089987 3:48276621-48276643 TGCTTATGGCGGGGGTACCAAGG 0: 1
1: 0
2: 3
3: 5
4: 48
954089975_954089988 20 Left 954089975 3:48276591-48276613 CCCTTCAGAGAAGCCACTGACCC 0: 3
1: 0
2: 3
3: 19
4: 181
Right 954089988 3:48276634-48276656 GGTACCAAGGCACCCCAAGTTGG 0: 1
1: 1
2: 2
3: 4
4: 81
954089975_954089985 -1 Left 954089975 3:48276591-48276613 CCCTTCAGAGAAGCCACTGACCC 0: 3
1: 0
2: 3
3: 19
4: 181
Right 954089985 3:48276613-48276635 CCGTGCCTTGCTTATGGCGGGGG 0: 1
1: 0
2: 0
3: 3
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954089975 Original CRISPR GGGTCAGTGGCTTCTCTGAA GGG (reversed) Intronic
900504857 1:3024882-3024904 GGGTCAGTGGGCTCCCTGCAGGG - Intergenic
900531633 1:3156685-3156707 AGGACGGAGGCTTCTCTGAACGG - Intronic
901709752 1:11104492-11104514 GGCACAGTGGCTTCTCTGGGAGG + Intergenic
903941985 1:26938237-26938259 GGGTCAGAGGCTGCTGTGATTGG + Intronic
904856008 1:33498802-33498824 AGGGCATTGGCTCCTCTGAAGGG + Intergenic
904960737 1:34330820-34330842 GGGTCAGTGTATCCTCTTAAGGG + Intergenic
905105253 1:35559937-35559959 GGATCAGGGACTTCTCTGGAGGG + Intronic
907261756 1:53223465-53223487 GTGACAGTGAATTCTCTGAAAGG - Intergenic
907421962 1:54353654-54353676 GGGTCAGAGGCTGCTCTCGAGGG + Intronic
907938731 1:59066483-59066505 GGGTGAGTGACTTCTTTCAAAGG + Intergenic
908043477 1:60142296-60142318 GGACCAGTGGCTTTTCTTAATGG + Intergenic
910520297 1:88113642-88113664 CAGTCAGAGGCTTCTCTGCAAGG - Intergenic
912545751 1:110450240-110450262 GGGTCAGGGGCTTCCCTCACAGG + Intergenic
912648207 1:111415015-111415037 GGGTCAGGGCCTTCTCTCCAGGG + Exonic
912944619 1:114074790-114074812 AGGTCAGTGGTTTCCCTCAAAGG - Intergenic
912974396 1:114314826-114314848 AGGTCAGTGGCCTCCCTCAAGGG + Intergenic
915526961 1:156481825-156481847 GGGTCAGTGCCTGCTTTGAAGGG - Intronic
915805924 1:158849793-158849815 GGGTAATTGGTTTCTCTGAAGGG + Intergenic
916818217 1:168373448-168373470 GGGACAGTGGCTTCTGAGACAGG + Intergenic
916983679 1:170167291-170167313 GGGACAGAGGCTTCTCTAAGAGG + Intronic
919355638 1:196517788-196517810 GAGTCACTGGCATCCCTGAAAGG + Intronic
920317420 1:205087614-205087636 GGCTCAGTAGCTTCTCTGAGTGG - Exonic
920848141 1:209610667-209610689 GGGTCAGGGGCTTCAGGGAAGGG - Intronic
921217930 1:212952554-212952576 GGCTCACTGGCTTCTCTCCAAGG - Intronic
921276494 1:213525813-213525835 GGGGCATTGGTTTCTTTGAAAGG + Intergenic
922981550 1:229831273-229831295 GGGTCATTGGTTTCTCCAAATGG - Intergenic
923733007 1:236571398-236571420 GGGTCTGCGGCATCTCCGAAAGG + Exonic
