ID: 954097289

View in Genome Browser
Species Human (GRCh38)
Location 3:48338606-48338628
Sequence GACCTACACTCTGGGCATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954097289_954097293 -8 Left 954097289 3:48338606-48338628 CCTGGATGCCCAGAGTGTAGGTC No data
Right 954097293 3:48338621-48338643 TGTAGGTCCAAAGGAATGACTGG No data
954097289_954097294 -7 Left 954097289 3:48338606-48338628 CCTGGATGCCCAGAGTGTAGGTC No data
Right 954097294 3:48338622-48338644 GTAGGTCCAAAGGAATGACTGGG No data
954097289_954097296 16 Left 954097289 3:48338606-48338628 CCTGGATGCCCAGAGTGTAGGTC No data
Right 954097296 3:48338645-48338667 ATCCTAAGCCCAAACCCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954097289 Original CRISPR GACCTACACTCTGGGCATCC AGG (reversed) Intergenic
No off target data available for this crispr