ID: 954103856

View in Genome Browser
Species Human (GRCh38)
Location 3:48398541-48398563
Sequence CTTGCACAGGATGCTGTCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 167}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954103844_954103856 16 Left 954103844 3:48398502-48398524 CCCTGAGGGTCACCAGGGCCCTT 0: 1
1: 0
2: 0
3: 30
4: 248
Right 954103856 3:48398541-48398563 CTTGCACAGGATGCTGTCTTTGG 0: 1
1: 0
2: 0
3: 19
4: 167
954103845_954103856 15 Left 954103845 3:48398503-48398525 CCTGAGGGTCACCAGGGCCCTTC 0: 1
1: 0
2: 0
3: 20
4: 242
Right 954103856 3:48398541-48398563 CTTGCACAGGATGCTGTCTTTGG 0: 1
1: 0
2: 0
3: 19
4: 167
954103846_954103856 4 Left 954103846 3:48398514-48398536 CCAGGGCCCTTCCCCCTCCCGTG 0: 1
1: 0
2: 1
3: 41
4: 506
Right 954103856 3:48398541-48398563 CTTGCACAGGATGCTGTCTTTGG 0: 1
1: 0
2: 0
3: 19
4: 167
954103850_954103856 -8 Left 954103850 3:48398526-48398548 CCCCTCCCGTGACAGCTTGCACA 0: 1
1: 0
2: 0
3: 12
4: 129
Right 954103856 3:48398541-48398563 CTTGCACAGGATGCTGTCTTTGG 0: 1
1: 0
2: 0
3: 19
4: 167
954103852_954103856 -10 Left 954103852 3:48398528-48398550 CCTCCCGTGACAGCTTGCACAGG 0: 1
1: 0
2: 0
3: 9
4: 111
Right 954103856 3:48398541-48398563 CTTGCACAGGATGCTGTCTTTGG 0: 1
1: 0
2: 0
3: 19
4: 167
954103848_954103856 -3 Left 954103848 3:48398521-48398543 CCTTCCCCCTCCCGTGACAGCTT 0: 1
1: 0
2: 0
3: 25
4: 229
Right 954103856 3:48398541-48398563 CTTGCACAGGATGCTGTCTTTGG 0: 1
1: 0
2: 0
3: 19
4: 167
954103847_954103856 -2 Left 954103847 3:48398520-48398542 CCCTTCCCCCTCCCGTGACAGCT 0: 1
1: 0
2: 1
3: 26
4: 279
Right 954103856 3:48398541-48398563 CTTGCACAGGATGCTGTCTTTGG 0: 1
1: 0
2: 0
3: 19
4: 167
954103849_954103856 -7 Left 954103849 3:48398525-48398547 CCCCCTCCCGTGACAGCTTGCAC 0: 1
1: 0
2: 0
3: 8
4: 108
Right 954103856 3:48398541-48398563 CTTGCACAGGATGCTGTCTTTGG 0: 1
1: 0
2: 0
3: 19
4: 167
954103851_954103856 -9 Left 954103851 3:48398527-48398549 CCCTCCCGTGACAGCTTGCACAG 0: 1
1: 0
2: 3
3: 9
4: 109
Right 954103856 3:48398541-48398563 CTTGCACAGGATGCTGTCTTTGG 0: 1
1: 0
2: 0
3: 19
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954103856 Original CRISPR CTTGCACAGGATGCTGTCTT TGG Intronic
901049094 1:6417360-6417382 CTAGCACAGGCTGCTGATTTGGG + Exonic
902464317 1:16606357-16606379 CTTTCGCATGATGCTGTATTGGG + Intronic
902742138 1:18446021-18446043 CTTACACAGGTGGCAGTCTTAGG - Intergenic
905791524 1:40792148-40792170 CCTGTCCAGGTTGCTGTCTTTGG + Intronic
909939239 1:81591334-81591356 TTTGCACAGGAAGCTTGCTTAGG + Intronic
910384140 1:86663427-86663449 CATGCACAGGGGCCTGTCTTGGG + Intergenic
912269262 1:108192729-108192751 CCTGAGGAGGATGCTGTCTTAGG - Intronic
