ID: 954091483

View in Genome Browser
Species Human (GRCh38)
Location 3:48287804-48287826
Sequence ACATAAGCACAGATGGAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 265}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954091479_954091483 10 Left 954091479 3:48287771-48287793 CCATTGTTCATCCTAACAAGAAG 0: 1
1: 0
2: 0
3: 18
4: 161
Right 954091483 3:48287804-48287826 ACATAAGCACAGATGGAGATAGG 0: 1
1: 0
2: 2
3: 22
4: 265
954091478_954091483 11 Left 954091478 3:48287770-48287792 CCCATTGTTCATCCTAACAAGAA 0: 1
1: 0
2: 1
3: 15
4: 158
Right 954091483 3:48287804-48287826 ACATAAGCACAGATGGAGATAGG 0: 1
1: 0
2: 2
3: 22
4: 265
954091481_954091483 -1 Left 954091481 3:48287782-48287804 CCTAACAAGAAGGAAGCAGAGTA 0: 1
1: 0
2: 0
3: 43
4: 393
Right 954091483 3:48287804-48287826 ACATAAGCACAGATGGAGATAGG 0: 1
1: 0
2: 2
3: 22
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954091483 Original CRISPR ACATAAGCACAGATGGAGAT AGG Intronic
900389039 1:2426171-2426193 ACATCTGCACAGATGGTGAAAGG - Intronic
900464531 1:2818612-2818634 ACATATGCACACATGCAGAGAGG - Intergenic
901156903 1:7146272-7146294 ACATAAGCCAAGAGGGAGACTGG - Intronic
901604703 1:10450082-10450104 ACACAAAAACAGCTGGAGATTGG + Exonic
902170307 1:14604798-14604820 ACAGGAGCTCAGATGGAGCTTGG + Intronic
904638674 1:31904595-31904617 ACAGTAGCACAGATGCAGGTGGG + Intergenic
905598793 1:39232637-39232659 ACATAAGTAGAAATGGATATGGG + Intronic
905660289 1:39717309-39717331 AAAAAAGCACAGATGGAATTGGG - Intronic
906518460 1:46453325-46453347 ACAGAAGCAGAGAGGGAGAGAGG + Intergenic
906601859 1:47137415-47137437 ACTTAAGCACAGGTGGACAGGGG + Intronic
906887257 1:49662756-49662778 TCATAAGCATTGATGGAAATAGG + Intronic
907023541 1:51093032-51093054 ACTTAAGCACAAAGGAAGATGGG + Intergenic
907257626 1:53191724-53191746 ACATGAGGACAGATGGGGACGGG + Intergenic
909113930 1:71510590-71510612 ACTTAAGCAGAGAAGGGGATGGG + Intronic
912017877 1:105064683-105064705 ACATGGGAACAGATGAAGATAGG + Intergenic
912027270 1:105192825-105192847 ACAAAAACACAGATGGTGCTTGG + Intergenic
916299656 1:163259581-163259603 ACATCAGTACAGCTGGAGACAGG + Intronic
917887683 1:179402449-179402471 ATATAAGCACAGATGCAGGTGGG - Intronic
918742015 1:188143663-188143685 ACAAAAACAGAGATGCAGATAGG - Intergenic
919304339 1:195810845-195810867 AGAAAAGCACAGATGGAAATAGG + Intergenic
920397973 1:205660289-205660311 ACATTAGCACAGCTGGGGCTGGG - Intronic
921278476 1:213542480-213542502 ACACAACCAAAGCTGGAGATAGG - Intergenic
923355172 1:233147780-233147802 ACAATAACACATATGGAGATGGG + Intronic
924082786 1:240416605-240416627 ACATAAGTACAGATGGAATGAGG - Intronic
924850328 1:247822608-247822630 ACATAATCACAGAGGCAGAGAGG - Intergenic
