ID: 954089989

View in Genome Browser
Species Human (GRCh38)
Location 3:48276635-48276657
Sequence GTACCAAGGCACCCCAAGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 1, 2: 3, 3: 6, 4: 143}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954089975_954089989 21 Left 954089975 3:48276591-48276613 CCCTTCAGAGAAGCCACTGACCC 0: 3
1: 0
2: 3
3: 19
4: 181
Right 954089989 3:48276635-48276657 GTACCAAGGCACCCCAAGTTGGG 0: 1
1: 1
2: 3
3: 6
4: 143
954089984_954089989 -1 Left 954089984 3:48276613-48276635 CCGTGCCTTGCTTATGGCGGGGG 0: 1
1: 0
2: 0
3: 5
4: 79
Right 954089989 3:48276635-48276657 GTACCAAGGCACCCCAAGTTGGG 0: 1
1: 1
2: 3
3: 6
4: 143
954089982_954089989 0 Left 954089982 3:48276612-48276634 CCCGTGCCTTGCTTATGGCGGGG 0: 1
1: 0
2: 0
3: 7
4: 72
Right 954089989 3:48276635-48276657 GTACCAAGGCACCCCAAGTTGGG 0: 1
1: 1
2: 3
3: 6
4: 143
954089974_954089989 22 Left 954089974 3:48276590-48276612 CCCCTTCAGAGAAGCCACTGACC 0: 3
1: 1
2: 6
3: 18
4: 173
Right 954089989 3:48276635-48276657 GTACCAAGGCACCCCAAGTTGGG 0: 1
1: 1
2: 3
3: 6
4: 143
954089973_954089989 28 Left 954089973 3:48276584-48276606 CCTCTGCCCCTTCAGAGAAGCCA 0: 2
1: 2
2: 5
3: 30
4: 337
Right 954089989 3:48276635-48276657 GTACCAAGGCACCCCAAGTTGGG 0: 1
1: 1
2: 3
3: 6
4: 143
954089977_954089989 8 Left 954089977 3:48276604-48276626 CCACTGACCCCGTGCCTTGCTTA 0: 1
1: 0
2: 1
3: 10
4: 131
Right 954089989 3:48276635-48276657 GTACCAAGGCACCCCAAGTTGGG 0: 1
1: 1
2: 3
3: 6
4: 143
954089976_954089989 20 Left 954089976 3:48276592-48276614 CCTTCAGAGAAGCCACTGACCCC 0: 2
1: 1
2: 5
3: 26
4: 215
Right 954089989 3:48276635-48276657 GTACCAAGGCACCCCAAGTTGGG 0: 1
1: 1
2: 3
3: 6
4: 143
954089980_954089989 1 Left 954089980 3:48276611-48276633 CCCCGTGCCTTGCTTATGGCGGG 0: 1
1: 0
2: 0
3: 1
4: 42
Right 954089989 3:48276635-48276657 GTACCAAGGCACCCCAAGTTGGG 0: 1
1: 1
2: 3
3: 6
4: 143
954089986_954089989 -6 Left 954089986 3:48276618-48276640 CCTTGCTTATGGCGGGGGTACCA 0: 1
1: 0
2: 4
3: 2
4: 33
Right 954089989 3:48276635-48276657 GTACCAAGGCACCCCAAGTTGGG 0: 1
1: 1
2: 3
3: 6
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954089989 Original CRISPR GTACCAAGGCACCCCAAGTT GGG Intronic
902426151 1:16323745-16323767 GTACCACTGCACTCCAAGGTGGG + Intronic
903423182 1:23233383-23233405 TTTCCAAGGCACCACTAGTTGGG + Intergenic
903491290 1:23730607-23730629 GTACCACGGCACTCCAACCTGGG - Intergenic
903536790 1:24072135-24072157 GAGCCAAGGAACCCCAAGGTCGG - Intronic
904646630 1:31972404-31972426 GCACCACTGCACCCCAACTTGGG + Intergenic
908022908 1:59916688-59916710 GTGCCATGGCACTCCAACTTGGG + Intronic
