ID: 954089982

View in Genome Browser
Species Human (GRCh38)
Location 3:48276612-48276634
Sequence CCCCGCCATAAGCAAGGCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 72}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954089982_954089994 17 Left 954089982 3:48276612-48276634 CCCGTGCCTTGCTTATGGCGGGG 0: 1
1: 0
2: 0
3: 7
4: 72
Right 954089994 3:48276652-48276674 GTTGGGAGATATGTTCTCAATGG 0: 3
1: 1
2: 1
3: 13
4: 152
954089982_954089988 -1 Left 954089982 3:48276612-48276634 CCCGTGCCTTGCTTATGGCGGGG 0: 1
1: 0
2: 0
3: 7
4: 72
Right 954089988 3:48276634-48276656 GGTACCAAGGCACCCCAAGTTGG 0: 1
1: 1
2: 2
3: 4
4: 81
954089982_954089989 0 Left 954089982 3:48276612-48276634 CCCGTGCCTTGCTTATGGCGGGG 0: 1
1: 0
2: 0
3: 7
4: 72
Right 954089989 3:48276635-48276657 GTACCAAGGCACCCCAAGTTGGG 0: 1
1: 1
2: 3
3: 6
4: 143
954089982_954089995 18 Left 954089982 3:48276612-48276634 CCCGTGCCTTGCTTATGGCGGGG 0: 1
1: 0
2: 0
3: 7
4: 72
Right 954089995 3:48276653-48276675 TTGGGAGATATGTTCTCAATGGG 0: 3
1: 1
2: 2
3: 16
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954089982 Original CRISPR CCCCGCCATAAGCAAGGCAC GGG (reversed) Intronic
900005034 1:39554-39576 CTCCTTCATAAGCAAGCCACAGG - Intergenic
902990267 1:20182869-20182891 CCCCGCCTTCAGCAAGCCCCTGG + Intergenic
912471774 1:109911385-109911407 ACCCGCCACCACCAAGGCACGGG + Intronic
914677831 1:149917634-149917656 CCTCCCCATAAGCAAAGCATCGG + Intronic
914785943 1:150830966-150830988 ACCTGCCATATGCCAGGCACTGG + Intronic
920338485 1:205260336-205260358 CCCAGCCCAAAGCAGGGCACAGG - Intronic
921966772 1:221098792-221098814 ATCTGCCATAGGCAAGGCACTGG + Intergenic
1069823752 10:71242850-71242872 CCCTGCCAGCAGCAGGGCACTGG + Intronic
1080505637 11:32910393-32910415 CCAGGCAATGAGCAAGGCACTGG - Intronic
1081692857 11:45089774-45089796 CCCTGCCATAAGAGAGGCCCAGG - Intergenic
1084593973 11:70106270-70106292 CCCTGCCCTATTCAAGGCACTGG + Intronic
1085391138 11:76182906-76182928 CCCAGCCCTGAGCAAGCCACTGG - Intergenic
1091379016 12:43733-43755 CTCCTTCATAAGCAAGCCACAGG - Intergenic
1097900709 12:64871266-64871288 ACTTGCCATCAGCAAGGCACAGG - Intronic
1104203549 12:126615098-126615120 CCCCGCGATGAGCAAGGCGTGGG + Intergenic
1108570173 13:51741865-51741887 CCCAGCCCTCAGTAAGGCACTGG + Intronic
1111936781 13:94566161-94566183 GCCAGCCCTAAGGAAGGCACAGG - Intergenic
1117255210 14:53970294-53970316 CCCAGCCTTGAGCAAGTCACAGG + Intergenic
1122102658 14:99425614-99425636 TCTCGCTCTAAGCAAGGCACTGG + Intronic
1122982557 14:105198221-105198243 CCCCTCCCTCAGCAAGCCACTGG + Intergenic
1128757904 15:70195845-70195867 GCCTGCCATCAGCAAGGCCCTGG - Intergenic
1131036671 15:89226997-89227019 CCCCGCCTTCAGCCAGGCAGAGG - Intergenic
1132092273 15:98956298-98956320 CCCCTCCACACGCAAGGGACAGG - Intronic
1132381960 15:101372241-101372263 CCCCGTAATAAGCCAAGCACCGG - Intronic
1132448478 15:101951390-101951412 CTCCTTCATAAGCAAGCCACAGG + Intergenic
1132792422 16:1699160-1699182 CCCAGCCATCTGGAAGGCACGGG - Exonic
1141110914 16:81270054-81270076 CCCCGCCAGGAGCTAGGCTCAGG - Intronic
1141827976 16:86494293-86494315 CCCCGCCACAGGCCTGGCACCGG - Intergenic
1143137665 17:4720712-4720734 CCCCACCAAAAGCAAGGAAGAGG - Intronic
1143619276 17:8071934-8071956 GGCCACCATAAGCAAGGCCCAGG + Intergenic
1144672988 17:17143442-17143464 CCTCGCCAGGAGCAAGGCCCTGG + Intronic
1146377923 17:32307218-32307240 CCCAGCCATATGCCAGGTACTGG - Intronic
