ID: 954089977

View in Genome Browser
Species Human (GRCh38)
Location 3:48276604-48276626
Sequence TAAGCAAGGCACGGGGTCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 131}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954089977_954089987 -6 Left 954089977 3:48276604-48276626 CCACTGACCCCGTGCCTTGCTTA 0: 1
1: 0
2: 1
3: 10
4: 131
Right 954089987 3:48276621-48276643 TGCTTATGGCGGGGGTACCAAGG 0: 1
1: 0
2: 3
3: 5
4: 48
954089977_954089994 25 Left 954089977 3:48276604-48276626 CCACTGACCCCGTGCCTTGCTTA 0: 1
1: 0
2: 1
3: 10
4: 131
Right 954089994 3:48276652-48276674 GTTGGGAGATATGTTCTCAATGG 0: 3
1: 1
2: 1
3: 13
4: 152
954089977_954089995 26 Left 954089977 3:48276604-48276626 CCACTGACCCCGTGCCTTGCTTA 0: 1
1: 0
2: 1
3: 10
4: 131
Right 954089995 3:48276653-48276675 TTGGGAGATATGTTCTCAATGGG 0: 3
1: 1
2: 2
3: 16
4: 136
954089977_954089988 7 Left 954089977 3:48276604-48276626 CCACTGACCCCGTGCCTTGCTTA 0: 1
1: 0
2: 1
3: 10
4: 131
Right 954089988 3:48276634-48276656 GGTACCAAGGCACCCCAAGTTGG 0: 1
1: 1
2: 2
3: 4
4: 81
954089977_954089989 8 Left 954089977 3:48276604-48276626 CCACTGACCCCGTGCCTTGCTTA 0: 1
1: 0
2: 1
3: 10
4: 131
Right 954089989 3:48276635-48276657 GTACCAAGGCACCCCAAGTTGGG 0: 1
1: 1
2: 3
3: 6
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954089977 Original CRISPR TAAGCAAGGCACGGGGTCAG TGG (reversed) Intronic
900844615 1:5086981-5087003 TGAGCAAGGCAGGGGGACAGAGG - Intergenic
901193021 1:7423858-7423880 AAAGCAAGGTACGGGGCGAGAGG + Intronic
905705277 1:40051720-40051742 TTAGCCAGGCACGGTGGCAGGGG - Intronic
905954955 1:41984951-41984973 TAAACAAGGCACTAAGTCAGAGG + Intronic
907552358 1:55315033-55315055 TAAGCCAGTCAAGGGGGCAGCGG + Intergenic
911370348 1:96988334-96988356 TAAGGAAGGCAGGTGGTGAGGGG - Intergenic
912757909 1:112340007-112340029 AAAGAAAGGCCCAGGGTCAGAGG + Intergenic
916558377 1:165911926-165911948 TAAGGAAGGCAATGGGGCAGAGG - Intergenic
919654144 1:200180978-200181000 TATGCCAGGCACTGGGCCAGTGG - Intergenic
920808986 1:209264521-209264543 AAGGCAAGGCACGGGGGAAGGGG - Intergenic
924402809 1:243705614-243705636 TAAGGAAGGCACAGGGGCATTGG + Intronic
1063632730 10:7749157-7749179 GAAGCAAGGCATGTGGTTAGGGG - Intronic
1065067203 10:21982066-21982088 TAGCCAAGGAACAGGGTCAGTGG - Intronic
1068390115 10:56385009-56385031 TAATCAAGGCACATGGTCACTGG - Intergenic
1068871635 10:61951367-61951389 TAGGCAAGGCACAGGCTCTGGGG - Intronic
1069606719 10:69743498-69743520 CAAGAAAGGGAGGGGGTCAGAGG + Intergenic
1070146199 10:73775205-73775227 TAAGGAAAGCAAGGGGGCAGGGG - Intronic
1071565315 10:86668568-86668590 CAGGCAAGGCTGGGGGTCAGGGG + Exonic
1072739636 10:97901646-97901668 GAAACAAGGCTGGGGGTCAGTGG + Intronic
1073722519 10:106189412-106189434 TCAGCATGGCACTGTGTCAGAGG - Intergenic
1074256714 10:111810265-111810287 TATTGAAGGCAAGGGGTCAGTGG + Intergenic
