ID: 954089976

View in Genome Browser
Species Human (GRCh38)
Location 3:48276592-48276614
Sequence GGGGTCAGTGGCTTCTCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 2, 1: 1, 2: 5, 3: 26, 4: 215}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954089976_954089987 6 Left 954089976 3:48276592-48276614 CCTTCAGAGAAGCCACTGACCCC 0: 2
1: 1
2: 5
3: 26
4: 215
Right 954089987 3:48276621-48276643 TGCTTATGGCGGGGGTACCAAGG 0: 1
1: 0
2: 3
3: 5
4: 48
954089976_954089983 -3 Left 954089976 3:48276592-48276614 CCTTCAGAGAAGCCACTGACCCC 0: 2
1: 1
2: 5
3: 26
4: 215
Right 954089983 3:48276612-48276634 CCCGTGCCTTGCTTATGGCGGGG 0: 1
1: 0
2: 0
3: 1
4: 36
954089976_954089979 -5 Left 954089976 3:48276592-48276614 CCTTCAGAGAAGCCACTGACCCC 0: 2
1: 1
2: 5
3: 26
4: 215
Right 954089979 3:48276610-48276632 ACCCCGTGCCTTGCTTATGGCGG 0: 1
1: 0
2: 0
3: 11
4: 79
954089976_954089989 20 Left 954089976 3:48276592-48276614 CCTTCAGAGAAGCCACTGACCCC 0: 2
1: 1
2: 5
3: 26
4: 215
Right 954089989 3:48276635-48276657 GTACCAAGGCACCCCAAGTTGGG 0: 1
1: 1
2: 3
3: 6
4: 143
954089976_954089978 -8 Left 954089976 3:48276592-48276614 CCTTCAGAGAAGCCACTGACCCC 0: 2
1: 1
2: 5
3: 26
4: 215
Right 954089978 3:48276607-48276629 CTGACCCCGTGCCTTGCTTATGG 0: 1
1: 0
2: 0
3: 10
4: 88
954089976_954089985 -2 Left 954089976 3:48276592-48276614 CCTTCAGAGAAGCCACTGACCCC 0: 2
1: 1
2: 5
3: 26
4: 215
Right 954089985 3:48276613-48276635 CCGTGCCTTGCTTATGGCGGGGG 0: 1
1: 0
2: 0
3: 3
4: 45
954089976_954089988 19 Left 954089976 3:48276592-48276614 CCTTCAGAGAAGCCACTGACCCC 0: 2
1: 1
2: 5
3: 26
4: 215
Right 954089988 3:48276634-48276656 GGTACCAAGGCACCCCAAGTTGG 0: 1
1: 1
2: 2
3: 4
4: 81
954089976_954089981 -4 Left 954089976 3:48276592-48276614 CCTTCAGAGAAGCCACTGACCCC 0: 2
1: 1
2: 5
3: 26
4: 215
Right 954089981 3:48276611-48276633 CCCCGTGCCTTGCTTATGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954089976 Original CRISPR GGGGTCAGTGGCTTCTCTGA AGG (reversed) Intronic
900379445 1:2376596-2376618 GGGGTGAGTGGCTCCTCCCATGG + Intronic
900916768 1:5644893-5644915 GGGCTCAGCTGCTTCTCTGGGGG + Intergenic
901579650 1:10230887-10230909 TGAGTCAGTGGCATATCTGAGGG + Intronic
902729328 1:18358501-18358523 GGGGTGAGTGGCTGCTCTACGGG + Intronic
902859338 1:19233667-19233689 GAGGGCAGTGGCTTCATTGACGG - Intronic
903311006 1:22455980-22456002 GGGGTCACTGCCTTCCCTCAGGG - Intronic
905249530 1:36638980-36639002 GGTGTCAGAGGCCTCTCTGTCGG - Intergenic
905695421 1:39970014-39970036 GGGCTCAGTGTGTTCTCTAACGG - Intergenic
905889605 1:41510989-41511011 TGGGTCAGTGGCTTCTCCGGGGG - Exonic
906787638 1:48629841-48629863 GGGATCAGGGGATACTCTGAGGG + Intronic
907289485 1:53403555-53403577 GTGGTCAGTGGCACCTCTGCTGG - Intergenic
907677005 1:56527388-56527410 GGAGACAGTGACTTTTCTGAAGG + Intronic
