ID: 954089982

View in Genome Browser
Species Human (GRCh38)
Location 3:48276612-48276634
Sequence CCCCGCCATAAGCAAGGCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 72}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954089982_954089989 0 Left 954089982 3:48276612-48276634 CCCGTGCCTTGCTTATGGCGGGG 0: 1
1: 0
2: 0
3: 7
4: 72
Right 954089989 3:48276635-48276657 GTACCAAGGCACCCCAAGTTGGG 0: 1
1: 1
2: 3
3: 6
4: 143
954089982_954089994 17 Left 954089982 3:48276612-48276634 CCCGTGCCTTGCTTATGGCGGGG 0: 1
1: 0
2: 0
3: 7
4: 72
Right 954089994 3:48276652-48276674 GTTGGGAGATATGTTCTCAATGG 0: 3
1: 1
2: 1
3: 13
4: 152
954089982_954089988 -1 Left 954089982 3:48276612-48276634 CCCGTGCCTTGCTTATGGCGGGG 0: 1
1: 0
2: 0
3: 7
4: 72
Right 954089988 3:48276634-48276656 GGTACCAAGGCACCCCAAGTTGG 0: 1
1: 1
2: 2
3: 4
4: 81
954089982_954089995 18 Left 954089982 3:48276612-48276634 CCCGTGCCTTGCTTATGGCGGGG 0: 1
1: 0
2: 0
3: 7
4: 72
Right 954089995 3:48276653-48276675 TTGGGAGATATGTTCTCAATGGG 0: 3
1: 1
2: 2
3: 16
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954089982 Original CRISPR CCCCGCCATAAGCAAGGCAC GGG (reversed) Intronic