1063447056 10:6125854-6125876 TGTTCAGTGGCTTCAGTGAAGGG - Intergenic
1064352065 10:14585457-14585479 GGGTCCGTGGCTTCACCTAAAGG - Intronic
1064448548 10:15420066-15420088 GGGTCATTGGCTTGTCTATATGG + Intergenic
1064544793 10:16439233-16439255 AGGACAGTGGCTTTTCTGGAGGG + Intronic
1072917292 10:99545988-99546010 GGTCCAGTGGCTTCTCTTCAGGG + Intergenic
1073630423 10:105142607-105142629 GGGTCAGCTGATTCTCAGAAGGG - Intronic
1073873992 10:107899979-107900001 GGTTCAGTGACTTATCTAAAAGG + Intergenic
1074869456 10:117565286-117565308 GGGAGAGTGTCTTCTCTCAAGGG + Intergenic
1075943688 10:126413258-126413280 GGGCGAGTAGCTTCTCTGCAAGG + Intergenic
1076518126 10:131061615-131061637 GTCTCAGGGGCTTCTATGAAGGG - Intergenic
1076802392 10:132836613-132836635 GGGTGTGTGGCGTCTCTGGACGG + Intronic
1077529367 11:3087999-3088021 GGGGCACTGGCCTCTCTGCAGGG - Exonic
1077825705 11:5806314-5806336 AGGTCAGTGGTTTCTCTGAAGGG + Intronic
1079876334 11:25861912-25861934 GGGTCATTGCCTTTTCTAAAGGG - Intergenic
1082792906 11:57359479-57359501 GGGTCGGGGGCTCCTCTGACAGG - Intronic
1083703644 11:64498285-64498307 GGGACAGTGGCTTCTCTGTGAGG - Intergenic
1085629345 11:78100780-78100802 GGGCCAGTGGCTTCTCACCATGG + Intergenic
1088992964 11:114970581-114970603 GGGTCAGTTTATTCTCTAAATGG + Intergenic
1091251074 11:134144784-134144806 GGGTCACTGGCTTCACTGTGGGG - Exonic
1092855602 12:12670784-12670806 GGGTAAATGGCTTTTGTGAAGGG + Intronic
1094731484 12:33181186-33181208 GGGACAGGGGCTTCTCTGAGAGG + Intergenic
1097016985 12:55994198-55994220 GGGCCAGTGGCTTCTGGGAAAGG - Exonic
1098306822 12:69110593-69110615 GGGTCAGTAGCTTGTGTGATAGG - Intergenic
1099671837 12:85704063-85704085 GACTCAGTGACTTCTCTAAAAGG + Intergenic
1102349135 12:112179317-112179339 GGCTCAGCGTCTGCTCTGAATGG + Exonic
1103821593 12:123702970-123702992 GGTTCTATGGCTCCTCTGAAGGG - Intronic
1104042778 12:125141293-125141315 GGGTCAGTGGGGTGTCTGGAGGG + Intronic
1104203555 12:126615119-126615141 GGGTCAGTGGCTTCTCTGAAGGG + Intergenic
1107087245 13:36438636-36438658 GGGTCTGTGCCTTATCTGATTGG - Exonic
1108418833 13:50228306-50228328 GAGACAGTGGCTTTTCTGTAGGG - Intronic
1110436884 13:75485462-75485484 GAGTCAGTAGTTCCTCTGAAGGG + Intergenic
1110813185 13:79833217-79833239 GGGTCAGTGTTTTCTCTTATTGG + Intergenic
1115707808 14:36015936-36015958 TGGTCAGTGGCTTCTCATATTGG + Intergenic
1116875847 14:50111018-50111040 GGGTAAGAGGCTTCTCTGGGGGG + Intronic
1118169426 14:63372371-63372393 GGCTCAGCTGCTTCTCTGAGTGG - Exonic
1118885147 14:69859935-69859957 TGGTCTGTGGCCTCTCTGATTGG + Intronic