908824504 1:68120205-68120227 GGGGTGGGTAGCTTCCCTGAGGG + Intronic
910985968 1:93004835-93004857 GGTTTCAATGTCTTCTCTGATGG - Intergenic
912510879 1:110189459-110189481 GGGGACAGTGGCTTTGCTAAGGG - Intronic
912648206 1:111415014-111415036 GGGGTCAGGGCCTTCTCTCCAGG + Exonic
912974395 1:114314825-114314847 GAGGTCAGTGGCCTCCCTCAAGG + Intergenic
913070348 1:115292932-115292954 GGGGTCACTGGGCTCTCGGAGGG + Intronic
915146339 1:153797889-153797911 GGGGTCAGCGGCTCCTCTGCAGG + Intergenic
915147320 1:153802770-153802792 GGAGTTAGTGGCATCTCGGAGGG - Intergenic
915526962 1:156481826-156481848 GGGGTCAGTGCCTGCTTTGAAGG - Intronic
915805923 1:158849792-158849814 GGGGTAATTGGTTTCTCTGAAGG + Intergenic
917050522 1:170917368-170917390 GTGCTCAGCGGCTTCTCTCAGGG + Intergenic
917986538 1:180326102-180326124 GGGGTAACTTGCTTCCCTGAAGG - Intronic
919812878 1:201420122-201420144 GGGGACAGTTGGATCTCTGAGGG - Intronic
920036080 1:203066591-203066613 AGGCTCAGTGACTACTCTGAAGG + Intronic
920848142 1:209610668-209610690 GGGGTCAGGGGCTTCAGGGAAGG - Intronic
1062956628 10:1544429-1544451 GGGGTCTGTGGCTTTTCACACGG + Intronic
1063116597 10:3076207-3076229 GTGGCCAGCGGCTCCTCTGAGGG + Intronic
1063148024 10:3314089-3314111 GGGGGCAGTGACTTCACAGAGGG + Intergenic
1063148115 10:3314603-3314625 GGGGACAGTGACTTCACAGAGGG + Intergenic
1063447057 10:6125855-6125877 GTGTTCAGTGGCTTCAGTGAAGG - Intergenic
1066131033 10:32394206-32394228 GGGGTCACTGCCTTCTCTGCTGG - Intergenic
1070296618 10:75166991-75167013 GTGTTCAGTGCTTTCTCTGAGGG + Intronic
1070464970 10:76712062-76712084 GGGTGAAATGGCTTCTCTGAAGG - Intergenic
1070824826 10:79385053-79385075 GGGTTCTGTGGCTTGTCTCAGGG + Exonic
1073630424 10:105142608-105142630 GGGGTCAGCTGATTCTCAGAAGG - Intronic
1075052985 10:119196762-119196784 GAGGTGAGTGGCTACTATGAAGG - Intergenic
1075949470 10:126464360-126464382 GGTGTGTGTGGCTGCTCTGAAGG - Intronic
1076067432 10:127459863-127459885 GGAGTCAGTGGTTTCTCCCATGG + Intergenic
1076904390 10:133354967-133354989 GGGGGCAGTGGCTGCCCTGGAGG - Intergenic
1077825704 11:5806313-5806335 GAGGTCAGTGGTTTCTCTGAAGG + Intronic
1078436252 11:11328195-11328217 GGCTTCAGTGGCTTCCCTGCTGG + Intronic
1080412421 11:32038312-32038334 GGAATCATTGGCTTCTCAGATGG - Intronic
1083006958 11:59355733-59355755 GGGGCATGTGGCTTCTCTGCTGG + Intergenic
1083265465 11:61544789-61544811 GGGGTGTGTGGCTTCCCTGTGGG + Intronic
1083470707 11:62881839-62881861 GAGGTCAGGGGCCTCTCAGAGGG + Intronic
1084483876 11:69437049-69437071 GAGGTCAGTGGCCTCATTGAGGG - Intergenic
1084489275 11:69469546-69469568 TGGGTCTGTGGCTGCTTTGAAGG - Intergenic
1084549280 11:69831267-69831289 GGTGTCAGTGGCCTCTATGTAGG - Intergenic
1087228964 11:95637937-95637959 GGGTTCAGTGGATTCCCTCAGGG - Intergenic
