ID: 954089988

View in Genome Browser
Species Human (GRCh38)
Location 3:48276634-48276656
Sequence GGTACCAAGGCACCCCAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 1, 2: 2, 3: 4, 4: 81}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954089977_954089988 7 Left 954089977 3:48276604-48276626 CCACTGACCCCGTGCCTTGCTTA 0: 1
1: 0
2: 1
3: 10
4: 131
Right 954089988 3:48276634-48276656 GGTACCAAGGCACCCCAAGTTGG 0: 1
1: 1
2: 2
3: 4
4: 81
954089980_954089988 0 Left 954089980 3:48276611-48276633 CCCCGTGCCTTGCTTATGGCGGG 0: 1
1: 0
2: 0
3: 1
4: 42
Right 954089988 3:48276634-48276656 GGTACCAAGGCACCCCAAGTTGG 0: 1
1: 1
2: 2
3: 4
4: 81
954089973_954089988 27 Left 954089973 3:48276584-48276606 CCTCTGCCCCTTCAGAGAAGCCA 0: 2
1: 2
2: 5
3: 30
4: 337
Right 954089988 3:48276634-48276656 GGTACCAAGGCACCCCAAGTTGG 0: 1
1: 1
2: 2
3: 4
4: 81
954089976_954089988 19 Left 954089976 3:48276592-48276614 CCTTCAGAGAAGCCACTGACCCC 0: 2
1: 1
2: 5
3: 26
4: 215
Right 954089988 3:48276634-48276656 GGTACCAAGGCACCCCAAGTTGG 0: 1
1: 1
2: 2
3: 4
4: 81
954089982_954089988 -1 Left 954089982 3:48276612-48276634 CCCGTGCCTTGCTTATGGCGGGG 0: 1
1: 0
2: 0
3: 7
4: 72
Right 954089988 3:48276634-48276656 GGTACCAAGGCACCCCAAGTTGG 0: 1
1: 1
2: 2
3: 4
4: 81
954089974_954089988 21 Left 954089974 3:48276590-48276612 CCCCTTCAGAGAAGCCACTGACC 0: 3
1: 1
2: 6
3: 18
4: 173
Right 954089988 3:48276634-48276656 GGTACCAAGGCACCCCAAGTTGG 0: 1
1: 1
2: 2
3: 4
4: 81
954089975_954089988 20 Left 954089975 3:48276591-48276613 CCCTTCAGAGAAGCCACTGACCC 0: 3
1: 0
2: 3
3: 19
4: 181
Right 954089988 3:48276634-48276656 GGTACCAAGGCACCCCAAGTTGG 0: 1
1: 1
2: 2
3: 4
4: 81
954089986_954089988 -7 Left 954089986 3:48276618-48276640 CCTTGCTTATGGCGGGGGTACCA 0: 1
1: 0
2: 4
3: 2
4: 33
Right 954089988 3:48276634-48276656 GGTACCAAGGCACCCCAAGTTGG 0: 1
1: 1
2: 2
3: 4
4: 81
954089984_954089988 -2 Left 954089984 3:48276613-48276635 CCGTGCCTTGCTTATGGCGGGGG 0: 1
1: 0
2: 0
3: 5
4: 79
Right 954089988 3:48276634-48276656 GGTACCAAGGCACCCCAAGTTGG 0: 1
1: 1
2: 2
3: 4
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954089988 Original CRISPR GGTACCAAGGCACCCCAAGT TGG Intronic
901680647 1:10910766-10910788 GGTGCCAAGGGACACCAAGCAGG + Intergenic
903423181 1:23233382-23233404 GTTTCCAAGGCACCACTAGTTGG + Intergenic
905318345 1:37097676-37097698 GGGACCAAGTCACTCCAGGTAGG - Intergenic
916207114 1:162325758-162325780 GGTACCAAGTCACCTGAAGATGG - Intronic
919726403 1:200887617-200887639 GGGTCCAAGTCTCCCCAAGTGGG + Intergenic
924629209 1:245721327-245721349 GGTACCAGCTCACCCAAAGTAGG + Intergenic
1063469741 10:6274790-6274812 GGTACCACTGCACTCCAGGTTGG + Intergenic
1067008932 10:42691534-42691556 GGTAGAAAGGCAGCCCAGGTAGG - Intergenic
1072160395 10:92760907-92760929 GGTACCAAGGCACTCAATTTTGG + Intergenic