915421550 1:155786570-155786592 GTTTCACAGGACGCTGTCTTTGG + Intronic
915656453 1:157364927-157364949 CTGACATAGGATGCTGTTTTGGG + Intergenic
918851019 1:189690658-189690680 TTTGCTCAAGATGCTATCTTTGG + Intergenic
919324557 1:196090277-196090299 CTTGGAGAGTATGCTGTCTGAGG + Intergenic
921106173 1:211981157-211981179 CTGGAACAAGATGCTGTCTTTGG - Exonic
921711486 1:218377779-218377801 CTTCCAAAGGATGCAGTCTGAGG + Intronic
924147001 1:241086784-241086806 TTTGCACAGGATGAGGTGTTTGG - Intronic
1063828192 10:9922250-9922272 CTTGCAAAGGCTGTTGCCTTTGG - Intergenic
1064007590 10:11710803-11710825 CTTTCACAGCATGATGTCTAAGG - Intergenic
1064244141 10:13656221-13656243 CTTGCAAAGGAAGCTGGGTTGGG - Intronic
1067355285 10:45518680-45518702 ATTCCACAGGATGCTCCCTTGGG - Intronic
1070676932 10:78418225-78418247 GATGCACAGGGTGCTGGCTTTGG + Intergenic
1073101281 10:101008049-101008071 CTTGCACAGAATGCTGCTTGGGG + Intronic
1078669574 11:13353060-13353082 CTTGCAAAGGATGCTGACAGTGG + Intronic
1081348570 11:42020583-42020605 CATGCACAAGCTTCTGTCTTCGG - Intergenic
1083635432 11:64118189-64118211 CTTGCAGAGGCTGCTGCCGTTGG - Exonic
1086905129 11:92409841-92409863 CTTGTATAGAATGCTGTCTGAGG - Intronic
1088271376 11:108037879-108037901 CTTGCACACGGGTCTGTCTTAGG + Intronic
1089986522 11:122819211-122819233 CTTGGACTGGAGGCTGTCTCTGG + Intergenic
1090397209 11:126426924-126426946 CTTGCAGATGGGGCTGTCTTGGG + Intronic
1091074905 11:132606454-132606476 CTTTCACAGGATGATGTCTGCGG + Intronic
1091315580 11:134611700-134611722 CTAGTACAGGATGTAGTCTTAGG + Intergenic
1093082327 12:14827349-14827371 CTTGCATAGGATAGGGTCTTTGG - Exonic
1098945674 12:76586954-76586976 CTTATACAAGATGCTGTTTTGGG + Intergenic
1101728679 12:107408850-107408872 CTTGCACCAGATGCTGTGCTGGG + Intronic
1103415157 12:120738401-120738423 CTCCCCCAGGATGCTGTCCTTGG - Exonic
1103893602 12:124258085-124258107 CTCACACAGGCAGCTGTCTTGGG - Intronic
1106800398 13:33250538-33250560 CTTTAAAAGGATGCAGTCTTAGG - Intronic
1107790220 13:43994439-43994461 TCTGCACAGGATGCTCTGTTAGG - Intergenic
1108060184 13:46525204-46525226 GTTGCCCAGGCTGATGTCTTTGG + Intergenic
1108920250 13:55664413-55664435 CTTGCCCTGGTGGCTGTCTTGGG - Intergenic
1110360495 13:74619748-74619770 CTTCTTCAGGATGCTTTCTTAGG + Intergenic
1111300842 13:86348427-86348449 CCTGAAAAGGATGCAGTCTTTGG + Intergenic
1112739885 13:102460734-102460756 CTTGCAAACACTGCTGTCTTTGG + Intergenic
1114537548 14:23432540-23432562 GCTGCACAGGATGCTCTCGTGGG + Intronic
1115981131 14:39052833-39052855 CTAGGACAAGATGCTGTCTGAGG + Intronic
1116264925 14:42675724-42675746 GTAGCACAGGATGAGGTCTTAGG - Intergenic
1117481299 14:56148070-56148092 CTTGCACTGGATTCTGTCTCAGG + Intronic