1090748126 11:129723467-129723489 AGGGACAGTGGCTTCTCCGTGGG - Intergenic
1090937964 11:131362086-131362108 GGGATCAGTGGAGTCTCTGTGGG - Intergenic
1091002460 11:131921862-131921884 GGGGTCTGTGACTTCTCAGGTGG - Intronic
1091251075 11:134144785-134144807 GGGGTCACTGGCTTCACTGTGGG - Exonic
1094607193 12:31959278-31959300 CGGGTCCGCGGCTTCTCTGGTGG + Intergenic
1095970697 12:47900232-47900254 GGGGACAGTGGCCTCTCAGAAGG - Intronic
1096162163 12:49387690-49387712 GGAGTCTGGGGCTTCTTTGATGG + Intronic
1097729087 12:63107301-63107323 GTTGTGAGTGGCTTCTCTGCAGG + Intergenic
1102024692 12:109707593-109707615 GGGGTCACTGGCCTTGCTGAAGG - Intergenic
1103733336 12:123042933-123042955 GGAGTGTGTGGCTGCTCTGAAGG + Intronic
1104042777 12:125141292-125141314 GGGGTCAGTGGGGTGTCTGGAGG + Intronic
1104203554 12:126615118-126615140 GGGGTCAGTGGCTTCTCTGAAGG + Intergenic
1104858394 12:131912546-131912568 GGGGTCTGTGGCTCCTCTGAAGG + Intronic
1104972134 12:132535677-132535699 CTGCTCAGTGGCTTCTCTGGGGG - Intronic
1106335261 13:28777919-28777941 GGGGTCAGTGGCTCCTGTGGGGG + Intergenic
1106391451 13:29338982-29339004 GGGGACAGTGGCTCCTGTGGGGG + Intronic
1107235771 13:38168527-38168549 GAGGTTAGTGGCTTCTCAGTGGG - Intergenic
1108418834 13:50228307-50228329 GGAGACAGTGGCTTTTCTGTAGG - Intronic
1112332756 13:98489336-98489358 ATGGTCAGGGGCTGCTCTGAAGG - Intronic
1113776883 13:112952982-112953004 GGGGGCAGTTGGTTCTCAGAAGG + Intronic
1116875846 14:50111017-50111039 TGGGTAAGAGGCTTCTCTGGGGG + Intronic
1118981658 14:70722004-70722026 TGGGTGAGAAGCTTCTCTGAGGG - Intergenic
1125657123 15:41367202-41367224 CAGGTCAGGGGCTTCTCTGCAGG + Intronic
1127174271 15:56337254-56337276 GGGCTAAGTGGCTTATCTGGTGG + Intronic
1128018101 15:64365386-64365408 GGGCACAGTGGCTTCTCAGGAGG - Exonic
1128740987 15:70083550-70083572 GGGGGCAGGGGGTTATCTGAGGG - Intronic
1129691426 15:77715848-77715870 GGTGTCCCTGGCTGCTCTGAAGG + Intronic
1129908230 15:79204917-79204939 TGGGTCTGTGGCATCTCTGCAGG + Intergenic
1131022856 15:89114356-89114378 GGGGTCTGTGGGTTCCCTGTGGG - Intronic
1131119112 15:89812300-89812322 GGGCTCATTGTCTGCTCTGAGGG + Intronic
1131788194 15:95935505-95935527 TGGGTCAGTGGCTTGCTTGAGGG - Intergenic
1132257364 15:100387452-100387474 GGAGTCAGTGTCAACTCTGAAGG - Intergenic
1132270194 15:100517409-100517431 TGGGGGAGTGGCTTTTCTGAGGG + Intronic
1132569738 16:638844-638866 TGGGTCAGAAGCTTCCCTGAGGG + Intronic
1132577142 16:669307-669329 CGGGGAAGAGGCTTCTCTGAGGG + Intronic
1133726547 16:8542739-8542761 GGGGTTAGTGGGTTATCTGAGGG + Intergenic
1134518485 16:14906171-14906193 TGGGTCAGTGGCTACGGTGAAGG - Intronic
1134555443 16:15160046-15160068 TGGGTCAGTGGCTACGGTGAAGG + Intergenic
1134706156 16:16304824-16304846 TGGGTCAGTGGCTACGGTGAAGG - Intergenic
