ID: 954089995

View in Genome Browser
Species Human (GRCh38)
Location 3:48276653-48276675
Sequence TTGGGAGATATGTTCTCAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 3, 1: 1, 2: 2, 3: 16, 4: 136}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954089977_954089995 26 Left 954089977 3:48276604-48276626 CCACTGACCCCGTGCCTTGCTTA 0: 1
1: 0
2: 1
3: 10
4: 131
Right 954089995 3:48276653-48276675 TTGGGAGATATGTTCTCAATGGG 0: 3
1: 1
2: 2
3: 16
4: 136
954089980_954089995 19 Left 954089980 3:48276611-48276633 CCCCGTGCCTTGCTTATGGCGGG 0: 1
1: 0
2: 0
3: 1
4: 42
Right 954089995 3:48276653-48276675 TTGGGAGATATGTTCTCAATGGG 0: 3
1: 1
2: 2
3: 16
4: 136
954089986_954089995 12 Left 954089986 3:48276618-48276640 CCTTGCTTATGGCGGGGGTACCA 0: 1
1: 0
2: 4
3: 2
4: 33
Right 954089995 3:48276653-48276675 TTGGGAGATATGTTCTCAATGGG 0: 3
1: 1
2: 2
3: 16
4: 136
954089984_954089995 17 Left 954089984 3:48276613-48276635 CCGTGCCTTGCTTATGGCGGGGG 0: 1
1: 0
2: 0
3: 5
4: 79
Right 954089995 3:48276653-48276675 TTGGGAGATATGTTCTCAATGGG 0: 3
1: 1
2: 2
3: 16
4: 136
954089990_954089995 -8 Left 954089990 3:48276638-48276660 CCAAGGCACCCCAAGTTGGGAGA 0: 1
1: 0
2: 3
3: 17
4: 203
Right 954089995 3:48276653-48276675 TTGGGAGATATGTTCTCAATGGG 0: 3
1: 1
2: 2
3: 16
4: 136
954089982_954089995 18 Left 954089982 3:48276612-48276634 CCCGTGCCTTGCTTATGGCGGGG 0: 1
1: 0
2: 0
3: 7
4: 72
Right 954089995 3:48276653-48276675 TTGGGAGATATGTTCTCAATGGG 0: 3
1: 1
2: 2
3: 16
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954089995 Original CRISPR TTGGGAGATATGTTCTCAAT GGG Intronic
900196505 1:1378928-1378950 TTGGGAGCTATGTTTGGAATGGG + Intergenic
901616719 1:10546168-10546190 TTAGAAGATATATTCTTAATGGG + Intronic
902120624 1:14162261-14162283 TTGACAGATATGCTATCAATCGG - Intergenic
909406341 1:75294101-75294123 TTGGGAGATATGATTTTACTTGG + Intronic
911163703 1:94707348-94707370 TTGGTAGATATGTACTTTATAGG - Intergenic
914740827 1:150463317-150463339 TTTTGAGATATGGTCTCACTGGG - Intronic
915736942 1:158091067-158091089 TTGGGACTTATGTCCTAAATAGG - Intronic
916724275 1:167509011-167509033 TTGGTAAATATTTACTCAATTGG + Intronic
917486479 1:175459504-175459526 TTGGGGAAGGTGTTCTCAATAGG - Intronic
920791616 1:209098239-209098261 TTTGGAAATATGTTATCCATAGG - Intergenic
923877926 1:238070747-238070769 TTTGTAGATATTTTCTAAATGGG + Intergenic
1065388239 10:25155665-25155687 TTGGGGAATTTGTTCTCATTAGG - Intergenic
1069302355 10:66924222-66924244 TTGGGCAGTATGTTCTTAATAGG - Intronic
1071087130 10:81876416-81876438 TTGGGAGATCTGTTCTCACTTGG - Intronic
1071847940 10:89538922-89538944 TTGGGTGATCAGTTGTCAATGGG - Intronic
1075578010 10:123594707-123594729 TGTGGACATATGTTCTCATTTGG - Intergenic
1076348977 10:129801781-129801803 CTGGGAGACATGTTCCCAGTGGG - Intergenic
1081984171 11:47289575-47289597 GTGGGAGAGAAGCTCTCAATGGG + Intronic
1085455287 11:76661990-76662012 TTGGGAGAAATGTTTCCAAAAGG + Intronic
1085803850 11:79616728-79616750 TTGGGTCATATGTTCTGAAAAGG + Intergenic
1090752512 11:129759939-129759961 TGGGTAGATTTGTTCTCAGTGGG - Intergenic
1092083995 12:5740836-5740858 ATGGGATATATGTTGTCAAATGG - Intronic
1092956052 12:13551227-13551249 TGGAGAGGTCTGTTCTCAATGGG - Exonic