1117785569 14:59281059-59281081 CTTGCAGAGAAATCTGTCTTGGG - Intronic
1120286704 14:82511548-82511570 TTTGCACAGGATGGTGTATAAGG - Intergenic
1120691845 14:87601496-87601518 CTTGGACACAATGCTGCCTTGGG - Intergenic
1121336016 14:93077884-93077906 TGTGCACAGTATGCTGTCTTGGG - Intronic
1122590850 14:102849698-102849720 CTTGCCCAGGATGCTGACTGTGG + Intronic
1126496168 15:49293040-49293062 CAGGCACAGGATGGAGTCTTGGG + Intronic
1126839201 15:52699716-52699738 CTTGCACAGGATGCCCGCTGGGG - Intronic
1127362297 15:58255067-58255089 CTAGTTCATGATGCTGTCTTAGG + Intronic
1128537603 15:68502674-68502696 CTTGCCCAGGACGCTGGCATGGG + Intergenic
1128545821 15:68566847-68566869 GTTGCACATGACGCTGTGTTTGG - Intergenic
1128779900 15:70352386-70352408 TTTGGAAATGATGCTGTCTTGGG - Intergenic
1131232911 15:90672498-90672520 CTTGAACATGACGCTGTCCTGGG + Intergenic
1131699890 15:94923350-94923372 TTTTCACAGGAAGATGTCTTAGG + Intergenic
1133140094 16:3737312-3737334 CCTGCAGCGTATGCTGTCTTGGG - Intronic
1134677721 16:16102343-16102365 CTGGCACAGGATGCTGGCTCAGG + Intronic
1135750604 16:25055697-25055719 CTTGCACTGGATGCTGGGGTTGG + Intergenic
1137477725 16:48824998-48825020 CTTTCCCAGGATGCTGACTAAGG + Intergenic
1139307390 16:65998795-65998817 CCAGCACAGTATGCTGTGTTTGG - Intergenic
1139473880 16:67192849-67192871 CTTCCACTGGATGCTGTTCTTGG - Exonic
1139677893 16:68537856-68537878 CTTGCGCAGGATTTTGTGTTTGG + Intronic
1140400776 16:74669644-74669666 CTTGCACAGGATGCCTTCCAAGG - Intergenic
1141929100 16:87189261-87189283 CTTGCACACGATGCGGCTTTTGG - Intronic
1142029684 16:87832293-87832315 CTGGCTCAGGATGGTGTCTCGGG + Exonic
1142944786 17:3415733-3415755 ATTAAACATGATGCTGTCTTTGG + Intergenic
1144249878 17:13405649-13405671 CATTCACAGGATGCTGCCTTGGG - Intergenic
1144519948 17:15946727-15946749 CTTGCCCAGGATGGTGTATCAGG + Intronic
1146557860 17:33842111-33842133 CTTGCCCAGCCTGCTGTCTCTGG - Intronic
1150799700 17:68270919-68270941 CTTGCTGAGGATGATGTCGTGGG - Exonic
1153789377 18:8563985-8564007 CTTGCACATGAAGCTTCCTTGGG - Intergenic
1154215170 18:12410418-12410440 CTGGCCGAGGATGCTGTCATTGG + Intronic
1156886463 18:42141215-42141237 CCTGCTCAGGCTGCTGTTTTAGG - Intergenic
1157153363 18:45241283-45241305 CGTGCTCTGGCTGCTGTCTTGGG + Intronic
1159279228 18:66263269-66263291 CTTGCTCAGGGGGCTGTCTCAGG + Intergenic
1160159164 18:76458451-76458473 CTTGTGCAGGATGCTTGCTTGGG - Intronic
1162323197 19:9982319-9982341 TTTGCACTGGCTGCTGTCTTTGG + Intronic
1162841686 19:13361294-13361316 CCTCCCCAGGAAGCTGTCTTTGG - Intronic
1163569131 19:18069857-18069879 CCTGCACTGGAGGCTGCCTTGGG + Intronic
1166540426 19:43601667-43601689 CTTGGGCAGGCTGCTATCTTGGG - Intronic
1166821828 19:45585137-45585159 CTTGCAGAGGAAGGTGTATTTGG - Intronic
