ID: 954099347

View in Genome Browser
Species Human (GRCh38)
Location 3:48357585-48357607
Sequence CAGGATTACCAGCTGCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954099347_954099351 15 Left 954099347 3:48357585-48357607 CCTCTCTGCAGCTGGTAATCCTG No data
Right 954099351 3:48357623-48357645 TCTGAAATTCTCAGCAAAGAGGG No data
954099347_954099350 14 Left 954099347 3:48357585-48357607 CCTCTCTGCAGCTGGTAATCCTG No data
Right 954099350 3:48357622-48357644 CTCTGAAATTCTCAGCAAAGAGG No data
954099347_954099348 -10 Left 954099347 3:48357585-48357607 CCTCTCTGCAGCTGGTAATCCTG No data
Right 954099348 3:48357598-48357620 GGTAATCCTGATGTCTCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954099347 Original CRISPR CAGGATTACCAGCTGCAGAG AGG (reversed) Intergenic
No off target data available for this crispr