1134961384 16:18407286-18407308 TGGGTCAGTGGCTACGGTGAAGG + Intergenic
1134965684 16:18489889-18489911 TGGGTCAGTGGCTACGGTGAAGG + Intronic
1136711636 16:32241526-32241548 AGGAGCAGTGGCTTCTCTGGAGG + Intergenic
1136756280 16:32687880-32687902 AGGAGCAGTGGCTTCTCTGGAGG - Intergenic
1136811833 16:33182495-33182517 AGGAGCAGTGGCTTCTCTGGAGG + Intergenic
1136818309 16:33292575-33292597 AGGAGCAGTGGCTTCTCTGGAGG + Intronic
1136824873 16:33349108-33349130 AGGAGCAGTGGCTTCTCTGGAGG + Intergenic
1136829939 16:33447879-33447901 AGGAGCAGTGGCTTCTCTGGAGG + Intergenic
1138453071 16:57105389-57105411 GGGGTCAGTGGACCCTGTGAGGG + Intronic
1141157155 16:81605295-81605317 GGGGCCAGGGGGTCCTCTGAGGG + Intronic
1141716603 16:85730530-85730552 GGGTTCAGTGGCTGGTCTGGGGG - Intronic
1142369384 16:89669879-89669901 GGGGGCGGTGGCTTCTCACAGGG - Exonic
1202990411 16_KI270728v1_random:5463-5485 AGGAGCAGTGGCTTCTCTGGAGG + Intergenic
1203058418 16_KI270728v1_random:948233-948255 AGGAGCAGTGGCTTCTCTGGAGG - Intergenic
1142552658 17:750706-750728 GGAGTCAGTGTTTTCTCTGCTGG - Intronic
1145067332 17:19770665-19770687 GGGGCCAGTTCCTTCACTGATGG - Intergenic
1147267231 17:39242144-39242166 TGGGTCAGTGGGTTCACTGACGG + Intergenic
1147956570 17:44138704-44138726 ATGGTCAGTGGCTACTCTGTTGG + Intergenic
1149600239 17:57888785-57888807 GGGGTCAGTGACTTGTGTTAAGG + Intronic
1152681635 17:81671552-81671574 GGGGTCAGAGCCTTCTTTGGTGG + Intronic
1153643507 18:7175040-7175062 GGGGACAGTGGTTGCTATGAGGG - Intergenic
1153881922 18:9428562-9428584 TGTATCAGAGGCTTCTCTGATGG + Intergenic
1154928292 18:20962829-20962851 TAGTTCAGTTGCTTCTCTGAGGG - Intronic
1156691821 18:39716326-39716348 GTGGTAATTGGCTCCTCTGAAGG - Intergenic
1157764619 18:50286995-50287017 GGGGTCAGTGGGGACTGTGATGG - Intronic
1158573436 18:58615997-58616019 GTGTTTCGTGGCTTCTCTGAAGG + Intronic
1161912949 19:7208134-7208156 GAGGTCAGTAGCATCTCAGAGGG - Intronic
1161976624 19:7611177-7611199 GGGGTAGGTGGCTTCTGTCACGG + Intronic
1162094790 19:8304001-8304023 GGCGTCAGTGACTGCTCTGGGGG - Exonic
1162351185 19:10150695-10150717 GTGGTCATTGGCTTCACTGAAGG - Intronic
1163519152 19:17781596-17781618 TGGGTGGGTGGCTTCTCTGTTGG + Intronic
1164082668 19:21874243-21874265 GAGGACAGTCGCATCTCTGATGG - Intergenic
1164290656 19:23866118-23866140 GTGGTAAGTGGCCTCTCTGATGG - Intergenic
1164931335 19:32178460-32178482 TGGGTCAGAGGCCTCGCTGATGG + Intergenic
1165453526 19:35898495-35898517 GGGGTCAGGGGCTGCTCTGGGGG + Exonic
1166701686 19:44885950-44885972 GGGGTCGGTGGCTTGTAGGAGGG - Exonic
1167278772 19:48554283-48554305 GGGGTACGTGGCGTATCTGAGGG - Intronic
925140410 2:1546474-1546496 GGGGTCTGTGGCTTTTGCGAAGG - Intergenic
925294286 2:2767414-2767436 AGGGTCTGTGGCCTCCCTGAGGG - Intergenic
925334323 2:3082383-3082405 GGGCTCAGTGGCAGCTCTGAAGG + Intergenic