1154337334 18:13476142-13476164 CCCTTCCATAAGGAAGCCACAGG - Intronic
1157037277 18:43990011-43990033 CCCCACCATATGAAAGGCCCTGG - Intergenic
1160636787 19:81163-81185 CTCCTTCATAAGCAAGCCACAGG - Intergenic
1164088751 19:21928957-21928979 CCCCTCTATAAGCAAGGCCCAGG - Intergenic
1164191788 19:22924652-22924674 CCCCTCTATAAGTAAGGCCCAGG - Intergenic
1166290053 19:41857128-41857150 CCCCGCCAAAAGAAAGATACGGG + Intergenic
927503602 2:23598723-23598745 CCCAGTCATAAGCAAAACACAGG - Intronic
940161328 2:150716997-150717019 CCCAGCCATCATGAAGGCACTGG - Intergenic
940341344 2:152584933-152584955 CCCCACCATAAGCAAAGCTTTGG - Intronic
942062044 2:172236393-172236415 CACCACCATAATCAAGACACAGG + Intergenic
948513726 2:238489693-238489715 CCCCGCCATGCCCAATGCACAGG - Intergenic
1175702190 20:61147633-61147655 CCCCGCCACATGCCAGGCACTGG + Intergenic
1176292591 21:5054082-5054104 CCCCGCTATCAGGAAGGGACAGG + Intergenic
1177115939 21:17087423-17087445 ACCTGCTATAAACAAGGCACTGG - Intergenic
1179125049 21:38583189-38583211 CCCTGCCATAAGAACTGCACAGG + Intronic
1179864669 21:44209568-44209590 CCCCGCTATCAGGAAGGGACAGG - Intergenic
1181571364 22:23769353-23769375 CCCCTCCATAAGGAAGGAGCAGG + Intronic
1184507960 22:44915654-44915676 CCCAGCCATAAGCAAGAGAGGGG + Intronic
1185051296 22:48555683-48555705 CCCCGTCATCAGCAAGGCCCAGG + Intronic
1185269824 22:49924279-49924301 CCCCGACATGCACAAGGCACCGG - Intronic
954089982 3:48276612-48276634 CCCCGCCATAAGCAAGGCACGGG - Intronic
968710041 4:2107905-2107927 TCTTGCCATAAGCCAGGCACTGG + Intronic
969338675 4:6527274-6527296 CCCCGCTAGAAGGAATGCACCGG + Intronic
981076594 4:140598534-140598556 CTCCGCCATGAGCAAGGCGCAGG + Intergenic
997500567 5:134370562-134370584 CCCCACCATAGGCAAGTCCCCGG + Intronic
1002101467 5:176860127-176860149 CCCCGCCAAGAGGCAGGCACAGG + Intronic
1004347021 6:14857847-14857869 CCCCGCCTTCAGCAAGAGACTGG + Intergenic
1005475615 6:26204749-26204771 CCCCGCGACGAGCAAGGCGCCGG - Exonic
1007114830 6:39336020-39336042 CCCAGCCACAGGCAAGGCAGTGG - Exonic
1008636373 6:53415022-53415044 CCCTGCCTTAAGCAAACCACTGG + Intergenic
1013447528 6:110245828-110245850 CCCTGCCTCAAGCAGGGCACAGG + Intronic
1014197495 6:118576631-118576653 TCCCCCCATATGCAAGACACAGG - Intronic
1018170263 6:161138844-161138866 CCCCGCCAGAGGCAAGGAGCAGG + Intronic
1018855238 6:167670036-167670058 CCACGCCATAAGAGAGGCTCAGG + Intergenic
1018913452 6:168117657-168117679 CCCCATCATAAGCAGGGCAGGGG + Intergenic
1021472764 7:21024473-21024495 CCCTGCCATAACCAATACACAGG + Intergenic
1023853335 7:44163050-44163072 CCCCTCCCTAGGCAATGCACAGG - Intronic
1026998562 7:74635604-74635626 CCCCACCATAATCAAGATACAGG - Intergenic
1037917853 8:22783485-22783507 CACCGCCATAAGAAAGCCACTGG - Intronic
1049633392 8:143672088-143672110 CCCCGCCCTGCGCAAGGCACAGG - Intergenic
1049887728 9:39336-39358 CTCCTTCATAAGCAAGCCACAGG - Intergenic
1051385066 9:16499019-16499041 ACCTGCCATAAGAAAAGCACAGG + Intronic
1057556925 9:96095436-96095458 CCCTGCCATCAGCAAGGCCCTGG + Intergenic
1059503217 9:114774397-114774419 ACCCGATATATGCAAGGCACTGG + Intergenic
1061057826 9:128233612-128233634 CCACGCCTTTAGGAAGGCACAGG + Intronic
1062448608 9:136606215-136606237 ACCCGCCAGAGGCAAGGCCCCGG + Intergenic
1188015669 X:25105185-25105207 CCCAGCCCTATGCAAAGCACTGG + Intergenic
1195271063 X:103231629-103231651 CCCCCACATAAGGAAGGCAAGGG - Intergenic