924875901 1:248104153-248104175 ACATAATCACAGAGGGAAACAGG + Intergenic
1063398274 10:5714577-5714599 ACATAAGAAGAGAAGCAGATTGG + Intronic
1065176958 10:23086958-23086980 ACAAAAACACACATGGAAATGGG + Intergenic
1065772072 10:29087011-29087033 ACATGGGCACAGAAGGAGAAAGG - Intergenic
1067243575 10:44517338-44517360 ACTTAAGAACAGATGGGGACGGG - Intergenic
1067910847 10:50345149-50345171 ACCTAAGCACATATGGAAAAGGG - Intronic
1068417351 10:56741161-56741183 GCATAACCACATATGGAGAAGGG - Intergenic
1069328068 10:67255473-67255495 ACATAAGCACAGACGCTAATTGG + Intronic
1070409516 10:76126577-76126599 ACAGAAGCCCAGATGTAGAGAGG - Intronic
1070636336 10:78131154-78131176 ACAGAAGCACAGATGTGGCTTGG - Intergenic
1074670509 10:115785125-115785147 ACATATCCACCGATGGAGAGGGG - Intronic
1075269520 10:121036375-121036397 AGAGAAGCTCTGATGGAGATTGG - Intergenic
1076069960 10:127481514-127481536 TCAGAAGCACACATGGAGTTTGG + Intergenic
1077213014 11:1382218-1382240 ACAGGAGCTCAGATGGAGACAGG + Intergenic
1078401904 11:11036052-11036074 AGAGAAGCATAGCTGGAGATAGG + Intergenic
1078713324 11:13816095-13816117 ACACAGGCATAGATGCAGATGGG + Intergenic
1078954659 11:16177964-16177986 AGATAAGCACAGATAGAGAAGGG + Intronic
1080101037 11:28459686-28459708 ACATGAGCATAGATAGAAATTGG - Intergenic
1080141842 11:28931077-28931099 ACTCAAACACAGAGGGAGATGGG - Intergenic
1081396243 11:42589658-42589680 ACAGAAGCACATATGGACTTTGG + Intergenic
1081428095 11:42947308-42947330 AGCTAAGCAGAGATGGAGCTGGG - Intergenic
1085993639 11:81883370-81883392 ACATAATGAGAGATGGATATAGG + Intergenic
1086952284 11:92903576-92903598 ATAAACACACAGATGGAGATGGG + Intergenic
1087757991 11:102074433-102074455 ACACAAGCACAGAAGGAGCTGGG - Intronic
1088576749 11:111279581-111279603 ACAAAGACACAGATGCAGATGGG - Intronic
1091147908 11:133296576-133296598 ACAAAAGCACAGAGGGACAATGG - Intronic
1091672243 12:2460571-2460593 ACTTAAGTGCAGATGGAGACAGG - Intronic
1091721901 12:2820074-2820096 TCATGCCCACAGATGGAGATGGG + Exonic
1093241556 12:16682957-16682979 AGATAAACACAGATGCAGGTAGG - Intergenic
1093324117 12:17752395-17752417 ACAGAAGCACAGAAGGATAATGG - Intergenic
1094074509 12:26458138-26458160 ACTTAACCAGAGATGGAGACAGG + Intronic
1094426262 12:30320328-30320350 AGATAAACACAGATGAAAATAGG + Intergenic
1096169852 12:49459130-49459152 ATTTAAGCAGAGAAGGAGATGGG + Intronic
1100277097 12:93081315-93081337 ACATAAGCAGCGAAGGAGAGGGG + Intergenic
1100372082 12:93977756-93977778 ACATTTAGACAGATGGAGATGGG + Intergenic
1100457196 12:94763946-94763968 AGATAAGCACAAAGGGAGTTGGG - Intergenic
1100552776 12:95662082-95662104 ACATACACACAGAGGAAGATTGG + Intronic