1093371376 12:18369299-18369321 TGGGGAGATATGTTTACAGTAGG - Intronic
1098968703 12:76824824-76824846 TTTGGAGATAAGGTCTCACTCGG - Intronic
1104203537 12:126615057-126615079 TTGGGAGATATGTTCTCAATGGG - Intergenic
1104600542 12:130150542-130150564 ATGGGAGTTGTGTCCTCAATGGG - Intergenic
1105523014 13:21148462-21148484 TTGGGATATACATTTTCAATTGG - Exonic
1105632141 13:22180436-22180458 TTGGCAAATATGTTCTAAAGAGG - Intergenic
1106958375 13:34969438-34969460 TTGGGAGATATTTTTTACATAGG + Intronic
1116235396 14:42273030-42273052 TTGGGGGATAGGTACACAATAGG - Intergenic
1117006989 14:51430674-51430696 ATGAGAGATATGTTCTCACTGGG - Intergenic
1118529768 14:66690509-66690531 TTGGGTGATATTTTCTCTAAAGG + Intronic
1122428761 14:101626934-101626956 TTGGGAAAAAAGTCCTCAATAGG + Intergenic
1130963274 15:88679159-88679181 TTGGTAGAGATGTTTTCTATAGG - Intergenic
1132210549 15:100018870-100018892 ATGGGAGAAATGTTCTCACACGG + Intronic
1133635024 16:7657036-7657058 TTGGCAGATATGCCTTCAATTGG - Intronic
1135669635 16:24364100-24364122 TTGGGAGGTATTTTCTTCATGGG - Intergenic
1138824774 16:60305833-60305855 TTGCCAGATTTGTTCTCCATAGG + Intergenic
1139162801 16:64532231-64532253 TTTGGAGATCTGCTTTCAATAGG + Intergenic
1144313607 17:14037750-14037772 TTTGGAGATATTTTCTGCATAGG + Intergenic
1146819363 17:35972312-35972334 TTAGCAGATAAGTGCTCAATAGG - Intergenic
1154497244 18:14970989-14971011 TTGGGACATATTTCATCAATAGG - Intergenic
1155272537 18:24154587-24154609 TTTGGAGACATGTTTTCAATAGG - Intronic
1156434256 18:37109486-37109508 TTGTGGGATATTTTCTCAAATGG + Intronic
1159579277 18:70217129-70217151 TTTGGAGATATTTTCTATATAGG - Intergenic
1159753918 18:72339628-72339650 TTGGGATACATGTTCTTAAATGG + Intergenic
1159771053 18:72545183-72545205 TTGGCAGTTCTGTTCTAAATGGG - Intronic
1167652383 19:50739528-50739550 TTTGGTGATATTTTCTCAAAGGG + Intergenic
1168320946 19:55509046-55509068 TTGGGAGATATGTACCCAGAGGG + Intronic
926380294 2:12280147-12280169 TGGGCAGATATTTTCTCCATTGG + Intergenic
928546082 2:32330556-32330578 TTGGAAGATAAGTTCACAAGGGG - Intergenic
933362325 2:81304178-81304200 TGCTGAGTTATGTTCTCAATTGG + Intergenic
933628969 2:84634957-84634979 TTTGGAGATCTGGTCACAATGGG + Intronic
933635806 2:84708036-84708058 CTGGATGAGATGTTCTCAATTGG + Intronic
933843164 2:86304020-86304042 TTGGTAGATATGTAGTAAATAGG + Intronic
935417319 2:102832706-102832728 TTGGAAAATATATTCTAAATAGG + Intronic
935783117 2:106525161-106525183 GTGGGAGATATGCAATCAATGGG + Intergenic
936485446 2:112921558-112921580 TTGGAAGAGATGTTAGCAATTGG - Intergenic
936485636 2:112923158-112923180 TTGGAAGAGATGTTAGCAATTGG + Intergenic
939507117 2:143059080-143059102 ATGGGAGACATTTTCTCTATGGG + Intergenic
939718550 2:145616649-145616671 TTGGGGGATATTTTTACAATAGG + Intergenic
941320984 2:164054300-164054322 TTGGAAGATATGTTTTGGATTGG + Intergenic
942430662 2:175907622-175907644 TGGGGAGAGAAGTTCTCAATAGG + Intergenic
944083162 2:195812902-195812924 TTGGGAGCTAGCTTCTTAATTGG + Intronic
944572746 2:201060973-201060995 TTGGTAGTTATGTTCTAAAAAGG + Intronic
947131108 2:226925793-226925815 TTGGGAAATATGTAATTAATTGG + Intronic
1172195342 20:33087878-33087900 TTGGGAGAAATGTTCTAATTAGG + Intronic