908183813 1:61632495-61632517 GTACCACTGCACTCCAAGGTGGG - Intergenic
909407688 1:75311157-75311179 GTGCCAATGCACTCCAACTTGGG - Intronic
912723701 1:112041229-112041251 GTACGAAGAAACCCCCAGTTTGG + Intergenic
917355435 1:174122148-174122170 GTACCACTGCACTCCAAGTATGG + Intergenic
918573465 1:186026674-186026696 GTACCACTGCACTCCAACTTGGG - Intronic
924093163 1:240523133-240523155 GTGCCAATGCACCCCAACCTGGG - Intronic
1063469742 10:6274791-6274813 GTACCACTGCACTCCAGGTTGGG + Intergenic
1064783835 10:18872064-18872086 CTACCAAGGCTCTCCATGTTAGG - Intergenic
1074266813 10:111912580-111912602 GTAACAAAGCACCACAAATTGGG - Intergenic
1075011506 10:118874305-118874327 GTACCATGCCACTCCAAGTCAGG + Intergenic
1075209726 10:120480896-120480918 GTCTCAAGGCACAGCAAGTTAGG + Intronic
1075743107 10:124707694-124707716 GCACCACGGCACTCCAGGTTGGG + Intronic
1077825694 11:5806270-5806292 GTACCAAGGCACCTTAAGTTAGG - Intronic
1078634243 11:13033991-13034013 GTAACAAAGCACCACAAATTGGG - Intergenic
1079280288 11:19081177-19081199 GTCCCTAGACACCCCAATTTAGG - Intergenic
1080722340 11:34862241-34862263 GTACCATTGCACTCCAACTTGGG - Intronic
1081996000 11:47364527-47364549 ATACCAGGGCACTCCAACTTGGG - Intronic
1083064947 11:59914855-59914877 GTAACAAAGCACCACAAATTGGG + Intergenic
1083292500 11:61697721-61697743 GTACCACGGCACTCCAGGCTGGG - Intronic
1084137857 11:67200552-67200574 GTACCATTGCACTCCAACTTGGG - Intronic
1088491604 11:110393668-110393690 GTGCCAATGCACTCCAACTTGGG + Intergenic
1092048897 12:5454053-5454075 GTAACAAAGCACCACAAATTGGG + Intronic
1095788525 12:46137819-46137841 GTACCAGGGCACCTCAGCTTTGG + Intergenic
1097517856 12:60628062-60628084 GCACCACTGCACTCCAAGTTGGG - Intergenic
1102842077 12:116135581-116135603 GTAACAAACCACCCCAAATTTGG - Intronic
1104203542 12:126615075-126615097 GTATCAAGGCACCCCAAGTTGGG - Intergenic
1106089856 13:26580972-26580994 GTACCACTGCACCCCAGCTTGGG - Intronic
1106455080 13:29919811-29919833 ATACCATGGCACTCCAACTTGGG + Intergenic
1106724850 13:32473500-32473522 GTAACAAGTCACCACAAATTTGG + Intronic
1110756768 13:79183998-79184020 GTACCAATGCACTCCAACCTGGG + Intergenic
1115654363 14:35429433-35429455 GTACCACGGCACCCCAGCTTGGG - Intergenic
1116504725 14:45664765-45664787 GTTCCAAGCCACCCAAAGCTTGG + Intergenic
1117004779 14:51409639-51409661 GTACCACTGCACCCCAACCTGGG - Intergenic
1119245652 14:73104409-73104431 GTACCACTGCACTCCAACTTGGG - Intronic
1120609354 14:86621450-86621472 GTAACAAAGCACCACAAATTGGG + Intergenic
1121418362 14:93794944-93794966 GTAACAAAACACCCCAAGCTGGG - Intergenic
1125386510 15:39142472-39142494 GTACCACTGCACTCCAGGTTGGG + Intergenic