1075797873 10:125134333-125134355 TGAGCAAGGCACGGGGCGGGGGG - Intronic
1075817390 10:125275377-125275399 TATGCAAGGCACGGGGTGAGGGG - Intergenic
1076603326 10:131673535-131673557 CAAGCAGAGCTCGGGGTCAGGGG - Intergenic
1078640012 11:13085629-13085651 TAATCAAGGCACTGGGACAATGG + Intergenic
1084326890 11:68405632-68405654 TTAGCAAACCACGGGGTGAGAGG - Intronic
1088319550 11:108541193-108541215 TAAGCTGGGCAGGGGGTCGGGGG - Intronic
1095381740 12:41602915-41602937 TAAGTGAGTCACGGAGTCAGTGG + Intergenic
1096193605 12:49635087-49635109 TAGGCAAGGCACTGGGATAGAGG - Exonic
1096581067 12:52585676-52585698 CAAGAAAGGCATGGGGGCAGAGG + Exonic
1098972824 12:76873968-76873990 TAAGCCAGGTACTGGGTTAGGGG + Intronic
1099915386 12:88886028-88886050 TATGCAAGGAAAGGAGTCAGGGG - Intergenic
1101636937 12:106551686-106551708 TAAGCAAGGCTCTGTGTGAGTGG + Intronic
1104203553 12:126615106-126615128 TGAGCAAGGCGTGGGGTCAGTGG + Intergenic
1104527878 12:129541105-129541127 AAAGCAAAGCAAGAGGTCAGAGG + Intronic
1104639222 12:130456711-130456733 GAAGCAGGACAGGGGGTCAGCGG + Intronic
1105624294 13:22098334-22098356 TAGCTAAGGCACGGGGTAAGGGG - Intergenic
1106757626 13:32838648-32838670 TAATCAAGGCAAGTGGTCAGCGG - Intergenic
1109396878 13:61770899-61770921 TCAGCAAGGCACAGGCACAGCGG - Intergenic
1120528947 14:85609288-85609310 TAAGGAACGCACAGGGTCAAAGG - Intronic
1127380651 15:58428182-58428204 ATAGCCAGGCATGGGGTCAGGGG + Intronic
1129173328 15:73821373-73821395 TAGGCAAGGCATGAGGTCACAGG - Intergenic
1129680039 15:77653586-77653608 TAAACGAGGCACGGGACCAGGGG + Intronic
1131009070 15:89002541-89002563 TAAACAAAGCAAGAGGTCAGTGG - Intergenic
1131099147 15:89674401-89674423 TTAGCAAGGCATGGTGTCACAGG - Intronic
1131100355 15:89683869-89683891 TAAGCGAGGTACCAGGTCAGTGG + Exonic
1132289339 15:100688603-100688625 TAGGCAGGGCACGGAGGCAGTGG - Intergenic
1132395203 15:101467851-101467873 TACGCAAGCCACGCGGACAGTGG + Intronic
1132611025 16:816391-816413 CCAACAAGGCACGGGGCCAGGGG + Intergenic
1137972603 16:53000805-53000827 CAAGCAAGGCAGGGGCTCAGGGG + Intergenic
1139162308 16:64525720-64525742 CAAGCTAGGCACTGGGTCATAGG - Intergenic
1142001211 16:87665411-87665433 TAAGCAAAGTGCGGGGTCCGGGG - Intronic
1148238129 17:45983015-45983037 TGAGGAAGGCTCGCGGTCAGCGG - Intronic
1148393242 17:47288734-47288756 TATGCAAGGCACTGGGCCAGGGG + Intronic
1148835590 17:50464097-50464119 TAGGAAAGGCTCGGGGTCAGAGG + Intronic
1152110798 17:78356719-78356741 AAAGCAAGGCACGGGGCGGGGGG + Intergenic
1152120862 17:78417453-78417475 TGAGCATGGGACGGGGGCAGGGG + Intronic
1152558188 17:81065064-81065086 TAACCCAGGCACTGGCTCAGGGG - Intronic
1152943153 17:83183014-83183036 GAAGGAAGTCACGGGGTGAGTGG + Intergenic
1153691520 18:7599500-7599522 AAAGCAAGGAACTGAGTCAGGGG - Intronic
1156239758 18:35241300-35241322 TTACGAAGTCACGGGGTCAGCGG - Intronic