1176692433 21:9932028-9932050 GGGGGAGATATTTTTTCAATGGG + Intergenic
1177346175 21:19874454-19874476 TGTGGATATATGTTTTCAATTGG - Intergenic
1177639128 21:23823978-23824000 CTAGGAGCTATGTTTTCAATTGG - Intergenic
1179254333 21:39702032-39702054 TAGGAAGAGATGTTCTCAATTGG + Intergenic
1182750202 22:32635483-32635505 TTTGCAGATATGTTCTGATTTGG - Intronic
950601730 3:14041097-14041119 TTGGGAGTTATGTTCACAGTGGG - Intronic
952193878 3:31052164-31052186 TTGGGTGCTATGTTCACTATTGG + Intergenic
954089995 3:48276653-48276675 TTGGGAGATATGTTCTCAATGGG + Intronic
955194800 3:56795276-56795298 TTGGGCTACATGTTCTCAACAGG + Intronic
955406730 3:58630487-58630509 TTGGGACACATTTTCTCACTGGG - Intergenic
958048746 3:88318649-88318671 TTGGGCCATATGGTCTCACTGGG + Intergenic
958094869 3:88931068-88931090 TTGGAAAAGATGTTCACAATTGG - Intergenic
960405147 3:117250933-117250955 ATGGGATGTTTGTTCTCAATAGG - Intergenic
960659611 3:120043570-120043592 TTGAGAGATATGTTCCCAATGGG + Intronic
963705513 3:148682630-148682652 TTGGAAGATATCTTCTGAATAGG - Intergenic
966595534 3:181721984-181722006 TATGGAGATATATTCTCAATTGG + Intergenic
967400517 3:189055665-189055687 TTGGGAGGGCTGTTCTCAAATGG - Intronic
969852285 4:9969231-9969253 TTGGTATATATGTTCTAAAATGG + Intronic
971318100 4:25584065-25584087 TTGGGAGTTATCTTCTCAACTGG + Intergenic
971628892 4:28962699-28962721 TTGGGTGCTATGTTCTCTACTGG + Intergenic
977423606 4:96836245-96836267 TTGTAAGATATGATCTCATTAGG - Intergenic
980365024 4:131792266-131792288 GGGGGAGATATTTTTTCAATGGG + Intergenic
980708707 4:136535246-136535268 TTGGGAGGATTTTTCTCAATAGG + Intergenic
981076587 4:140598493-140598515 TTAAGAAATATGTTCTCAAAAGG - Intergenic
981737502 4:147968205-147968227 TTCGGAGTGCTGTTCTCAATAGG + Intronic
982077432 4:151751566-151751588 TTGGAAGTCATGTTCTAAATTGG - Intronic
982126706 4:152189983-152190005 CTGGGAGATCTGTTCTCAACTGG - Intergenic
982155306 4:152514448-152514470 TGGGGAGGTATGTTCTCTAGGGG + Intronic
984037154 4:174683805-174683827 TTTGTAGATATTTTCTAAATGGG - Intronic
984921136 4:184765444-184765466 TTGGAAGATATGTTATTATTAGG - Intronic
986556466 5:9014895-9014917 TCGGGAGATATTTGCTCAGTGGG - Intergenic
993085764 5:83361881-83361903 TATGGATATATGTTGTCAATAGG - Intergenic
997883791 5:137613211-137613233 TTGTGAGATAGGTGCTCCATAGG - Intergenic
999726501 5:154442620-154442642 TTGGGGGATAACTTCTCAACTGG + Intergenic
1000987560 5:167877108-167877130 TTGGGAGTTATCTTCTGAACTGG + Intronic
1001515349 5:172351509-172351531 TTGGGAGAGATGTGCCCAACTGG - Intronic
1004350299 6:14885001-14885023 TTGGAAAATATGTTCTTAGTAGG - Intergenic
1005526383 6:26655129-26655151 TCTGAAGATATGTTCACAATAGG + Intronic
1006731429 6:36239134-36239156 TTGGGAGATAGGGTCACACTGGG + Intergenic
1008064863 6:47036584-47036606 TTGGGTGATCTGTTTTAAATAGG + Intronic
1009866012 6:69398721-69398743 TTGGGAGACATGATCATAATTGG - Intergenic
1011211972 6:84965020-84965042 TTGAGAGATATGTTCTCAATGGG - Intergenic
1012152232 6:95769042-95769064 TTTGGATATATGTTGTTAATAGG - Intergenic
1014197505 6:118576678-118576700 TTGGGGGTTATGGTCTCAGTGGG + Intronic
1014398853 6:120962229-120962251 CTGGAAGATATATTTTCAATGGG + Intergenic