925532096 2:4875471-4875493 AGGGCCAGTGGCTCCCCTGATGG - Intergenic
927114351 2:19886403-19886425 GCGGGGATTGGCTTCTCTGACGG + Intergenic
927433560 2:23047676-23047698 GATGTCAGTGGCCTCTCTGAAGG + Intergenic
931165062 2:59737921-59737943 GTGGCCAGTGGCTACTGTGATGG + Intergenic
942188670 2:173449163-173449185 GGGGTGAGTGGTGTCTCTGTTGG + Intergenic
942726134 2:179009683-179009705 GGGTGCAGTGGATTCTGTGAGGG + Intronic
943845188 2:192635771-192635793 GGGGTAAATTGCTGCTCTGAAGG + Intergenic
944465302 2:199994466-199994488 TGGCTCAGTGGCTCCTGTGAGGG - Intronic
946161049 2:217836280-217836302 GGAGGCACTGCCTTCTCTGATGG - Intronic
947161835 2:227222836-227222858 GGGGCCAATGGCCTCTCTGCTGG + Intronic
947928397 2:233941606-233941628 GAGGCCAGTGACCTCTCTGAGGG + Intronic
948087619 2:235264719-235264741 GGGGTGAGTGGCTGCTGTGTTGG - Intergenic
1168912511 20:1460687-1460709 GTGGCTAGTGGCTTCTCTGTTGG - Intronic
1170619943 20:17987313-17987335 GGGGTTAGTGGCTACTCTACTGG - Intronic
1170705283 20:18738794-18738816 GCTGGCAGTGGCTTCTCTGTGGG + Intronic
1173536069 20:43814380-43814402 GGGGTGAGAGGTTTCTCTCAGGG - Intergenic
1174523536 20:51153706-51153728 GCAGGCAGTGGTTTCTCTGATGG + Intergenic
1175817589 20:61891540-61891562 GGTGTCAGGGGCCTCTCGGAAGG - Intronic
1175930674 20:62492433-62492455 GGGGACAGGGGCTTCTCTGCAGG - Intergenic
1176172268 20:63701368-63701390 GGGGGCAGTGGCACCTCAGAGGG + Intronic
1177961068 21:27666816-27666838 GTGGTCAGTGGCTTCCTTTAGGG - Intergenic
1178367039 21:31996838-31996860 GGGTACAGTGGCTTCTCTCCGGG - Intronic
1178877619 21:36424937-36424959 GGGGTCAGTGGCGACAGTGACGG - Intergenic
1180041794 21:45283890-45283912 GGGGACAGTGGCCTCACAGAGGG - Intronic
1182560216 22:31153652-31153674 GGGGTGGGTGGCCTGTCTGAGGG + Intergenic
1182578370 22:31289295-31289317 GAGGTCAGTAGCTTCTCTTCTGG - Exonic
1183630595 22:39030241-39030263 GAGGTCAGTGGCTGCTGTGGGGG - Intronic
1183634051 22:39050333-39050355 GAGGTCAGTGGCTGCTGTGGGGG - Intronic
949733697 3:7145715-7145737 GAGGTCAGAGGGTTCCCTGAAGG + Intronic
949854877 3:8452308-8452330 GGGGCCAGTGGCTACTGTGTTGG - Intergenic
950539030 3:13599098-13599120 TGGGGCAGTGGCTTTTCTGTGGG + Intronic
952252208 3:31665824-31665846 GGGGTCAGGGGGTCCTCTGAAGG + Intronic
952352424 3:32553017-32553039 TGTGTCAGTGGCTGCTCTGTAGG - Intronic
954089976 3:48276592-48276614 GGGGTCAGTGGCTTCTCTGAAGG - Intronic
954873363 3:53784663-53784685 GGGCTCTGTGTCTTCTCTGTGGG - Intronic
955868561 3:63412125-63412147 GTGGTGACTGGCTTTTCTGATGG + Intronic
956526338 3:70166557-70166579 AAGGTCAGTGGCTTCTAGGAGGG - Intergenic
959626454 3:108457530-108457552 AGGGACAGTGGCTTCTTGGATGG - Intronic
959892415 3:111571020-111571042 GGGGTCAGCGGCTTGTAGGAGGG + Intronic
960402691 3:117222616-117222638 GGGGTTAGTGGCCTTTATGATGG - Intergenic