1123690654 15:22836047-22836069 TGGTCAGTGGCTGGTCTCAATGG + Intergenic
1124706857 15:31973786-31973808 GAGTCAGTTGCTTCCCTGAATGG + Intergenic
1125657124 15:41367203-41367225 AGGTCAGGGGCTTCTCTGCAGGG + Intronic
1125805520 15:42490689-42490711 AGGTCAGTGGCTTCCCCTAAAGG + Intronic
1126238959 15:46418971-46418993 TGGTCAATAGCTTCGCTGAAGGG + Intergenic
1126553271 15:49956472-49956494 GGGCCAGTTTCTTCTCTGGATGG - Intronic
1127536689 15:59896391-59896413 GGGTCAGTTGATTGCCTGAAGGG + Intergenic
1129691427 15:77715849-77715871 GTGTCCCTGGCTGCTCTGAAGGG + Intronic
1131425079 15:92339403-92339425 CTGGCAGTGCCTTCTCTGAAAGG - Intergenic
1131859610 15:96638434-96638456 GTCTCAGTGGCATATCTGAAAGG - Intergenic
1137786352 16:51140604-51140626 TGGTGACTGGCTTCTCTGGAGGG + Exonic
1138624092 16:58235704-58235726 GGGGCAGTGGCTCCTCTCAGAGG + Intronic
1139591263 16:67934604-67934626 GGGTTAGTGGCTTCACTGTCTGG + Exonic
1146608889 17:34287433-34287455 GGGTTAGTTGCTGCTCTTAAAGG - Intronic
1146751759 17:35388274-35388296 GGGTCACTGGAATCCCTGAAAGG - Intergenic
1147956571 17:44138705-44138727 TGGTCAGTGGCTACTCTGTTGGG + Intergenic
1149850414 17:60030525-60030547 GGGCCAGGGGCTTCTGTGACAGG + Intergenic
1149859752 17:60115999-60116021 GGGCCAGGGGCTTCTGTGACAGG - Intergenic
1151942653 17:77302380-77302402 CGGCCAGGGGCTTCTCTTAATGG - Intronic
1154316705 18:13310038-13310060 GGTTCAATGTCTCCTCTGAAAGG - Intronic
1157446860 18:47752866-47752888 GGATCTGAGGCTTCTCTCAAGGG + Intergenic
1157721310 18:49926665-49926687 GGTTCAGTGGCTTATCCGCAAGG + Intronic
1160427534 18:78788294-78788316 GGGTCCTCGGCTTCTCTGAGAGG - Intergenic
1161723636 19:5916620-5916642 GGGCCAGGGGCTTCTGTGAGAGG - Exonic
1164211456 19:23101342-23101364 GAGTCTGTGACTTCACTGAAAGG + Intronic
1164290655 19:23866117-23866139 TGGTAAGTGGCCTCTCTGATGGG - Intergenic
1166092710 19:40520462-40520484 GGGTTCGTGGATTATCTGAAAGG + Intronic
1167607052 19:50487050-50487072 GCGCCTGTGGCTTCTCTCAATGG + Exonic
927505965 2:23615101-23615123 GGTTCAGTGTCTTTCCTGAAAGG - Intronic
930732933 2:54745341-54745363 GGGATAGTGCCTTCTATGAAAGG + Intronic
934137200 2:89007916-89007938 AGGTAAGTGGTTTCTCTGCATGG + Intergenic
934140068 2:89038143-89038165 AGGTGAGTGGTTTCTCTGCATGG + Intergenic
934229171 2:90162408-90162430 AGGTGAGTGGTTTCTCTGCATGG - Intergenic
934233903 2:90212577-90212599 AGGTAAGTGGTTTCTCTGCATGG - Intergenic
934938047 2:98479435-98479457 TAGTCAGTGGCATCTCTGCATGG + Intronic
