ID: 954101815

View in Genome Browser
Species Human (GRCh38)
Location 3:48379382-48379404
Sequence GGGATGCTTTGGTTTCAGGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 150}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954101812_954101815 -8 Left 954101812 3:48379367-48379389 CCTATTGATATGGTGGGGATGCT 0: 1
1: 0
2: 0
3: 8
4: 98
Right 954101815 3:48379382-48379404 GGGATGCTTTGGTTTCAGGTTGG 0: 1
1: 0
2: 1
3: 15
4: 150
954101807_954101815 21 Left 954101807 3:48379338-48379360 CCTCTGTACTTCAGGATTTCACA 0: 1
1: 0
2: 2
3: 30
4: 249
Right 954101815 3:48379382-48379404 GGGATGCTTTGGTTTCAGGTTGG 0: 1
1: 0
2: 1
3: 15
4: 150
954101806_954101815 24 Left 954101806 3:48379335-48379357 CCTCCTCTGTACTTCAGGATTTC 0: 1
1: 0
2: 0
3: 19
4: 195
Right 954101815 3:48379382-48379404 GGGATGCTTTGGTTTCAGGTTGG 0: 1
1: 0
2: 1
3: 15
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954101815 Original CRISPR GGGATGCTTTGGTTTCAGGT TGG Exonic
900806637 1:4771863-4771885 GGGAGCCTTTGGGTACAGGTTGG - Intronic
901071076 1:6518813-6518835 GGGTTGCTCTGGTGGCAGGTTGG - Intronic
901332605 1:8423162-8423184 GGGAAGCTTGGTTCTCAGGTGGG - Intronic
906454213 1:45979824-45979846 TGTTTGTTTTGGTTTCAGGTAGG - Intronic
914748878 1:150519149-150519171 GGGATGCTTTGGCTTGACTTAGG - Intergenic
915645920 1:157272265-157272287 GGGATGCTGTGTCTTCATGTGGG - Intergenic
918813965 1:189158496-189158518 GAGATCCTTGGGATTCAGGTAGG - Intergenic
919758130 1:201078694-201078716 AGGATGGATTGGCTTCAGGTAGG - Intronic
919990723 1:202707460-202707482 GGGATACTCTGGCTTCAGCTAGG + Intronic
1063580997 10:7306947-7306969 GGGATGCTTTGGCATGAGGATGG - Intronic
1063826607 10:9905556-9905578 GCAATACTTTGGTTTCAGTTAGG - Intergenic
1067448789 10:46368766-46368788 GGGAAGCTTTGGTCTCAGGGGGG + Intergenic
1067588583 10:47491999-47492021 GGGAAGCTTTGGTCTCAGGGGGG - Intergenic
1067635709 10:48000090-48000112 GGGAAGCTTTGGTCTCAGGGGGG - Intergenic
1067877807 10:50020298-50020320 GGGAAGCTTGGGTCTCAGGGGGG + Intergenic
1070132269 10:73664097-73664119 GGGAAGCTTTGGTCTCAGGGGGG - Intergenic
1073358489 10:102876647-102876669 GGGCTGCTTTTGGTTCAGATTGG + Intronic
1075288586 10:121208851-121208873 GGAATGCTTTCATTTCAGGCAGG + Intergenic
1076205022 10:128590695-128590717 GGGATGCTGTGACTTCAGGTGGG + Intergenic
1076801775 10:132834360-132834382 GGGCTGCTTTGATTTGGGGTGGG - Intronic
1078058827 11:8030754-8030776 GGGAGGCTTTGGAGTCAGGGAGG + Intronic
1078359498 11:10657444-10657466 GGGATACTGTGGTTTCAGAGAGG - Intronic