960659597 3:120043509-120043531 AGGGTCAGTGGCTTTTCTGGAGG - Intronic
961554542 3:127689029-127689051 AGGGTCAGAGGCTACTGTGATGG + Intergenic
961572843 3:127812820-127812842 TGGGTCAGTAGCGTCTCTGGAGG + Intronic
962184998 3:133248916-133248938 GGAGTGAGTGCATTCTCTGAGGG - Intronic
963776987 3:149449839-149449861 GGGCCCAGAGGCTTCTCTGGGGG - Intergenic
964478165 3:157115745-157115767 GGAGTCAGTGGCTGGGCTGAGGG + Intergenic
964612039 3:158625181-158625203 AGGGTCAATGGCTTCTCTGAAGG + Intergenic
967233731 3:187365441-187365463 GGGGTAAGGGGACTCTCTGAAGG + Intergenic
968606470 4:1537997-1538019 GGGGTCAGGGGCATGGCTGAGGG - Intergenic
968963476 4:3757678-3757700 GGTCTCAGTGTCTTCACTGAAGG + Intergenic
971552066 4:27969793-27969815 GGGGGCTGAGGCTTCTCTGTCGG - Intergenic
971727320 4:30330919-30330941 GTGGTCAGTAGGTTCTCTGCTGG + Intergenic
977932155 4:102760951-102760973 GGGGTGAGTGGCTTCACCGCCGG - Exonic
985671844 5:1210811-1210833 GGGGGCTGTGCCTGCTCTGAGGG + Intronic
985851307 5:2390843-2390865 TAGGGCAGGGGCTTCTCTGAGGG + Intergenic
990712789 5:58604217-58604239 GGGTACAGTGGATTCTGTGAAGG + Intronic
992608384 5:78485442-78485464 GGGGTCAGTAGGTGCTCTGGAGG - Exonic
992615624 5:78543568-78543590 GGGGTCTGAGGATTCTCTCAGGG - Intronic
993669992 5:90748548-90748570 GTGGCCAGTGGCTACTGTGAAGG + Intronic
995519359 5:112987025-112987047 GGGGAAAGAAGCTTCTCTGAAGG - Intronic
997408935 5:133675473-133675495 GTGGTGAGTGGCTTGCCTGACGG - Intergenic
998288059 5:140883341-140883363 AGGCTGAGTGTCTTCTCTGATGG - Exonic
999108686 5:149095881-149095903 GGAGTAAGTGGATTCTGTGATGG - Intergenic
1002575572 5:180171992-180172014 GGGGTCAGTGGGTGCACTAAAGG + Intronic
1002601935 5:180358751-180358773 GGGGTTAGTGCCTTACCTGAGGG + Intergenic
1002716458 5:181231156-181231178 GGGGCCGGCAGCTTCTCTGATGG - Intronic
1002853839 6:1020562-1020584 GGGCTCAGTGGCTTGTCTGATGG + Intergenic
1004223023 6:13762786-13762808 GTGGTTAGTGGCTTCTCAGATGG + Intergenic
1006097364 6:31664434-31664456 GGGGTCAGTGGCTGGGGTGAAGG + Exonic
1006447114 6:34085850-34085872 CTGGTCAGAGGCCTCTCTGAAGG + Intronic
1007420233 6:41714808-41714830 GTGGTCACTGGATTCCCTGAGGG - Intronic
1010366864 6:75060932-75060954 GGTGGAAGTTGCTTCTCTGAAGG + Intergenic
1010784585 6:79985428-79985450 GGGTTCAGAGCCTGCTCTGAGGG - Intergenic
1010931609 6:81810751-81810773 GGGGTCAATGACATTTCTGAAGG - Intergenic
1011211989 6:84965081-84965103 GGGGTCAGCAGCTTCTCTGAAGG + Intergenic
1012575205 6:100787209-100787231 GGTGTCAGTTGCTTGTCAGAAGG - Intronic
1013305178 6:108841122-108841144 GGGGTCACTGCCTTCTCTGTGGG + Intergenic
1016366506 6:143324189-143324211 TAAGTCAGTGCCTTCTCTGAAGG + Intronic
1017420559 6:154268162-154268184 GCTGTCAGTGCCTGCTCTGATGG - Intronic
1018795316 6:167180739-167180761 TGGCTGAGTGGCTTCTGTGAGGG + Intronic