935119354 2:100168731-100168753 AGGTCAGTGGATTCTATCAATGG - Intergenic
935270089 2:101427110-101427132 GGGTCACTGGCTTCTCTCTTAGG - Intronic
936014765 2:108949686-108949708 GGTTCAGTGGCCTCTCTGGTTGG - Intronic
938044169 2:128101658-128101680 AAGTCAGTAGCATCTCTGAATGG + Intronic
938402740 2:131006285-131006307 GGCTCAGTGGGTTCTCTGCTTGG - Intronic
939697463 2:145344151-145344173 GGGTCAGAACCTTCTCTCAATGG - Intergenic
940053478 2:149489272-149489294 GGCTCAGCGGCTTCTGTGGAAGG - Intergenic
940797858 2:158099516-158099538 GGGGCAGTGTCTTCTGGGAAGGG + Intronic
942440942 2:176035922-176035944 GGGTAAGTTGGTTCTCTTAATGG + Intergenic
943845189 2:192635772-192635794 GGGTAAATTGCTGCTCTGAAGGG + Intergenic
944268933 2:197759873-197759895 AGGTCAGGGGCTTGTCTGCAGGG - Intronic
945892901 2:215449089-215449111 GTGTCAGAGGCTTTTCTCAAAGG - Intergenic
947767491 2:232647031-232647053 GGGTCAGTGGCTCTGCTGGAGGG - Intronic
948312257 2:236996777-236996799 GGCTCTGTGGCAACTCTGAAAGG - Intergenic
1171248087 20:23629357-23629379 GGCTCTGTGCCTTCTCTGACTGG - Exonic
1174404865 20:50296507-50296529 GGGTCAGAGGCCTCACTGGAAGG + Intergenic
1175416033 20:58801669-58801691 AGGTCAGTGTGTTCACTGAATGG + Intergenic
1175630228 20:60529364-60529386 GCATCAGTGCCTTCTCTGCATGG - Intergenic
1175817588 20:61891539-61891561 GTGTCAGGGGCCTCTCGGAAGGG - Intronic
1178368438 21:32007161-32007183 GGGCCAGTGGGCTCTCAGAAGGG + Intronic
1180972823 22:19824546-19824568 GTGTTTGTGGCTTCTCTGGAAGG - Intronic
1184721666 22:46318099-46318121 GGGCCAGTGGCCTCACTGACTGG - Intronic
949733698 3:7145716-7145738 AGGTCAGAGGGTTCCCTGAAGGG + Intronic
950470938 3:13185954-13185976 TGCTCATTGTCTTCTCTGAAGGG - Intergenic
950614887 3:14150510-14150532 GGGTGAATGGCTTCTCAGAAAGG - Intronic
952252209 3:31665825-31665847 GGGTCAGGGGGTCCTCTGAAGGG + Intronic
952411674 3:33054987-33055009 GGGCCTTTGGCTTCTCTGTAAGG + Intronic
954089975 3:48276591-48276613 GGGTCAGTGGCTTCTCTGAAGGG - Intronic
960659596 3:120043508-120043530 GGGTCAGTGGCTTTTCTGGAGGG - Intronic
965750877 3:171973944-171973966 AGGTCAGTGACTTCTCTAAGTGG + Intergenic
969314936 4:6376295-6376317 GGGTCAGTGGAGCATCTGAAAGG + Intronic
969375491 4:6760851-6760873 GGGTCAGTCCCTTCTCTCTACGG + Intergenic
969414448 4:7049581-7049603 GGGACAGTGGGGTCTCCGAAAGG + Intronic
971219701 4:24693512-24693534 GGGTCAGTGTGTTCTATGAATGG - Intergenic
975671711 4:76787091-76787113 GGAAGAGTGGCTGCTCTGAACGG - Intergenic
981388837 4:144163664-144163686 GAATCACTGGCATCTCTGAAAGG - Intergenic