1156348822 18:36284990-36285012 TAACCCAGGCAGAGGGTCAGAGG - Intergenic
1156903231 18:42325595-42325617 GAAGCCAGGCAAGGAGTCAGTGG - Intergenic
1160464276 18:79063015-79063037 TAAGCAGGGCAAGGGCACAGTGG + Intergenic
1161951618 19:7470878-7470900 TGAGCCAGGCACGGGGGCATGGG + Exonic
1166821196 19:45581359-45581381 TAAGGAAAGCACTGGGGCAGAGG - Intronic
1168635348 19:57991916-57991938 TAAGACAAGCACAGGGTCAGAGG - Intronic
927031789 2:19127826-19127848 TTGGCAAAGCACGGGGTCACTGG - Intergenic
940233586 2:151484848-151484870 TATGCCAGGCACTGGGTTAGAGG - Intronic
940940760 2:159557927-159557949 AAAGCAAGGCAGGGGGTGATGGG + Intronic
942023372 2:171889128-171889150 AAAGCAAGGCAGAGGATCAGGGG - Intronic
942981691 2:182091703-182091725 CAAGCAGGGCATGGGGTCATTGG - Intronic
947477459 2:230463693-230463715 TCAGCAAGGCACTGGGTTGGTGG + Intronic
1169332666 20:4729099-4729121 TAAGCAAGGTAGGGTGTGAGGGG - Intergenic
1173222332 20:41140295-41140317 GAAGCAGGGCACGGCTTCAGTGG - Intronic
1173925725 20:46779873-46779895 TAAGCAAGGCGGGGGGTGGGTGG - Intergenic
1174690822 20:52502711-52502733 TAAGCAACACACTGGGTTAGAGG - Intergenic
1175719430 20:61276735-61276757 TAAGAACTCCACGGGGTCAGGGG + Intronic
1178854753 21:36241145-36241167 TAAGCCAGGCATGGTGGCAGGGG + Intronic
1183337675 22:37259889-37259911 TAAGAAAGGGAGGGGGTGAGTGG - Intergenic
1183428987 22:37754565-37754587 TAAGCAAGTCAGGGACTCAGCGG - Intronic
1184221602 22:43104103-43104125 TATACAAGGCAAGGGGGCAGGGG + Intergenic
1184499802 22:44864819-44864841 TTAGCCAGGCAGGGGGGCAGTGG + Intergenic
949950667 3:9226142-9226164 GAAATAAGGCAGGGGGTCAGGGG + Intronic
950581653 3:13866206-13866228 TGTGCCAGGCACTGGGTCAGAGG + Intronic
950769681 3:15301536-15301558 AAAGCAAGGCATGGGGGCTGGGG + Intronic
954089977 3:48276604-48276626 TAAGCAAGGCACGGGGTCAGTGG - Intronic
955711513 3:61783967-61783989 TGAGCATGGGATGGGGTCAGAGG + Intronic
957267144 3:77982465-77982487 TAAGTAAGGCATGGAGTCAAAGG - Intergenic
959394532 3:105820428-105820450 GAAGCAAGGTTCGGGGGCAGGGG + Intronic
960470225 3:118055253-118055275 TAAGCAAGGCACCATGTGAGTGG - Intergenic
961011273 3:123437763-123437785 TAAGCAAGGCACTGAGTGCGTGG - Intronic
966814807 3:183881266-183881288 TTAGCCAGGCACGGTGGCAGGGG - Intronic
966875259 3:184317818-184317840 TAAGCAGGGGAGGGAGTCAGAGG + Intronic
968801668 4:2747039-2747061 AAAGCAAGGGCCGGGGGCAGCGG - Intronic
969242077 4:5905898-5905920 TATGCTAAGCACGGGGGCAGGGG + Intronic
969248806 4:5953967-5953989 TAAGCAAGGCACTTGGTCCAAGG - Intronic
969705344 4:8788649-8788671 AAAGGAAGCCACGGGGCCAGAGG + Intergenic
969705663 4:8789814-8789836 AAAGGAAGGCACGGGGCCAGAGG + Intergenic
972741702 4:41893276-41893298 TAAGCAAGGCCCTGGGAGAGGGG + Intergenic
973200189 4:47491827-47491849 AAAGCATGGTACGAGGTCAGAGG - Intronic
973295761 4:48518941-48518963 TAGGCTAGGCACGGGGCCCGTGG - Intronic