1018821005 6:167374323-167374345 TGGCTGAGTGGCTTCTGTGAGGG - Intronic
1018898977 6:168041795-168041817 GGGGATAGTGGCTTCTCTGGGGG - Intronic
1019157882 6:170051211-170051233 GGGGTCACTGCCTCCTGTGATGG - Intergenic
1021737888 7:23657113-23657135 AGGGTCAGTGGCTTCTCTGAAGG - Intergenic
1023819941 7:43975047-43975069 GGGCTCAGTGGCTGGTCAGAGGG + Intergenic
1024516747 7:50265963-50265985 TGGGTAAGTGGCATCTCTGAAGG + Intergenic
1024709988 7:52004681-52004703 GGTTTCAGTTGCTTCCCTGATGG + Intergenic
1029639510 7:101810778-101810800 GGGGTCAGTGGCTGGTGAGATGG + Intergenic
1030938621 7:115617282-115617304 GGGGTCTTTGGCTTCTGTGTGGG - Intergenic
1034337722 7:150334163-150334185 TGGGTCAGTGGCTTTTTAGATGG - Intronic
1035694492 8:1584727-1584749 GGGGTGAGCTGCTTCCCTGATGG - Intronic
1037859326 8:22393387-22393409 GGGGAGAGTGGCTTCTCACACGG + Intronic
1038408803 8:27342406-27342428 GGGCTCAGTGGCTTCTCGGGAGG - Intronic
1038498070 8:28020243-28020265 TGGTTCAGTGGCTTGTCTGTTGG - Intergenic
1039510228 8:38085941-38085963 GGGGGCAGTGGCTTCTGGAATGG + Intergenic
1039875719 8:41583664-41583686 GTGGTTAGTGGCTGCTCTGTTGG + Intronic
1040637369 8:49290643-49290665 CGGGTGACTGGCTTTTCTGAAGG + Intergenic
1048291012 8:133181738-133181760 GAGCTGAGTGGCTTCTCTCATGG - Intergenic
1048307463 8:133294356-133294378 GGAGACAGTGGCTGCTCTGGAGG + Intronic
1049424667 8:142532763-142532785 GGGGCCTGTGGGCTCTCTGAGGG + Intronic
1050148625 9:2596984-2597006 AGGATCAGCGGCTTCTGTGAAGG + Intergenic
1052994792 9:34546206-34546228 GGGGTGGGGGGCTTCTGTGACGG + Intergenic
1053244221 9:36521272-36521294 GGAGTCGGTGACTTCTCTGATGG + Intergenic
1054872458 9:70060845-70060867 GGTATCAGTGGCTTCTCTTAGGG - Intronic
1056074238 9:83022035-83022057 GGGGTAAGAGGCCTCTTTGAAGG - Intronic
1057456098 9:95212948-95212970 GTGGTCAGTGGCTACTGTGTTGG - Intronic
1059355033 9:113692165-113692187 GGGGTCTGTGGCTACTTTGTGGG - Intergenic
1060184102 9:121553367-121553389 GTGGTCACTGGCTTTCCTGACGG - Intergenic
1060840341 9:126788554-126788576 GGGGTCAGTGGAGCCACTGAAGG - Intergenic
1060962378 9:127690299-127690321 GAGGTCAGTGGATTCTCCCAGGG + Intronic
1061974765 9:134062518-134062540 TGGGTGAGCGGCCTCTCTGAAGG + Intronic
1185638260 X:1570975-1570997 GAGCTCAGGGGCTTCTGTGAAGG - Intergenic
1187862720 X:23697488-23697510 GGGATCAGTGGTGTCACTGAAGG - Intergenic
1189956437 X:46279424-46279446 GTGGTCATTGGATTCTCTGAAGG + Intergenic
1190378591 X:49815832-49815854 GAGGTCTGTGGATTCTTTGAAGG - Intergenic
1195670577 X:107466448-107466470 GTGGTCATTGGCTTCTCAGCTGG + Intergenic
1196734650 X:118973723-118973745 GGGGTCGGTGGGTACTCTGGGGG - Intergenic
1199037907 X:143075416-143075438 GAGGTTAGTGACTTCTCTAAGGG - Intergenic
1199698081 X:150357937-150357959 GGGGTCTCTGGCTTTGCTGAGGG + Intergenic