1014681365 6:124434248-124434270 TTGGGACATTTGTTTTCAGTGGG + Intronic
1017965015 6:159256603-159256625 TTGGGCTTTAGGTTCTCAATGGG - Exonic
1018711987 6:166503953-166503975 TTGGGAGAGCTGTTCTGACTGGG + Intronic
1021737905 7:23657174-23657196 TTGGGAGATATGTTCTCAATGGG + Intergenic
1029647227 7:101865357-101865379 TCAGGAAATATGTTCTCAAAAGG - Intronic
1030511190 7:110484192-110484214 TTGGGAGATGTGTTCTGACGGGG + Intergenic
1030514430 7:110522328-110522350 TTGTGTGATATTTTCTCAAGTGG - Intergenic
1031048928 7:116925400-116925422 TTGAGAGATAGGGTCTCACTTGG - Intergenic
1031622484 7:123951572-123951594 TGGGTAGAGACGTTCTCAATAGG + Intronic
1032846642 7:135757045-135757067 TAGGGAGATCTGTTGTGAATGGG + Intergenic
1032951342 7:136917760-136917782 AAGAGAGAAATGTTCTCAATGGG - Intronic
1034464099 7:151215613-151215635 TTGGGCGATACGGTCTCACTGGG - Exonic
1034763438 7:153695419-153695441 TTGGAACATATGCTCTCATTAGG + Intergenic
1036114052 8:5939161-5939183 TTGGAAGATATGCTTTCAATTGG - Intergenic
1043163443 8:76873826-76873848 TTGGGATATATGTTCTCCTTGGG + Intergenic
1043493790 8:80778089-80778111 TTTGCAAATATTTTCTCAATGGG - Intronic
1043565446 8:81542387-81542409 TTGGGAAATATGGTCTGAATGGG + Intergenic
1045140854 8:99280675-99280697 TTGGTAGATATTTTCTCTAGTGG - Intronic
1046764853 8:118058080-118058102 TTGGGAGATACATTGTCATTTGG - Intronic
1047830045 8:128619215-128619237 CTGGGAGCTCTGTTCTCAAGGGG - Intergenic
1048711842 8:137221228-137221250 TTGGTAGTGATGTTGTCAATTGG - Intergenic
1052614679 9:30822307-30822329 TTGGGAGATATTTTCCCAAGTGG + Intergenic
1052978650 9:34430823-34430845 TTTGGAGACATGGTCTCACTCGG - Intronic
1053629379 9:39918111-39918133 GGGGGAGATATTTTTTCAATGGG + Intergenic
1054214508 9:62332591-62332613 GGGGGAGATATTTTTTCAATGGG - Intergenic
1054672973 9:67822762-67822784 GGGGGAGATATTTTTTCAATGGG + Intergenic
1055840986 9:80503275-80503297 TTTAGAGATATGTGCTAAATAGG + Intergenic
1056695600 9:88847947-88847969 TTGGGAAATATGGCGTCAATAGG + Intergenic
1059774849 9:117464726-117464748 TTTGGAAAGATGTTCCCAATAGG + Intergenic
1060460225 9:123845651-123845673 TTTGGAGACAGGTTCTCACTTGG - Intronic
1061656826 9:132098312-132098334 TTAGTAGAGATGTTCTCAAAGGG - Intergenic
1187610206 X:20934702-20934724 TTGGCAGATTTGTTCTCCAGGGG - Intergenic
1187852545 X:23605461-23605483 TTGTAAGAGATGTTCTCAATGGG - Intergenic
1188004596 X:25008373-25008395 TTTGGAGATGTGTTTTAAATCGG + Intronic
1190422061 X:50295057-50295079 TTGCTAAATATGTTCTCAATGGG - Intronic
1190957231 X:55207813-55207835 TTGGGAGATTTCTCCTCAACTGG - Intronic
1192037635 X:67582425-67582447 TTAGGTGATATTTTCTCCATGGG + Intronic
1192092438 X:68174311-68174333 TTAGCAAATATGTTTTCAATAGG + Intronic
1193586628 X:83329823-83329845 TTGGGAGATATTGGCACAATAGG - Intergenic
1194037905 X:88901200-88901222 TTTTGAGATATGTTCTTTATCGG - Intergenic
1194728216 X:97424291-97424313 TTGGCATATATGTTCTCAGAAGG + Intronic
1197022414 X:121707282-121707304 TTGAGCTATATGTTCTCAAAAGG - Intergenic
1197959070 X:131984095-131984117 TTGGCAAATACGTTCTCATTAGG - Intergenic
1198267004 X:135019036-135019058 CTGGGAGATTTGCTCTTAATTGG + Intergenic
1202104010 Y:21342737-21342759 TTGAGAAATATGTTCTGAACAGG - Intergenic