1100669560 12:96795745-96795767 ACACAAGCACAGAAGTAGAGGGG - Intronic
1101907855 12:108841002-108841024 ATATAAACACAGATCTAGATTGG + Intronic
1103143664 12:118574985-118575007 ACATAAAGTCTGATGGAGATCGG + Intergenic
1103924757 12:124417406-124417428 ACATTTGCACAGAGGGAGGTGGG - Intronic
1104312220 12:127663694-127663716 ACCAAAGGACAGGTGGAGATGGG - Intergenic
1105849089 13:24318664-24318686 ACACAAGCGCAGGTGGAGAGAGG - Intronic
1106036327 13:26048536-26048558 ACATAAGCACAGGGGTGGATTGG + Intronic
1107598470 13:41988305-41988327 CCATAACCACAGAAGGAGAATGG + Intergenic
1108671298 13:52691853-52691875 AAAAATGCACAGATGGAGAAAGG - Intronic
1109077989 13:57862825-57862847 ACATAGCTACAGATGGTGATAGG + Intergenic
1109663236 13:65493322-65493344 GCAGAAACACAGATGGAGTTGGG + Intergenic
1110899820 13:80808213-80808235 AAATAAGTGCACATGGAGATAGG - Intergenic
1112176179 13:97027406-97027428 ACAGAACCAAAAATGGAGATGGG + Intergenic
1113053910 13:106246395-106246417 CCATAAGCACAGAGGGACAGAGG + Intergenic
1114376672 14:22153746-22153768 AAATAAGCACATATGGAGAATGG - Intergenic
1115899332 14:38127495-38127517 GCAGAAACAGAGATGGAGATTGG - Intergenic
1117574113 14:57081085-57081107 ACATAAGCAGAGAGTGAGGTGGG + Intergenic
1118376011 14:65177776-65177798 ACATAAGCAAATATGATGATTGG + Intergenic
1118501480 14:66366234-66366256 TCATGAGCCCAGAGGGAGATAGG - Intergenic
1118670767 14:68124136-68124158 TAATAAGCACATATGAAGATTGG + Intronic
1120496128 14:85238401-85238423 ACCTAAACACAGATTGATATGGG - Intergenic
1120690504 14:87587664-87587686 ACATAAGCACAGATTAAGTATGG + Intergenic
1120734726 14:88040281-88040303 ACATAGGAACAGATGCAGGTAGG - Intergenic
1122185912 14:99995869-99995891 ACAGTACCACAGATGGAAATCGG - Intronic
1125150720 15:36529108-36529130 ACATATGCACGAATGGAGTTAGG + Intergenic
1126185408 15:45826467-45826489 ACATAATCAAAGACAGAGATTGG + Intergenic
1126511666 15:49482747-49482769 TCATAACCACAGATTGAGACAGG - Intronic
1128221440 15:65971512-65971534 ACACAGGCACAGATGAAGGTGGG + Intronic
1131424228 15:92332329-92332351 ACAGAAGCACAGAATGACATAGG - Intergenic
1131987649 15:98061221-98061243 ACTTGAGCAAAGAAGGAGATTGG - Intergenic
1132170030 15:99641271-99641293 ACAAAAGCTCTGCTGGAGATAGG - Intronic
1133440733 16:5818979-5819001 GGAGAAGGACAGATGGAGATGGG - Intergenic
1135245718 16:20855314-20855336 AATTAAGCACAGACGGAGCTGGG + Exonic
1139823790 16:69741078-69741100 AAAAAAGCACAGATGGGGCTGGG + Intergenic
1140901776 16:79374404-79374426 ACAAAAGCAGAGATGAAGCTTGG - Intergenic
1142680140 17:1542675-1542697 ACAGATGCACAGATGGGGAAGGG + Intronic
1144098054 17:11919539-11919561 ACATAATGACAGAGGGAAATGGG + Intronic
1144198383 17:12917250-12917272 ACATAATCACAGAGGGGGAGAGG + Intronic