1125647908 15:41288324-41288346 GTAACAAAGCACCACAAATTGGG + Intergenic
1129491368 15:75928998-75929020 GTAACAAAGTACCCCAAATTTGG + Intronic
1131181417 15:90242483-90242505 GTACCAGTGCACCCCAACCTAGG - Exonic
1131189745 15:90304484-90304506 ATACCAAGGCACCCCATCCTGGG + Intronic
1131618930 15:94046606-94046628 GGCCCAAGGCAGCCCAGGTTTGG + Intergenic
1136243793 16:28961441-28961463 GTAACAAAGTACCACAAGTTGGG + Intronic
1137287463 16:47028007-47028029 GTACCACGGCACCCCAGCCTGGG - Intergenic
1137827480 16:51511823-51511845 GTACAAATGGACACCAAGTTAGG + Intergenic
1140764542 16:78145031-78145053 GTAACAAAGCACCACAAATTGGG + Intronic
1143743165 17:8968781-8968803 GTAACACGGCACAACAAGTTTGG + Intergenic
1145806844 17:27740445-27740467 GTACCAGTGCACTCCAGGTTGGG - Intergenic
1147892332 17:43726158-43726180 GTAACAAGCCACCCCAAAGTTGG - Intergenic
1149444116 17:56700347-56700369 GCACCACGGCACCCCAGGCTGGG + Intergenic
1150165024 17:62933144-62933166 GTAACAAGGCACCACAAACTGGG - Intergenic
1150354206 17:64469438-64469460 GTACCATGGCACTCCAACCTGGG - Intergenic
1151626460 17:75278938-75278960 GTACCACGGCACTCCAACCTGGG + Intronic
1151825483 17:76521648-76521670 GCACCAGGGCACTCCAACTTGGG - Intergenic
1151947999 17:77329913-77329935 GTCCGAAGCCACCCCAAGTCTGG - Intronic
1156295139 18:35782546-35782568 GTAACAAAGCATCCCAAATTTGG - Intergenic
1156895502 18:42240973-42240995 AGGCCAGGGCACCCCAAGTTTGG - Intergenic
1157639170 18:49195964-49195986 GCACCACTGCACTCCAAGTTGGG - Intronic
1158635712 18:59155020-59155042 GCACCAAGGCACTCCAGCTTGGG + Intronic
1161961510 19:7526017-7526039 ATACCATGGCACTCCAACTTGGG + Intronic
1163085635 19:14977736-14977758 GTACCACTGCACTCCAACTTGGG + Intronic
1163562432 19:18027786-18027808 GTACCACTGCACTCCAACTTGGG - Intergenic
1165293980 19:34911281-34911303 GCACCAATGCACTCCAATTTGGG + Intergenic
1168047560 19:53804985-53805007 GTGCCACTGCACCCCAACTTGGG + Intronic
925410169 2:3635192-3635214 GTGCCAAGCCTCCCCAAGGTAGG - Intronic
926289867 2:11520093-11520115 GTACCATGGTACCCCAATCTGGG + Intergenic
926664179 2:15501803-15501825 GTACCACTGCACTCCAACTTGGG - Intronic
927660131 2:24986346-24986368 GTATTCACGCACCCCAAGTTTGG + Intergenic
927794987 2:26040192-26040214 GCACCACTGCACTCCAAGTTGGG - Intronic
927951161 2:27170428-27170450 GTACCAAAGCACTCCAACCTGGG + Intergenic
929366242 2:41159918-41159940 GTAACAAGTGACCCCAAGTTGGG + Intergenic
931346943 2:61455219-61455241 GTACCACTGCACTCCAGGTTGGG - Intronic
932385350 2:71327369-71327391 GTAACAAATCACCACAAGTTGGG - Intronic
935324315 2:101922184-101922206 GTACCACTGCACTCCAACTTGGG + Intergenic