1072620334 10:97075177-97075199 GGTACCAGGGCACCTCATCTGGG + Intronic
1080175526 11:29358347-29358369 GGTACCATGGCACACCACCTGGG - Intergenic
1088258422 11:107922783-107922805 GTCACCCAGGCACCCCAGGTTGG - Intronic
1089555089 11:119311764-119311786 GAGACCAGGTCACCCCAAGTGGG - Intronic
1093095760 12:14970511-14970533 GGTATCAAAGAAGCCCAAGTGGG - Intergenic
1096293028 12:50358537-50358559 TGTACCAATGCACCCCAGCTTGG + Intronic
1104203543 12:126615076-126615098 GGTATCAAGGCACCCCAAGTTGG - Intergenic
1104732280 12:131114363-131114385 GATACCAATGCAGCCCCAGTAGG + Intronic
1110917508 13:81041182-81041204 GGTACAAAGGCAACTCAAGTGGG + Intergenic
1115654364 14:35429434-35429456 TGTACCACGGCACCCCAGCTTGG - Intergenic
1125386509 15:39142471-39142493 GGTACCACTGCACTCCAGGTTGG + Intergenic
1128518586 15:68360535-68360557 GATTCCAGGGCACCCCATGTGGG - Intronic
1137233033 16:46585905-46585927 GGTATCAATGAACGCCAAGTGGG + Intronic
1140911548 16:79457771-79457793 GTGATCAAGGCACCCCAAGAAGG + Intergenic
1146106203 17:30039567-30039589 GGTACCAAGATACCCCAAGTTGG + Intronic
1149724259 17:58877217-58877239 GGTACCAAGGCTACCTATGTTGG - Intronic
1151825484 17:76521649-76521671 GGCACCAGGGCACTCCAACTTGG - Intergenic
1155037747 18:22039509-22039531 TGTTCCAAGGCCCCCAAAGTGGG - Intergenic
1157669721 18:49518114-49518136 GGTACCGTGGCTCACCAAGTTGG + Intergenic
1159390848 18:67790026-67790048 GATACAAAAGCAACCCAAGTGGG - Intergenic
1160764959 19:803462-803484 GGACCCCAGGCAGCCCAAGTGGG + Intronic
1161698590 19:5783508-5783530 GGTACAGGGGCACCCCAGGTCGG + Exonic
1167911561 19:52707676-52707698 GGCACCATGGCACTCCAAGCTGG - Intronic
1168475735 19:56673703-56673725 CCTACCCAGGGACCCCAAGTAGG - Intergenic
927347960 2:22069681-22069703 GGTACCAACTCAGCCAAAGTGGG + Intergenic
929366241 2:41159917-41159939 TGTAACAAGTGACCCCAAGTTGG + Intergenic
931116020 2:59167686-59167708 TTTACCAAGGCAGCCCAAGCAGG - Intergenic
934943299 2:98518292-98518314 GGTCCCTGGGCACCCCTAGTGGG + Intronic
936428371 2:112437423-112437445 CTGACCAAGGCCCCCCAAGTGGG + Intergenic
937819605 2:126294419-126294441 GGTACCATTGCACTCCAACTTGG - Intergenic
939818945 2:146931384-146931406 AGTACCACTGCACCCCAGGTTGG + Intergenic
943904182 2:193476393-193476415 AGTACTTAGGCACCCCAAGGCGG + Intergenic
945695693 2:213100998-213101020 TCTACCATGGCAGCCCAAGTAGG - Intronic
1169250941 20:4060832-4060854 GGTAACAAGGCACCCAGGGTTGG + Intergenic
1174032240 20:47639129-47639151 GTTACCAAAGCAACCCATGTTGG + Exonic
1175288908 20:57860172-57860194 GGTGCCCAGGCACCCCATATTGG - Intergenic
1176032313 20:63018469-63018491 GATACCAGCGCACCCCAAATCGG - Intergenic
1183964680 22:41434624-41434646 CCTACCCAGGGACCCCAAGTAGG - Exonic
1185173084 22:49304752-49304774 GCTCCCAAGGGACCCCAAGAAGG + Intergenic
950218247 3:11174973-11174995 GAAACCAAGCCACACCAAGTGGG - Intronic