1145769005 17:27479107-27479129 ACAGGAGCACAGAGGGAGAGAGG - Intronic
1146497463 17:33335993-33336015 ACAGAAGGACAGAGGGAGAAGGG - Intronic
1149161843 17:53703171-53703193 ACAGAAGCAAAAATGGAAATAGG + Intergenic
1149282363 17:55121807-55121829 GGATAAGGACAGATGGAGCTGGG + Intronic
1150196851 17:63307627-63307649 ACATAATCACAGAAGAATATTGG + Intronic
1150657007 17:67045817-67045839 ACAAAAGGACAGGTGGAGGTCGG - Intronic
1151045846 17:70918649-70918671 ATTTAAACACAGATAGAGATGGG + Intergenic
1156446405 18:37240282-37240304 AGAAAAACACAGAGGGAGATGGG + Intergenic
1156603526 18:38638967-38638989 ACAAAAGCAAAGAAGGATATAGG + Intergenic
1156648533 18:39197154-39197176 CTATAAGCACAGATGAAGCTTGG + Intergenic
1156792304 18:40990363-40990385 ACAAAAGGAGAGATGGAGAGAGG + Intergenic
1157190067 18:45574199-45574221 ACACAAGCACACATGCATATAGG - Intronic
1157506989 18:48233743-48233765 AAAAAAGCACAGATGAATATGGG - Intronic
1159699291 18:71604759-71604781 ACATAAGCATAAATAGAGACAGG + Intergenic
1159733441 18:72062080-72062102 ACTTTAGAGCAGATGGAGATAGG - Intergenic
1160875140 19:1293396-1293418 ATACAGGCTCAGATGGAGATGGG - Intronic
1162015451 19:7844444-7844466 TCAGAACCACAGATGGAGTTGGG - Intronic
1162822305 19:13230322-13230344 ACAGAGGCCCAGATGGAGAGAGG + Intronic
1165690178 19:37856773-37856795 ATATGAGCAGAGATGCAGATAGG - Intergenic
1166822318 19:45588001-45588023 ACACAAGCAGAGATGGGGAGGGG + Intronic
1167233803 19:48301863-48301885 ATATACGGACAGATGGATATAGG + Intronic
1168544381 19:57238640-57238662 AAATGAGCATAGATGGAGAAAGG - Intergenic
926666665 2:15531899-15531921 AAATAATCAGAGATGGAGAATGG - Intronic
927219609 2:20694993-20695015 ACAGAAACACAGAAGGAGACTGG - Intronic
927577110 2:24209007-24209029 GCTTAAGCACGGCTGGAGATGGG + Intronic
928307751 2:30184617-30184639 CCAACAGCACAGATGGAGAGAGG - Intergenic
928575653 2:32652046-32652068 ACATAAGCATACAAGGATATTGG - Intronic
928635264 2:33239318-33239340 ACAAAAGCTCAGATGGGGATAGG + Intronic
929834916 2:45386655-45386677 ATATGAGCACAGATGTAGGTAGG - Intergenic
931052678 2:58431416-58431438 ACACAAGAACAGATTGAGTTTGG - Intergenic
931311646 2:61086951-61086973 ACACAAGGAAAGATGGAGACAGG + Intronic
932515587 2:72344927-72344949 ACAGAGGTTCAGATGGAGATGGG - Intronic
932537399 2:72614026-72614048 ACAAAAGCACAGTTGGATAGTGG + Intronic
932654419 2:73596768-73596790 ATATAAGGACAGATCTAGATTGG - Intronic
932811838 2:74832848-74832870 ACATTAGCACTGGTGGAGAATGG - Intergenic
933635124 2:84700338-84700360 ATATGAGCACAGATGCAGGTAGG + Intronic
935391415 2:102557176-102557198 ACACATGCACAGAAGGAGTTTGG - Intergenic
937851399 2:126639446-126639468 GCAGAAGCACAGAGGGAGGTTGG - Intergenic