937819604 2:126294418-126294440 GTACCATTGCACTCCAACTTGGG - Intergenic
939818946 2:146931385-146931407 GTACCACTGCACCCCAGGTTGGG + Intergenic
941904353 2:170706631-170706653 GTACCACTGCACCCCAACCTGGG + Intergenic
945469087 2:210206386-210206408 GTACCACTGCACCCCAACCTGGG + Intronic
945695692 2:213100997-213101019 CTACCATGGCAGCCCAAGTAGGG - Intronic
1174032241 20:47639130-47639152 TTACCAAAGCAACCCATGTTGGG + Exonic
1175120760 20:56714493-56714515 GTACCAAGGCACTCCAGCCTGGG + Intergenic
1175969821 20:62679402-62679424 GTACCACTGCACTCCAAGCTGGG - Intronic
1176381449 21:6115640-6115662 GTACCACTGCACTCCAACTTGGG - Intronic
1179220479 21:39402486-39402508 AAACCCAGGCAGCCCAAGTTAGG - Intronic
1179742023 21:43422599-43422621 GTACCACTGCACTCCAACTTGGG + Intronic
952151341 3:30595879-30595901 GTACCAATGCACCCCAGCCTAGG + Intergenic
952231434 3:31435023-31435045 GTAACAAATGACCCCAAGTTTGG + Intergenic
952411861 3:33056454-33056476 GTGCCACTGCACCCCAAGCTGGG - Intronic
954089989 3:48276635-48276657 GTACCAAGGCACCCCAAGTTGGG + Intronic
954343714 3:49978041-49978063 GTACCAATGCACTCCAACCTGGG - Intronic
955111103 3:55950833-55950855 GTACCAAGGAAACACAACTTAGG + Intronic
955350531 3:58190050-58190072 GTACCATGGCACTCCAGCTTGGG - Intergenic
956702500 3:71970849-71970871 GTAACAAAGGACCACAAGTTGGG - Intergenic
963792884 3:149602374-149602396 GAACAAAGGCAACCCAAGATGGG + Intronic
964612028 3:158625138-158625160 GTACCAAGGCACTCTAAGTTAGG - Intergenic
966703624 3:182885315-182885337 GTACCAAAGGACCCAAAGATAGG - Intronic
968477582 4:819612-819634 AAACCAAGTCTCCCCAAGTTGGG + Intronic
969841007 4:9881831-9881853 GAATTAAGGCATCCCAAGTTTGG - Intronic
975366695 4:73538036-73538058 GTGTGAAGGCACCCAAAGTTAGG - Intergenic
976172789 4:82321624-82321646 GCACCACTGCACTCCAAGTTGGG - Intergenic
980976177 4:139612601-139612623 TTACCAAGGATCCCCAAATTGGG + Intergenic
981775830 4:148366370-148366392 ATACCAAGGTACCCCATGTCAGG + Intronic
981882037 4:149625821-149625843 ATACCAAGGCACCACATTTTTGG + Intergenic
984584274 4:181545386-181545408 AAAACAAGGCACCTCAAGTTGGG + Intergenic
985500588 5:242020-242042 GCACCAAGACACACCATGTTTGG - Intronic
986749919 5:10777737-10777759 GTACTAAGGAATCACAAGTTGGG + Intergenic
987143934 5:14973078-14973100 GTACCATGGCACCCCAGCCTGGG - Intergenic
990620499 5:57554058-57554080 GTAACAAGGTACCACAAATTGGG - Intergenic
990935992 5:61149970-61149992 GTACCACGGCACTCCAACCTAGG - Intronic
991032710 5:62099558-62099580 GTACCACTGCACTCCAACTTGGG - Intergenic
993434785 5:87878921-87878943 GTATCATGGGAACCCAAGTTTGG - Intergenic