1078430783 11:11286833-11286855 GTGATGCTTTGTATTCAGGCTGG + Intronic
1080843256 11:36004288-36004310 TGAATGCTTTTGTTTCAAGTGGG + Intronic
1084281374 11:68097075-68097097 GGGTGGCTGTGGTGTCAGGTAGG + Exonic
1088567800 11:111191298-111191320 GGGATTCTTTGGCATCAGATGGG + Intergenic
1090823795 11:130369082-130369104 GGCATGCTTTGTTTTCCGGTTGG + Intergenic
1093342704 12:17998246-17998268 GGCATGCTTCAGCTTCAGGTTGG + Intergenic
1094617134 12:32046138-32046160 GGGTTGCATGGGGTTCAGGTTGG + Intergenic
1098659518 12:73075002-73075024 GGGAGTCTTAAGTTTCAGGTAGG + Intergenic
1104761973 12:131302184-131302206 GGGAGGCTCTGGTTTTAGGCAGG + Intergenic
1106594612 13:31125662-31125684 AGGATGCTTTGGTAGAAGGTAGG + Intergenic
1106768186 13:32936936-32936958 GGGATGCTTTGGTTGGCGGATGG + Intergenic
1107499784 13:40961903-40961925 GGAATACTTTGGTTTCATTTGGG - Intronic
1108897982 13:55359269-55359291 GGGATGCTATGGTTTCAATATGG + Intergenic
1112576751 13:100642959-100642981 GGGATGTTTTGGCTTCTTGTTGG - Intronic
1118761248 14:68881446-68881468 GGGATGAATGGGATTCAGGTGGG - Intronic
1119825185 14:77651766-77651788 AGAATGCTCTGGTTTCAGTTGGG - Intergenic
1120711338 14:87796381-87796403 TGGATGGATTGGTTACAGGTTGG + Intergenic
1126684975 15:51240624-51240646 GAGATCCTATGGTTTCTGGTTGG - Intronic
1132621110 16:868705-868727 CGGCTGGTTTGGTTTGAGGTGGG + Intronic
1136561293 16:31040569-31040591 GGGATGGTCTGGTTTCAGCAGGG + Intronic
1138726302 16:59143288-59143310 GGGGTGCTTTGGAAGCAGGTGGG - Intergenic
1141226146 16:82117841-82117863 GGGATGTTTTGATATCAGTTGGG + Intergenic
1141490174 16:84367571-84367593 GGCTTTCTTTGGCTTCAGGTAGG - Intergenic
1141800498 16:86304763-86304785 AGAATGCTTTGGTTTCTGTTAGG + Intergenic
1142560717 17:807430-807452 GGGCAGCTTTGCCTTCAGGTTGG - Intronic
1143994468 17:10994617-10994639 GGGGTGCTTTGGTAGCAGGCAGG + Intergenic
1144182659 17:12767291-12767313 TTGATGCTTTTTTTTCAGGTTGG - Exonic
1147495961 17:40915968-40915990 GGGATGCCCTGACTTCAGGTTGG + Intergenic
1147594005 17:41705101-41705123 GGGATCATTTGGAATCAGGTGGG + Intergenic
1148834424 17:50458305-50458327 TGGACCCTTTGGTTTCAGCTGGG + Intronic
1148875879 17:50686895-50686917 GGGATGCTGTGGCCTCTGGTTGG + Intronic
1148958484 17:51373460-51373482 GTGATGCTGTGGTTCAAGGTGGG - Intergenic
1149653256 17:58292293-58292315 GGGCTGCATTGAGTTCAGGTTGG - Intergenic
1150582984 17:66492192-66492214 GGGAAGCTTTCGTGTAAGGTAGG + Intronic
1150616628 17:66777430-66777452 GGAATGCTTTGATTTGGGGTGGG - Intronic
1153339827 18:3961900-3961922 GGGTTGCTCAGGTTTCAGGGAGG + Intronic