984843425 4:184089937-184089959 GGCTCAGTGGCTCTTCTCAAAGG + Exonic
985924186 5:3002976-3002998 GAGTCAGTTGCTGCTGTGAAGGG + Intergenic
986089491 5:4489788-4489810 GTGTCAGTTGGTTCTCTGCAAGG + Intergenic
986229575 5:5850608-5850630 GACTCATTGGCATCTCTGAAAGG + Intergenic
986308191 5:6531212-6531234 GGGCTAGAGGCTTCTCGGAAAGG + Intergenic
988888922 5:35592594-35592616 GGGGGAGGAGCTTCTCTGAATGG - Intergenic
990976023 5:61562743-61562765 GGATCAGTGGCTGCTCGGAGTGG - Intergenic
992608383 5:78485441-78485463 GGGTCAGTAGGTGCTCTGGAGGG - Exonic
992945344 5:81803851-81803873 AGGCCAGGGGCTTCTCTGCAGGG - Intergenic
993039523 5:82796971-82796993 GCATTAGTGGCCTCTCTGAATGG - Intergenic
997357543 5:133273481-133273503 GGGCCTGTGGCTCCTCTTAATGG + Intronic
998208622 5:140176720-140176742 GGGGCATTGGATTCGCTGAAAGG + Intronic
998288058 5:140883340-140883362 GGCTGAGTGTCTTCTCTGATGGG - Exonic
1002050188 5:176566137-176566159 GAGTCATTAGCTTCTGTGAAAGG - Intronic
1002103120 5:176867143-176867165 GGGTCATTGGCTTATCAGAAAGG - Intronic
1002724337 5:181284222-181284244 GGGGCAGAGGCTTCTCTGGCAGG + Intergenic
1006447115 6:34085851-34085873 TGGTCAGAGGCCTCTCTGAAGGG + Intronic
1006732553 6:36247154-36247176 TTGACAGTGGCTTCTCTGGAGGG - Intronic
1007955004 6:45909878-45909900 TGATCTGGGGCTTCTCTGAATGG - Intronic
1008620718 6:53269191-53269213 GGGTCCATGGCTGCTGTGAATGG - Exonic
1008788498 6:55199091-55199113 GGTTAAGGGGGTTCTCTGAAAGG + Intronic
1010017777 6:71124441-71124463 CGCTCAGTGGGGTCTCTGAAAGG + Intergenic
1011211990 6:84965082-84965104 GGGTCAGCAGCTTCTCTGAAGGG + Intergenic
1011236494 6:85224219-85224241 GGATGTCTGGCTTCTCTGAAAGG - Intergenic
1011749850 6:90444204-90444226 GGGTCCATGGCTTTGCTGAAAGG - Intergenic
1012382591 6:98638066-98638088 GGGGCAGTGGAGTCACTGAAGGG - Intergenic
1013305179 6:108841123-108841145 GGGTCACTGCCTTCTCTGTGGGG + Intergenic
1018762743 6:166905647-166905669 AGGTGTGTGACTTCTCTGAAAGG + Intronic
1020706229 7:11547078-11547100 GACTCACTGGCATCTCTGAAAGG + Intronic
1021737887 7:23657112-23657134 GGGTCAGTGGCTTCTCTGAAGGG - Intergenic
1025120882 7:56301069-56301091 GGCTCAGCTGCTTCTCTGAGTGG - Intergenic
1032420475 7:131775277-131775299 GGGTTAATGACTTCTCTGAAAGG + Intergenic
1033587542 7:142785889-142785911 GGGGCTGTGGCTTCTCTATAAGG + Intergenic
1035324158 7:158054144-158054166 GTGTCAGTGACTTCTCTCTAGGG - Intronic
1038060507 8:23907219-23907241 GGAACAGTGGCATCTCTGGAAGG - Intergenic
1038498069 8:28020242-28020264 GGTTCAGTGGCTTGTCTGTTGGG - Intergenic
