ID: 954096876

View in Genome Browser
Species Human (GRCh38)
Location 3:48335522-48335544
Sequence GCTCCTAACCCCAAAGGGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954096868_954096876 20 Left 954096868 3:48335479-48335501 CCAGGAAATTGTGAAAGCGGAAG No data
Right 954096876 3:48335522-48335544 GCTCCTAACCCCAAAGGGTTGGG No data
954096871_954096876 -9 Left 954096871 3:48335508-48335530 CCAGGCAGACCAACGCTCCTAAC No data
Right 954096876 3:48335522-48335544 GCTCCTAACCCCAAAGGGTTGGG No data
954096866_954096876 22 Left 954096866 3:48335477-48335499 CCCCAGGAAATTGTGAAAGCGGA No data
Right 954096876 3:48335522-48335544 GCTCCTAACCCCAAAGGGTTGGG No data
954096864_954096876 23 Left 954096864 3:48335476-48335498 CCCCCAGGAAATTGTGAAAGCGG No data
Right 954096876 3:48335522-48335544 GCTCCTAACCCCAAAGGGTTGGG No data
954096867_954096876 21 Left 954096867 3:48335478-48335500 CCCAGGAAATTGTGAAAGCGGAA No data
Right 954096876 3:48335522-48335544 GCTCCTAACCCCAAAGGGTTGGG No data
954096863_954096876 24 Left 954096863 3:48335475-48335497 CCCCCCAGGAAATTGTGAAAGCG No data
Right 954096876 3:48335522-48335544 GCTCCTAACCCCAAAGGGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954096876 Original CRISPR GCTCCTAACCCCAAAGGGTT GGG Intergenic
No off target data available for this crispr