974344310 4:60659029-60659051 TAAGGAAGGCAAGGAGTCACAGG - Intergenic
976591150 4:86850985-86851007 TTAGCAAGAGAAGGGGTCAGGGG + Intergenic
976795699 4:88930443-88930465 TCAGCAATACACAGGGTCAGTGG + Intronic
981076598 4:140598542-140598564 TGAGCAAGGCGCAGGGTCAGTGG + Intergenic
981504987 4:145489930-145489952 GAAGAAAGGCATGGGGTCAGAGG + Intronic
982076964 4:151747400-151747422 CAAGCCAGGCACAGGGTCAAGGG - Intronic
983671526 4:170243429-170243451 TCAGCATGGCATGGGGTCTGTGG + Intergenic
985934900 5:3089939-3089961 TAAGCCAGTCATGGGGTGAGTGG + Intergenic
985976300 5:3420831-3420853 TAAGCAGGTGACGGGGTCACGGG + Intergenic
988825632 5:34931771-34931793 CAAGCCAGGCTTGGGGTCAGCGG + Intronic
991490126 5:67174569-67174591 TGGGGAAGGCAGGGGGTCAGGGG - Intergenic
997976878 5:138446049-138446071 TCAGCAAGGCACTGGGTGGGTGG - Exonic
1001058375 5:168467807-168467829 CAAGCAAGGCCCTGAGTCAGTGG - Intronic
1001901695 5:175436309-175436331 TAAGCCAGGCAGTGTGTCAGAGG + Intergenic
1002564187 5:180100672-180100694 TAAGCACGACACGGGGTCTCTGG + Intergenic
1004694102 6:18018134-18018156 TTAGCCAGGCACGGTGGCAGGGG - Intergenic
1005503778 6:26452259-26452281 TTAGCTAAGCCCGGGGTCAGTGG - Exonic
1011547812 6:88499995-88500017 TAAGCAAGGCATGTATTCAGGGG - Intergenic
1016876818 6:148873599-148873621 TAAGCAAGGCAGGGAGTGTGTGG + Intronic
1018026807 6:159813293-159813315 AAAGCAAGGCACGAGGACAAAGG - Intronic
1022503849 7:30898569-30898591 TTGCCAAGGCACGGGGGCAGAGG - Intergenic
1029386249 7:100245529-100245551 TGAGCAAGGCAGAGGGGCAGGGG - Intronic
1032079131 7:128849948-128849970 GAGGCAAGGCACGGGGGCACAGG - Intronic
1033274419 7:139960383-139960405 AAAACTAGGCACGGTGTCAGGGG + Intronic
1037683830 8:21120722-21120744 TAAGCAAAATATGGGGTCAGAGG + Intergenic
1037906100 8:22716866-22716888 TCTGCCAGGCATGGGGTCAGCGG + Intronic
1045090424 8:98737513-98737535 AAATCAAGGAACAGGGTCAGAGG + Intronic
1047996893 8:130345546-130345568 AAAGCAAGGCAGGGTGGCAGTGG + Intronic
1048214219 8:132480716-132480738 GAGGCCAGGCAGGGGGTCAGGGG + Exonic
1053554295 9:39119081-39119103 TAAAAAAGGAAGGGGGTCAGGGG + Intronic
1053818393 9:41939222-41939244 TAAAAAAGGAAAGGGGTCAGAGG + Intronic
1054108655 9:61082869-61082891 TAAAAAAGGAAAGGGGTCAGAGG + Intergenic
1054361373 9:64123805-64123827 TTAGAAAGGAAGGGGGTCAGAGG + Intergenic
1054612202 9:67248256-67248278 TAAAAAAGGAAAGGGGTCAGAGG - Intergenic
1057934874 9:99228574-99228596 TGAGCAAGGCATGGGGACAGGGG - Intronic
1060374645 9:123107408-123107430 CAAGCAAGGCCAGTGGTCAGAGG + Intergenic
1060678782 9:125542867-125542889 TCAGAAAGGGACTGGGTCAGCGG - Intronic
1062561029 9:137141952-137141974 TGAGCCAGGCACTGGGTTAGAGG - Intronic
1190869870 X:54415788-54415810 GAGGCAGGGCAGGGGGTCAGGGG - Intergenic
1193729913 X:85090345-85090367 TGAGGAAGGCAAGGGGTAAGGGG + Intronic
1195300457 X:103524890-103524912 TGAGAAAGGCAAGGGGACAGAGG - Intergenic