950322462 3:12069761-12069783 GGTACCAAATCACACCCAGTAGG - Intronic
953367567 3:42359191-42359213 GGTACCTAGGCAGCACAAGAGGG - Intergenic
954089988 3:48276634-48276656 GGTACCAAGGCACCCCAAGTTGG + Intronic
961406319 3:126682242-126682264 GGTGCCAAGCCTCCCCAAGGAGG + Intergenic
964786930 3:160406973-160406995 GGGACCGAGGCTCCCAAAGTAGG - Intronic
968477581 4:819611-819633 GAAACCAAGTCTCCCCAAGTTGG + Intronic
973296586 4:48529774-48529796 GGCACCAAGGCACCAAGAGTGGG + Intronic
984859278 4:184221833-184221855 GGTCCCAAGTCAGCCCATGTCGG + Intergenic
984869247 4:184312016-184312038 GGTACCAAAGCACCACAGATAGG - Intergenic
985903295 5:2813784-2813806 GGTACAGAGGGACCCCAAGCAGG - Intergenic
986749918 5:10777736-10777758 GGTACTAAGGAATCACAAGTTGG + Intergenic
992046326 5:72893970-72893992 GGTACCAAGGCTTCCCTGGTGGG - Intronic
994901168 5:105771471-105771493 GGGAGCAAGGGACCACAAGTAGG - Intergenic
1001265031 5:170268087-170268109 GGTACCCAGGCAACACCAGTAGG + Intronic
1002567055 5:180118204-180118226 GGGACCAAAGGGCCCCAAGTGGG + Intronic
1004168221 6:13275344-13275366 GGTACCAAGACAACCCCATTAGG - Intronic
1005966569 6:30730860-30730882 GCCACCTAGGCACCCCAAGATGG - Intronic
1008617467 6:53240462-53240484 GGCAACAAGAAACCCCAAGTGGG + Intergenic
1008953180 6:57183026-57183048 GGCACCAAAGGAGCCCAAGTAGG - Intronic
1012639760 6:101595045-101595067 GGTACCGAGAAACCTCAAGTAGG + Intronic
1015804263 6:137092508-137092530 TGTAACAAAGCACCACAAGTTGG + Intergenic
1019493510 7:1325751-1325773 GGTACCAGGGCCCCCCATGCAGG + Intergenic
1019731077 7:2630053-2630075 GGTACCAGCCCACTCCAAGTAGG + Intergenic
1019734094 7:2641930-2641952 GGGACCCGGGCAGCCCAAGTGGG + Intronic
1019974975 7:4573885-4573907 GGTCCTCAGGCACCCCAGGTGGG + Intergenic
1021737899 7:23657155-23657177 GGTATGAAGGCACCCCAAGTTGG + Intergenic
1023105310 7:36758232-36758254 GGTGCCAATGCACTCCAACTTGG + Intergenic
1029677177 7:102078122-102078144 GGTACCAGTGCACTCCAGGTTGG - Intronic
1032010668 7:128345280-128345302 GGTGCCACTGCACCCCAAGTTGG - Intergenic
1040621942 8:49101312-49101334 GGTACCAAGATACCCCAAATTGG + Intergenic
1041180477 8:55242465-55242487 GGTAACAAGGCACTGCAAGAAGG + Intronic
1048558361 8:135505370-135505392 GGTCCCAAGGGACCACAAGCAGG - Intronic
1060540500 9:124426887-124426909 GGTACCACTGCACTCCAGGTTGG - Intergenic
1062001571 9:134218519-134218541 GGCTGCAAAGCACCCCAAGTGGG - Intergenic
1187007646 X:15248117-15248139 GGAACAAAGACACCTCAAGTTGG - Intronic
1189715913 X:43866039-43866061 GGAAACAAGGCATCCGAAGTAGG + Intronic
1190101268 X:47524361-47524383 GTTATCAAGTCACCCCAAGTGGG + Intergenic
1190571453 X:51786677-51786699 GGTACCAAGGGAGGCTAAGTGGG - Intergenic
1193485752 X:82084096-82084118 GGTACCATTGCACTCCAACTTGG + Intergenic
1201595103 Y:15659568-15659590 GGTAACAAGGCTCCCACAGTGGG + Intergenic