939172377 2:138710921-138710943 ACATTAGCACAGATGCTGAGTGG - Intronic
939547302 2:143569384-143569406 AGAGAAGAACAGATGGAGACGGG + Intronic
940383136 2:153039204-153039226 ACATAAGCACCTATGGATTTTGG + Intergenic
940391658 2:153139576-153139598 AGATATGAACAGATGGAGATGGG + Intergenic
941216753 2:162719972-162719994 ACAGAAACTCAGATTGAGATTGG - Intronic
944230414 2:197386553-197386575 ACATTAGAAGGGATGGAGATTGG - Intergenic
945459769 2:210092496-210092518 ACATAAGCACATTTGGAAAAAGG - Intronic
945541570 2:211093707-211093729 AACTAAGAAAAGATGGAGATAGG + Intergenic
945611882 2:212013634-212013656 ACAGAAGAAGAGATAGAGATTGG + Intronic
945655977 2:212624882-212624904 AGATGAGCACAACTGGAGATGGG + Intergenic
946303717 2:218843441-218843463 ACATTAGAAAAGAGGGAGATGGG + Intergenic
947162244 2:227226323-227226345 ACAGAAGCACAGTGGGAGAAGGG + Intronic
947766884 2:232643644-232643666 AAAAAAACACAGATGGACATTGG - Intronic
948337407 2:237221346-237221368 ATATAAGTACAGGTGAAGATAGG - Intergenic
1168835309 20:873695-873717 AGAGAAGTACAGAGGGAGATGGG - Intronic
1173338948 20:42136923-42136945 ACCTAAGCAGAGAGGGAGCTGGG + Intronic
1174081201 20:47971893-47971915 ACAGAGGCACTGATGGAGAGAGG - Intergenic
1174561045 20:51431079-51431101 AAATAAGCACATATAGAGAATGG - Intronic
1175830388 20:61962137-61962159 ACATGAGCCCAGCTGGAGAAAGG - Intronic
1177924738 21:27199975-27199997 CCATAAGAACACATGGACATAGG + Intergenic
1179077587 21:38137526-38137548 ATATAATCTCAGATTGAGATAGG - Intronic
1179433041 21:41338151-41338173 AAATAAGCAAAGAAGGAGAGGGG - Intronic
1179722687 21:43324559-43324581 ACAGAGGCACAGATGGGGAGAGG - Intergenic
1181402820 22:22661616-22661638 ACAGCAGCACAGATGGGGAAGGG - Intergenic
1182751707 22:32646821-32646843 ACAGAACCACAGAGGGAGAGGGG - Intronic
1182852645 22:33489209-33489231 ACATAATGACAAATGGTGATAGG + Intronic
1183263363 22:36810642-36810664 ACATAAGTGCAGATGTAGAAAGG - Intronic
1183455819 22:37922513-37922535 ACAATGGCACAGATGGAGAGGGG - Intronic
1184180430 22:42819948-42819970 ACAAAAACAAAGATGCAGATCGG - Intronic
950686161 3:14619983-14620005 ACATCAGCACAGACTGAGATGGG + Intergenic
950762707 3:15247537-15247559 ACCTAAGCATATATGGACATTGG + Intronic
951188672 3:19743857-19743879 ACATAAGCACTAATGTTGATGGG - Intergenic
951201649 3:19881850-19881872 CCATAAGCACAGATGTAGACAGG + Intronic
951864955 3:27298005-27298027 ACATAAGCAAAACTGGAGCTTGG + Intronic
954091483 3:48287804-48287826 ACATAAGCACAGATGGAGATAGG + Intronic
954581932 3:51707603-51707625 AGACCAGCACAGATGGAGACAGG - Intronic
959625238 3:108442321-108442343 AAAGAAGCACAGATGGAGAGAGG + Intronic
959674725 3:109021372-109021394 ACATCAGCAGAGATGGAGAGAGG - Intronic