1156957604 18:42987410-42987432 GGGATGTCTTTGTTTCAGATAGG - Intronic
1161821288 19:6532664-6532686 GGGAAGCGTAGGCTTCAGGTCGG + Intronic
1167258566 19:48444656-48444678 GGGAAGTTTTGGCTTCAGGGAGG - Exonic
1167477379 19:49708949-49708971 GGGAAGCATGGGTTTCGGGTTGG - Intronic
1168468843 19:56625005-56625027 GGGATGCTGTGGTACCAGGTGGG + Exonic
926667021 2:15536754-15536776 GGGCTGCTGTGGTTTCAGCCTGG - Intronic
928724550 2:34156866-34156888 TAGATCTTTTGGTTTCAGGTTGG - Intergenic
929235251 2:39598217-39598239 GGGATGTGTTGGTTTGGGGTTGG + Intergenic
930867704 2:56138259-56138281 GGGTTTCTATGGTTTTAGGTTGG + Intergenic
935343608 2:102082420-102082442 GGAATGTTTTGGATTGAGGTGGG + Intronic
935568313 2:104632927-104632949 GCTATGCTTTGGTTTCAAGGGGG + Intergenic
936452115 2:112641561-112641583 GGGATGCTTGGGATCCAGGTGGG - Intergenic
940323548 2:152401669-152401691 GGGAGGCTGTTGATTCAGGTTGG + Intronic
940979712 2:159987644-159987666 GGGATATTTTGGTTCCAGATAGG - Intronic
942042208 2:172078462-172078484 GGGAGGATTTGGATTGAGGTAGG + Intronic
946009816 2:216555479-216555501 GGGCTGCTTTGGCTTCTTGTGGG - Intronic
948143092 2:235688760-235688782 GGGGTGCTTTGGTGACAGCTTGG + Intronic
948322201 2:237079547-237079569 GATATGCATTTGTTTCAGGTGGG + Intergenic
948619133 2:239222925-239222947 GGGCTGCAGTGGTTTCAGGGAGG - Intronic
948859380 2:240745531-240745553 GAGATGCTTTGGTGTGGGGTGGG + Intronic
948974903 2:241458082-241458104 GGGATGCTGTGGCCTCAGGGTGG + Intronic
1171395459 20:24830032-24830054 AGGATGGTGTGGTTTCAGGAAGG - Intergenic
1172202068 20:33133515-33133537 GGGAAGCTTAAGTTGCAGGTAGG - Intergenic
1172593663 20:36134741-36134763 AGGCTGCATTGGTCTCAGGTAGG + Intronic
1172935442 20:38616809-38616831 GGGATGCTTTGGCGTCTAGTGGG + Intronic
1174375054 20:50121032-50121054 GGGATGGCTTGGTTTCAGGTAGG - Intronic
1174978951 20:55369998-55370020 GGGATGCTCTGGTGCCTGGTGGG - Intergenic
1175280154 20:57798524-57798546 GGGATCCTTTGGTTAGAGATGGG + Intergenic
1178152195 21:29808152-29808174 GGGAAGTTTTGTTTTCAAGTCGG + Intronic
1178552082 21:33549756-33549778 GGGATTCATTGGTCTCAGATGGG - Exonic
1179247191 21:39644205-39644227 GATATGCATTTGTTTCAGGTAGG + Intronic
1180183361 21:46127707-46127729 TGGGTGCTTTGCTATCAGGTGGG + Intronic
1181993821 22:26859132-26859154 AGGATGCTGTGGTTTCAGGAAGG + Intergenic
1182057669 22:27372636-27372658 AGGACCCTGTGGTTTCAGGTGGG - Intergenic
1183298492 22:37046337-37046359 GGAAGGCTTTGGTTTGGGGTAGG - Intergenic
1184659572 22:45959735-45959757 GGGCTGCTTGGGTGCCAGGTTGG - Intronic
1184742706 22:46438331-46438353 TAGCTGCTTTTGTTTCAGGTGGG - Intronic
