ID: 954089986

View in Genome Browser
Species Human (GRCh38)
Location 3:48276618-48276640
Sequence TGGTACCCCCGCCATAAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 4, 3: 2, 4: 33}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954089986_954089989 -6 Left 954089986 3:48276618-48276640 CCTTGCTTATGGCGGGGGTACCA 0: 1
1: 0
2: 4
3: 2
4: 33
Right 954089989 3:48276635-48276657 GTACCAAGGCACCCCAAGTTGGG 0: 1
1: 1
2: 3
3: 6
4: 143
954089986_954089988 -7 Left 954089986 3:48276618-48276640 CCTTGCTTATGGCGGGGGTACCA 0: 1
1: 0
2: 4
3: 2
4: 33
Right 954089988 3:48276634-48276656 GGTACCAAGGCACCCCAAGTTGG 0: 1
1: 1
2: 2
3: 4
4: 81
954089986_954089994 11 Left 954089986 3:48276618-48276640 CCTTGCTTATGGCGGGGGTACCA 0: 1
1: 0
2: 4
3: 2
4: 33
Right 954089994 3:48276652-48276674 GTTGGGAGATATGTTCTCAATGG 0: 3
1: 1
2: 1
3: 13
4: 152
954089986_954089995 12 Left 954089986 3:48276618-48276640 CCTTGCTTATGGCGGGGGTACCA 0: 1
1: 0
2: 4
3: 2
4: 33
Right 954089995 3:48276653-48276675 TTGGGAGATATGTTCTCAATGGG 0: 3
1: 1
2: 2
3: 16
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954089986 Original CRISPR TGGTACCCCCGCCATAAGCA AGG (reversed) Intronic
902215014 1:14929164-14929186 TGCTACCCATGCCATAAGGAAGG + Intronic
916649007 1:166817382-166817404 TGGTCTCCCCACCATAAGCTGGG + Intergenic
916649178 1:166819139-166819161 TGGTCTCCCCACCATAAGCTGGG + Intergenic
916741161 1:167648559-167648581 TGGTTCCCCCTCCACCAGCAGGG + Intronic
1064205205 10:13317566-13317588 TGGACCTCCAGCCATAAGCATGG - Exonic
1066198050 10:33120701-33120723 TGGTACCATCACCACAAGCAAGG + Intergenic
1076411833 10:130257175-130257197 TGGTGCCCCCACCCTCAGCAAGG - Intergenic
1077722334 11:4641164-4641186 TGGTTACCCAGCCATAATCAGGG + Intergenic
1077825696 11:5806287-5806309 TGGTACCCCCACCATGAGCAAGG + Intronic
1104203545 12:126615092-126615114 TGATACCCCCGCGATGAGCAAGG + Intergenic
1104732912 12:131118469-131118491 TGGAACGCCTGCCAAAAGCAAGG - Intronic
1104942256 12:132400625-132400647 TGGGACCCCCGCAGTAAACAGGG + Intergenic
1104942311 12:132400805-132400827 TGGGACCCCCGCTGTAAACAGGG + Intergenic
1116392296 14:44407618-44407640 TGATACCACCACCATAATCAAGG - Intergenic
1133489282 16:6251317-6251339 TGGTACCCATGTCACAAGCAGGG - Intronic
1140202343 16:72904766-72904788 TGGGACCCCCCCCACAGGCAAGG - Intronic
1151534822 17:74732894-74732916 TGGTACCTCCACTATCAGCAGGG + Intronic
1152336896 17:79703786-79703808 TGGGACCCCAGCCACAAGCCCGG + Intergenic
1156484200 18:37454567-37454589 TCACACCCCCGCAATAAGCAAGG + Intronic
1159888895 18:73936332-73936354 TGGTACCACAGCGACAAGCAGGG + Intergenic
1162488412 19:10976409-10976431 TGCTCCCACAGCCATAAGCATGG - Intronic
932130978 2:69186945-69186967 TTGTACCTCTGCTATAAGCAAGG + Intronic
944350066 2:198715903-198715925 TGGTACACCCGTCATCAGGAGGG - Intergenic
948981864 2:241498567-241498589 TGGTCCCCACTCCAGAAGCAGGG - Intronic
1174737578 20:52980020-52980042 TGCTACCCCAGCCTGAAGCAGGG + Intronic
1183431656 22:37769432-37769454 GGGCACCCCCGCCATAGGCTGGG + Intronic
1185194621 22:49461462-49461484 TAGTTCCCCTGGCATAAGCAGGG + Intronic
950367223 3:12495883-12495905 CTGTACCCCAGGCATAAGCAGGG - Intronic
954089986 3:48276618-48276640 TGGTACCCCCGCCATAAGCAAGG - Intronic
964612030 3:158625155-158625177 TGGTACCCCTGCCATGAGCAAGG + Intergenic
971346468 4:25815996-25816018 TGGTAAGCCCTACATAAGCAGGG - Intronic
975356513 4:73412263-73412285 AGGTACCACCACCATAGGCAGGG - Intronic
977619923 4:99124981-99125003 TGGAACCCCTGCTATGAGCAGGG + Intronic
981076592 4:140598528-140598550 TGGTACCTCCGCCATGAGCAAGG + Intergenic
998038362 5:138935453-138935475 TGGCATCCCCACCCTAAGCAAGG + Intergenic
1011211980 6:84965055-84965077 TGGTACCCCCACCATGAGCAAGG + Intergenic
1013441942 6:110179720-110179742 AGGGACCCGCGCCAGAAGCAGGG + Exonic
1036501602 8:9319430-9319452 TCTTATCCCCGCCCTAAGCAAGG - Intergenic
1049466189 8:142752238-142752260 TGGCCCCCCCGCCATAAGGAGGG - Intronic
1192054605 X:67760381-67760403 TGTTCCCCCCGCCACAAGTAGGG + Intergenic