960025163 3:113000449-113000471 ACGGACGCACAGATGGATATAGG + Intronic
960079686 3:113528084-113528106 ACATATGCACAAATTGATATAGG + Intergenic
960229410 3:115207842-115207864 ACCTTAGTACAGATAGAGATGGG + Intergenic
960837851 3:121926005-121926027 TCATAAGCAAAGATGGAGGTGGG + Intronic
961280422 3:125762307-125762329 ACAGAAAGACAGAGGGAGATGGG - Intergenic
962336345 3:134534930-134534952 ACATGGGCACAGATGCAGATAGG - Intronic
966811624 3:183851094-183851116 CCATAAGCACAGAATGAGTTTGG + Intronic
967477297 3:189936769-189936791 ACATACACACAGATGGCTATTGG + Intergenic
969904435 4:10381045-10381067 CCAGAAGCACAGATGGACAAGGG - Intergenic
971012739 4:22456682-22456704 ACATGATCACAGAGGGAGAGAGG - Intronic
972641354 4:40928030-40928052 ACATGAGCACAGCGGGTGATGGG + Intronic
973929972 4:55782202-55782224 ACAGATGGACAGATGGAAATTGG + Intergenic
975976873 4:80108422-80108444 ATATAAGCACAGATAAAAATGGG + Intronic
976416665 4:84784233-84784255 ACCAAAGCATAGATGTAGATAGG - Intronic
976764360 4:88583666-88583688 ACAGAATCACAGGTGGAGAGGGG + Intronic
977687589 4:99866281-99866303 ACATGAGAAGAGATGGAGACAGG + Intronic
978507245 4:109472050-109472072 ACATAAGCACATATGAGGAATGG - Intronic
978729598 4:112010069-112010091 ACAGAATCACAGGTGGAGATGGG - Intergenic
981119525 4:141033728-141033750 CCAAAAGCTCTGATGGAGATGGG - Intronic
981268083 4:142811172-142811194 ATATATGCACAGGTGGAGGTAGG - Intronic
981520552 4:145657406-145657428 ATATAATCACAGATGGGGAGAGG - Exonic
982525484 4:156472536-156472558 ACATAAGCACAGACATAGATTGG + Intergenic
982850622 4:160310828-160310850 AAATAAACACAGCTGGAGAAAGG - Intergenic
986029350 5:3880874-3880896 ACAGAGGCACAGCTGGAGCTCGG + Intergenic
986504677 5:8436924-8436946 AAATAAAGACAAATGGAGATTGG - Intergenic
986611773 5:9575581-9575603 ACATAAGCACTGTGGGAGAATGG - Intergenic
987436389 5:17899166-17899188 TCATTAGTACAGATGGAAATAGG - Intergenic
990517664 5:56545243-56545265 ACATAATCACAGCTGGTAATTGG + Intronic
997891126 5:137677874-137677896 ACATCAACACAGATGAAAATGGG + Intronic
998032762 5:138886131-138886153 ACATGAGCACAAATGGCTATAGG + Intronic
998591311 5:143481634-143481656 ACAGAAACACAGAATGAGATCGG + Intergenic
999191368 5:149749947-149749969 ACAGATGGACAGATGGAGCTAGG + Intronic
1002348424 5:178564232-178564254 ACAAAAGCACAAAAGGAGTTAGG - Intronic
1003641672 6:7880412-7880434 ACGGAAGCACAGTTGGAGGTGGG + Exonic
1004323532 6:14652394-14652416 ACAGAAGCACAGATGGGAGTGGG + Intergenic
1005126327 6:22450673-22450695 CCAAAACCACAGATAGAGATAGG - Intergenic
1005331751 6:24757485-24757507 ACAGGAGCAAAGATGGAGATTGG - Intergenic
1006007050 6:31010820-31010842 ACATAAGCCCTGAAGGAGATGGG + Intronic