1185116956 22:48943261-48943283 GGGATGCTGTGGTGCCAGGCTGG - Intergenic
950954636 3:17038976-17038998 AGGTTGCTTATGTTTCAGGTAGG + Intronic
951637370 3:24794329-24794351 GGGTGGCATTGCTTTCAGGTAGG + Intergenic
952035233 3:29192711-29192733 GGTATGCTTTCTTTTAAGGTGGG + Intergenic
952223577 3:31350595-31350617 GTCATGCTTTGGTTTCAGTAAGG - Intergenic
954014716 3:47677455-47677477 GGGATGGAGTGGATTCAGGTTGG - Intronic
954101815 3:48379382-48379404 GGGATGCTTTGGTTTCAGGTTGG + Exonic
955148011 3:56339320-56339342 GGAATGCTTTGGTTTCATCAGGG + Intronic
957260172 3:77890515-77890537 GGGAAGCTTTGGTTTTAGGATGG + Intergenic
959895010 3:111595437-111595459 GGGAAGCATTGTTTCCAGGTAGG + Exonic
961718441 3:128875331-128875353 GGGGTGCCTTGTTTTCAGCTTGG - Intergenic
962866370 3:139451075-139451097 GGGATTCCATGGTTTCAGGCTGG + Intergenic
964711597 3:159677123-159677145 GGAAGGCTTGGGTTCCAGGTGGG - Intronic
967956436 3:194880970-194880992 GGGATTCTTTGGTCTGTGGTGGG - Intergenic
969455839 4:7299153-7299175 GGGATGCTTTGCAGTCAGGGCGG + Intronic
970073517 4:12190779-12190801 TGGATGCTTTGTGTTCAGGGAGG - Intergenic
970917080 4:21348582-21348604 AAGATGGTTTGGTTTAAGGTTGG - Intronic
971829574 4:31673394-31673416 TGGATCCCTTGGTTTCAGCTAGG + Intergenic
973097540 4:46221847-46221869 GGGATGATTTTGTGCCAGGTGGG - Intergenic
976561757 4:86510126-86510148 GGGGTGGTTTGTTTTGAGGTGGG + Intronic
977967228 4:103167635-103167657 GGGAGCCTTTGGATTCAGGTAGG + Intronic
978384174 4:108164869-108164891 GGGACCCTTGGATTTCAGGTGGG - Intronic
979577031 4:122304878-122304900 GTGAAGCTTTGGTTTGAAGTCGG - Exonic
981937853 4:150253985-150254007 GTGAGGCCTTGGTTTCAGGCAGG + Intronic
988316337 5:29634669-29634691 GGGAGCCTTTGGATTCATGTAGG + Intergenic
992673260 5:79080742-79080764 GTGATGCTTTGGTAGCAGGGGGG + Exonic
997446719 5:133945669-133945691 GGCATGCTATGTTTTCTGGTTGG + Intergenic
1000131946 5:158308785-158308807 AGGATGCTTTGGGTTCTGGTGGG + Intergenic
1003474155 6:6466046-6466068 GTAAAGCTTTGGTTTCGGGTAGG - Intergenic
1003671303 6:8162901-8162923 GGGAGCCCTTGGTTTGAGGTGGG + Intergenic
1004375347 6:15086324-15086346 GGGATGTTTTGGGTACATGTGGG - Intergenic
1007274088 6:40660831-40660853 GGGATGCTTGGGTGTAAGGGAGG - Intergenic
1007502219 6:42306964-42306986 GGGATGCCTGGGTTTCACCTGGG + Intronic
1011275873 6:85630961-85630983 CTGATGCTTTCTTTTCAGGTAGG - Intronic
1014309894 6:119786935-119786957 GGGATAATTAGGTTTCAGGAAGG + Intergenic
1014700839 6:124686074-124686096 TGGGGGCTTTGGTTTCTGGTTGG + Intronic