1039547453 8:38420336-38420358 GGGTCTGTGTCATCTCTGTAGGG + Intronic
1039969127 8:42306689-42306711 GCTTCAGTGTCTTCTCTGAAAGG + Intronic
1040474247 8:47763032-47763054 GGGGCACAGGCTTCTCTGCAGGG - Intergenic
1041292060 8:56317499-56317521 GGGTGGGAGCCTTCTCTGAATGG + Intronic
1041561941 8:59227794-59227816 GAGTCATTGGCATCCCTGAAAGG + Intergenic
1042401357 8:68351580-68351602 GAGTCACTGGCATCCCTGAAAGG - Intronic
1043202692 8:77390586-77390608 GCGTAATTGGCTTCTCTGGATGG + Intergenic
1044631338 8:94281295-94281317 GGGTCTGTGGCATCTTTGAATGG - Intergenic
1044784315 8:95778474-95778496 AGGTCTGTGGCTTCTCAGATTGG + Intergenic
1047455930 8:125011551-125011573 TTGTCAGTGGCTTCTAAGAATGG - Exonic
1048307464 8:133294357-133294379 GAGACAGTGGCTGCTCTGGAGGG + Intronic
1050148626 9:2596985-2597007 GGATCAGCGGCTTCTGTGAAGGG + Intergenic
1051443831 9:17118484-17118506 GGGCCTGTGGCTTCTGTGACAGG - Intergenic
1051815105 9:21095722-21095744 GGGGCAGGGCCCTCTCTGAATGG - Intergenic
1051816971 9:21120088-21120110 GGGGCAGGGCCCTCTCTGAATGG + Intergenic
1053886471 9:42647654-42647676 GGGGCAGAGGCTTCTCTGGCAGG + Intergenic
1054225490 9:62455103-62455125 GGGGCAGAGGCTTCTCTGGCAGG + Intergenic
1054872457 9:70060844-70060866 GTATCAGTGGCTTCTCTTAGGGG - Intronic
1055012295 9:71579985-71580007 GGCAAAGTGGCTTCTCTAAAGGG - Intergenic
1056074237 9:83022034-83022056 GGGTAAGAGGCCTCTTTGAAGGG - Intronic
1056257297 9:84813229-84813251 GGGACAGTGGCCCCTCTGGAAGG - Intronic
1056512017 9:87315269-87315291 GGGCCAGGGGCCTCACTGAATGG - Intergenic
1057230697 9:93319749-93319771 GGGGCAGTGGCTTTTCTGGTAGG + Intronic
1057632002 9:96726981-96727003 GTCTCTGTGGCTTCTCTGTAAGG - Intergenic
1057843246 9:98502835-98502857 TGGTGAGTGGCTGCTCGGAAAGG - Intronic
1057972372 9:99570409-99570431 CAGTCAGTGGCTGCTCTGAAAGG - Intergenic
1058489363 9:105480130-105480152 GGGTCATGAGATTCTCTGAAAGG + Intronic
1059778950 9:117506735-117506757 GACTCATTGGCATCTCTGAAAGG - Intergenic
1062211453 9:135366476-135366498 GGTCCAGAGGATTCTCTGAAGGG - Intergenic
1186429106 X:9489288-9489310 GGGTTTGTGGCTTCACAGAATGG + Intronic
1186631423 X:11353170-11353192 GGATCTGAGGCTTCTCTGGAGGG - Intronic
1189956438 X:46279425-46279447 TGGTCATTGGATTCTCTGAAGGG + Intergenic
1191917193 X:66215723-66215745 GGGTCTGTGGATTCTCTCAGTGG - Intronic
1194172593 X:90605873-90605895 GGGTTAGTGGTTTCCCTAAATGG + Intergenic
1200518821 Y:4183610-4183632 GGGTTAGTGGTTTCCCTAAATGG + Intergenic
1200743166 Y:6877319-6877341 GGGTCTGGGGCTTCTCTTTAGGG - Intergenic