1006929057 6:37676545-37676567 ACATAAGCATGGATGGAGGTAGG + Intronic
1007222412 6:40289399-40289421 ACATAAACACACATGTAAATAGG + Intergenic
1009507024 6:64497449-64497471 ACATGAGCCCAGAAGCAGATGGG + Intronic
1011507399 6:88061456-88061478 ACACAAACACAGATGGAAAGTGG + Intronic
1011922384 6:92595656-92595678 ACCAAAGCACAGATGAGGATGGG + Intergenic
1012009594 6:93766056-93766078 ACATCAGTAAAGATGGAAATTGG + Intergenic
1012398688 6:98827502-98827524 ACATGAGCCCAGACGGAGAAGGG + Intergenic
1012958841 6:105600743-105600765 AAAGAAGCACAGATAGGGATTGG - Intergenic
1013284431 6:108668694-108668716 GCAAAAGCCCAGATGGAGAGGGG + Intronic
1014083203 6:117312099-117312121 ACGGAAGCACAGATTGAGAGAGG - Intronic
1014479869 6:121922465-121922487 ACTCAAGCACAGAGGGAGCTAGG + Intergenic
1014665278 6:124230114-124230136 AGATGATCTCAGATGGAGATGGG + Intronic
1015968743 6:138722101-138722123 AAATACCCACAGATGGATATTGG - Intergenic
1019074080 6:169373020-169373042 ACAAAAGCACAGAGTGAGACGGG - Intergenic
1020369160 7:7414024-7414046 ACTTAAACAAGGATGGAGATGGG + Intronic
1022615478 7:31925915-31925937 ACATATGCATACATGGAAATCGG - Intronic
1023504168 7:40882913-40882935 ACGAAGGAACAGATGGAGATGGG - Intergenic
1025189026 7:56882655-56882677 CCAAAAGCACAGAGGAAGATGGG - Intergenic
1025682913 7:63694264-63694286 CCAAAAGCACAGAGGAAGATGGG + Intergenic
1027782793 7:82540746-82540768 ACTTATGTACAGATGTAGATAGG - Intergenic
1028660654 7:93268909-93268931 AGATAATCACAGGTGGATATGGG + Intronic
1029905856 7:104092970-104092992 ACATATACACAGATGGGGACAGG + Intergenic
1030157611 7:106471362-106471384 ATATGAGTACAGATGCAGATAGG - Intergenic
1030205593 7:106949664-106949686 ACATAAGCACATAAGATGATTGG - Intergenic
1030733898 7:113021267-113021289 AAATAAGCACATATGGAGAATGG + Intergenic
1030768716 7:113444928-113444950 ACATGAGATCAGATAGAGATAGG + Intergenic
1030811376 7:113976374-113976396 AAATAAGCACAGATGGAGAGTGG - Intronic
1033109735 7:138563415-138563437 ACACGGGCACAGACGGAGATGGG - Intronic
1033581645 7:142742496-142742518 ACTTAAGCACAGCTGGAAAAAGG + Intergenic
1035529792 8:342354-342376 ATAAAAGCACATACGGAGATGGG + Intergenic
1035797366 8:2370678-2370700 ACAAGACCACAGATGGAGAAGGG - Intergenic
1036009004 8:4699467-4699489 TCATTAGCACAGATGGATTTGGG - Intronic
1036080036 8:5545133-5545155 ACAGAGGCACAGATGGGGAGTGG - Intergenic
1036212884 8:6856736-6856758 AAATAAGCCCAGATGGATTTAGG + Intergenic
1038093350 8:24279486-24279508 ACATGATCCCAGATGGGGATAGG - Intergenic
1038391798 8:27208748-27208770 GCATAAGCACAGAAGGATCTAGG + Intergenic
1039935087 8:42036053-42036075 AAATAAGCACAGATGTATTTAGG + Intronic
1041566947 8:59289255-59289277 ACATAAGCAGAGATGAGGAAGGG + Intergenic