1015554801 6:134450229-134450251 GGGGTGCCTTGGTTCCAGGTGGG + Intergenic
1017144200 6:151219252-151219274 GGGAAGCTTTGCTTTTAGGCAGG - Intergenic
1026353546 7:69538188-69538210 TGGATGCCTGGGTTCCAGGTTGG - Intergenic
1026462539 7:70627737-70627759 GGGATGCTTTGTTCTCAGAATGG + Intronic
1031480826 7:122276836-122276858 GTAATGCTTTGGTTTGGGGTAGG + Intergenic
1032495025 7:132355005-132355027 GGGAGGTCTTGGTTTCAGGCAGG + Intronic
1034544488 7:151781121-151781143 TTGATGCTATTGTTTCAGGTGGG - Intronic
1037029483 8:14085762-14085784 GGAATGCTTTTGTTTCAGAAGGG - Intergenic
1037527655 8:19742524-19742546 GGGATGCATTGGCTGCAGCTGGG - Intronic
1053261018 9:36664404-36664426 GTGAAGCTTTTCTTTCAGGTAGG + Intronic
1055791257 9:79925442-79925464 GGGATGCTTGTGGTTCAGCTTGG - Intergenic
1056255205 9:84791895-84791917 GAGATGGTTTAGTTTCAGATGGG + Intronic
1058476368 9:105337833-105337855 GGTATGCTTTGTTTCCAGGCTGG + Intronic
1058718938 9:107746260-107746282 GATATGCACTGGTTTCAGGTGGG - Intergenic
1059859570 9:118444324-118444346 GGGTTGGTTTTTTTTCAGGTGGG - Intergenic
1060516406 9:124268686-124268708 GGGATGCCTTGTTCTCACGTCGG - Intronic
1188670647 X:32878019-32878041 GGAATGCTTATGTTTCAGGTTGG - Intronic
1191258258 X:58289137-58289159 AGGATGCTTGGCTTTCAGGAAGG + Intergenic
1192300420 X:69895540-69895562 GGTATTTTTTGGTTTCAGGATGG - Intronic
1192579142 X:72266565-72266587 GTGATGCTATCTTTTCAGGTAGG - Intronic
1196099704 X:111834874-111834896 TGCTTACTTTGGTTTCAGGTTGG - Intronic
1196229217 X:113202402-113202424 GGGCTGCTTTGGTTTCACCTAGG + Intergenic
1197038913 X:121910526-121910548 GGGATTCTTTAGTTTGAGATTGG + Intergenic
1198100486 X:133417603-133417625 GGGAAGCTTTCTTTTCAGATGGG + Intergenic
1199086092 X:143632952-143632974 GGGTTTCTTTGTTTTGAGGTGGG - Intronic
1199732377 X:150648641-150648663 GAGATGCTATGGTTTCATTTAGG - Intronic
1200244952 X:154517998-154518020 GGGATGGTTTGGATTCCTGTGGG + Intergenic
1200290108 X:154863687-154863709 GGGAGCCTTGGGATTCAGGTAGG + Intronic
1200713542 Y:6511527-6511549 GGAATACTTCAGTTTCAGGTTGG - Intergenic
1200832713 Y:7703207-7703229 GGAATACTTCAGTTTCAGGTTGG + Intergenic
1201020386 Y:9650514-9650536 GGAATACTTCAGTTTCAGGTTGG + Intergenic
1202114254 Y:21454965-21454987 GGAATACTTCAGTTTCAGGTTGG - Intergenic
1202162706 Y:21952226-21952248 GGAATACTTCAGTTTCAGGTTGG + Intergenic
1202228650 Y:22634142-22634164 GGAATACTTCAGTTTCAGGTTGG - Intergenic
1202314507 Y:23562025-23562047 GGAATACTTCAGTTTCAGGTTGG + Intergenic
1202556295 Y:26108570-26108592 GGAATACTTCAGTTTCAGGTTGG - Intergenic