996707423 5:126511764-126511786 GTACCACTGCACTCCAAGCTGGG + Intergenic
999477971 5:151918970-151918992 GTACCCAGGGACCCCATATTGGG - Intronic
999773183 5:154790858-154790880 GTACCATGGCACTCCAACCTGGG - Intronic
1002593768 5:180308910-180308932 GTGCCACTGCACCCCAGGTTGGG - Intronic
1003663476 6:8087258-8087280 GCACCAAGGCACTCCAGCTTGGG - Intronic
1003704765 6:8512794-8512816 GTACCACTGCACTCCAGGTTGGG + Intergenic
1004710961 6:18169950-18169972 GTACCAATGCACCCCAGCCTGGG - Intronic
1007798922 6:44375400-44375422 CTCCCAAGGCACCCCAATTCTGG - Intronic
1013967240 6:115969608-115969630 GAACCAAGGAACCCCAATTCCGG + Intronic
1015651281 6:135463792-135463814 GTACCACTGCACTCCAACTTGGG - Intronic
1015804264 6:137092509-137092531 GTAACAAAGCACCACAAGTTGGG + Intergenic
1016471470 6:144379216-144379238 GTAACAAGTCACCCCAACATTGG + Intronic
1016615381 6:146041915-146041937 AGATCAAGGCACCACAAGTTTGG + Intronic
1021737900 7:23657156-23657178 GTATGAAGGCACCCCAAGTTGGG + Intergenic
1023105311 7:36758233-36758255 GTGCCAATGCACTCCAACTTGGG + Intergenic
1024583793 7:50823612-50823634 GCACCATGGCACCCCAGTTTGGG - Intergenic
1029677176 7:102078121-102078143 GTACCAGTGCACTCCAGGTTGGG - Intronic
1030253693 7:107482182-107482204 GTACCACTGCACCCCAACCTGGG - Intronic
1032010667 7:128345279-128345301 GTGCCACTGCACCCCAAGTTGGG - Intergenic
1037460862 8:19107713-19107735 GTACCACTGCACTCCAACTTGGG + Intergenic
1038050430 8:23804625-23804647 GTACCACGGCACTCCAACCTGGG + Intergenic
1041511884 8:58661690-58661712 GTACCACTGCACCCCAACCTAGG + Intergenic
1045323848 8:101102210-101102232 GTACCACTGCACTCCAACTTGGG - Intergenic
1046042087 8:108917858-108917880 GTGCCACTGCACTCCAAGTTGGG + Intergenic
1055706858 9:79015020-79015042 GTACCAAGGCAGCTAAGGTTTGG + Intergenic
1056532459 9:87498742-87498764 GCACCACGGCACCCCGAGGTCGG - Intronic
1056549797 9:87642724-87642746 CTACCACGGCACCCCAAAATTGG - Intronic
1058723421 9:107779438-107779460 GTACCACTGCACTCCAGGTTGGG + Intergenic
1060540499 9:124426886-124426908 GTACCACTGCACTCCAGGTTGGG - Intergenic
1185976307 X:4724690-4724712 GCACCACTGCACACCAAGTTGGG - Intergenic
1187007645 X:15248116-15248138 GAACAAAGACACCTCAAGTTGGG - Intronic
1189314941 X:40048529-40048551 GTACCACTGCACTCCAAGTCTGG + Intergenic
1193485753 X:82084097-82084119 GTACCATTGCACTCCAACTTGGG + Intergenic
1195757639 X:108214923-108214945 GTACCAAGGAAGCCCAACTCTGG - Intronic
1198028809 X:132735303-132735325 GTATCAAGGCAGCCCAAGTAAGG + Intronic
1198712053 X:139515081-139515103 GTAACAAAGCACCACAAATTTGG - Intergenic
1200281205 X:154778411-154778433 GTACCACGGGACCCCAGGCTTGG + Intergenic