1042655976 8:71097015-71097037 ATATGAGGAGAGATGGAGATTGG - Intergenic
1043397538 8:79853597-79853619 ACATAAACACAGAGGGTTATGGG - Intergenic
1044746602 8:95376964-95376986 ACATAAGAAAAGATGGAAGTTGG - Intergenic
1044905994 8:97003681-97003703 AGATAAGCATAGATGCATATTGG + Intronic
1045853097 8:106727108-106727130 ACATCAGCACAGAGGGATTTAGG + Intronic
1046117497 8:109801541-109801563 ACATAGGGCCAGAGGGAGATGGG - Intergenic
1046130564 8:109962815-109962837 TAATAGGCACAGATGGAGGTAGG + Intergenic
1046262436 8:111786580-111786602 CCATAGTCACAGATGTAGATGGG - Intergenic
1047093034 8:121594513-121594535 ACATCTGCTCAGATGGGGATGGG + Intergenic
1048517470 8:135123952-135123974 ACATAAGCAAGGATGAAGAAAGG + Intergenic
1049403636 8:142442073-142442095 CCATGAGGACAGATGGAGACAGG + Intergenic
1050268926 9:3920693-3920715 ACATAAGCAAATATAGAAATCGG - Intronic
1052410750 9:28118028-28118050 AAATAAGAACACATGGACATAGG + Intronic
1052771337 9:32693738-32693760 AAATAAGCACACATGGAGAATGG - Intergenic
1052900356 9:33788463-33788485 ACTTAAGCACAGCTGGAAAAAGG + Intronic
1055837028 9:80455739-80455761 ACATAAGCAGAGATGGGGATAGG + Intergenic
1061225810 9:129280493-129280515 CCACAAACACAGATGGAAATCGG - Intergenic
1186246222 X:7619501-7619523 ACACAAACACAGATGGGGGTGGG + Intergenic
1187241711 X:17519956-17519978 CCATAAGCACAAATGGGGGTGGG - Intronic
1187258898 X:17667298-17667320 CCAGAAGCACAAATGGAGAGAGG + Intronic
1187311625 X:18149613-18149635 CCAGAAGCAGAGCTGGAGATAGG - Intergenic
1188263111 X:28040673-28040695 ACATTAGCCCAGAGGGTGATGGG + Intergenic
1189660726 X:43295382-43295404 ATAGAAGCACAGAAGGAGAATGG + Intergenic
1190259470 X:48789008-48789030 ACAAAAGCACAGAAAGAGGTCGG + Intronic
1190290643 X:48989889-48989911 ACAGAAGGACAGATGTAGATGGG + Intronic
1190411627 X:50141871-50141893 AAACAAGCCCTGATGGAGATGGG + Intergenic
1191108198 X:56785392-56785414 ATGGAAGCACAGATGAAGATGGG - Intergenic
1191110519 X:56800223-56800245 ATAGAAGCACAGATGAAGACAGG - Intergenic
1191914710 X:66188983-66189005 ACATAAGCACAGAGTACGATGGG - Intronic
1192129599 X:68536708-68536730 ACATAAGAACAGTTGGACATTGG + Exonic
1194250187 X:91564727-91564749 TCATAAGCACAGATGGCACTTGG - Intergenic
1194802502 X:98290330-98290352 AAATGAGCACAGGTGGAGTTTGG - Intergenic
1195466312 X:105183120-105183142 ACATGGGCACAGATTGTGATAGG + Intronic
1196553695 X:117061440-117061462 ACATGAGAACACATGGATATGGG - Intergenic
1198167713 X:134073591-134073613 AAATAAGCAAGGAAGGAGATGGG + Intergenic
1198200951 X:134418169-134418191 ACAGAAGCAGAGGTGGAAATGGG + Intronic
1198986206 X:142456881-142456903 ACACATGCACAGAGGTAGATAGG + Intergenic
1200569149 Y:4805976-4805998 TCATAAGCACAGATGGCACTTGG - Intergenic