925437845 2:3856771-3856793 CCTACACAGGCTACTGTCTTTGG + Intergenic
928388701 2:30891561-30891583 TTTGCACATGAAGCTGTCTTTGG - Intergenic
929675573 2:43923953-43923975 CTTGCACACAATGCTGAGTTTGG - Intronic
932387372 2:71348498-71348520 GTTGCACTGGGTGCTGTCCTAGG - Exonic
935709226 2:105882421-105882443 CTTGCAAAGAATGCTTTCTCTGG - Intronic
936237620 2:110757061-110757083 CATGCACTGGAGCCTGTCTTGGG - Intronic
938200782 2:129371387-129371409 CTTGTCCTGGATGCTATCTTTGG + Intergenic
941142984 2:161807601-161807623 ATTGCATAGCATGCAGTCTTAGG + Intronic
941232785 2:162931637-162931659 TTTGCACAGGTTCCTCTCTTTGG + Intergenic
941366405 2:164616937-164616959 CTTTTACAAGATGCTGTTTTTGG - Intronic
943783557 2:191850856-191850878 CTTGAACAGGAGGCAGTCCTAGG + Intergenic
945352485 2:208798428-208798450 CTAGCATAGGAAGCTTTCTTGGG + Intronic
945543689 2:211122407-211122429 TTTGGACAGAATGCTGTCTTGGG + Intergenic
1170598914 20:17825959-17825981 CTGGCAAAAGATGCTGTCTTGGG + Intergenic
1173300520 20:41798325-41798347 CTTGTTGAGGATGCTGTCTGGGG + Intergenic
1173628197 20:44489432-44489454 CTGGCCCAGGATGCTGTCACAGG - Exonic
1174533342 20:51231962-51231984 TTTGCACAGCAAGCTGTTTTAGG + Intergenic
1174549017 20:51348106-51348128 CTGGCAGAGGCTTCTGTCTTTGG - Intergenic
1175465262 20:59186289-59186311 CTAGCAAGGGATGCTGTCTCGGG - Intergenic
1176312431 21:5159584-5159606 CTTCCACAGTATGGTGACTTTGG + Intergenic
1178807926 21:35854804-35854826 CTTGTACAGGCAGCTGTATTTGG - Intronic
1179844617 21:44102446-44102468 CTTCCACAGTATGGTGACTTTGG - Intronic
1180029310 21:45193205-45193227 CTTGGTCATGATGCTGTATTTGG - Intronic
1182037155 22:27207954-27207976 CCTGCACAACAGGCTGTCTTGGG + Intergenic
949728064 3:7073843-7073865 CTTCCTCAGGATGCTTACTTAGG - Intronic
950637752 3:14327360-14327382 CTTGTACAGGATGTTCTCTCTGG - Intergenic
951340957 3:21486039-21486061 CTAACACAGGATCCTGTGTTAGG - Intronic
951340958 3:21486040-21486062 CTAACACAGGATCCTGTGTTAGG + Intronic
951341329 3:21491037-21491059 CTAACACAGGATCCTGTGTTAGG - Intronic
951341330 3:21491038-21491060 CTAACACAGGATCCTGTGTTAGG + Intronic
951698386 3:25469349-25469371 CATGAACATGATGCTGTCTTTGG + Intronic
952392440 3:32891672-32891694 CTTGCACAGGAAGCTGCCGTTGG - Exonic
953110619 3:39934471-39934493 CTTGCATAGCATGCTGGTTTGGG - Intronic
953800855 3:46021428-46021450 CTTCCACAAGGTGCTTTCTTCGG - Exonic
954103856 3:48398541-48398563 CTTGCACAGGATGCTGTCTTTGG + Intronic
956584844 3:70853253-70853275 CTTGCTCAGTATGCATTCTTTGG + Intergenic
957689221 3:83545850-83545872 CTTCCAGAGGATGCATTCTTTGG - Intergenic
958844507 3:99249916-99249938 CCTGCATTGGATGCTGTATTGGG + Intergenic
961804342 3:129478196-129478218 CTGGCACAGGATGATGTGATTGG - Exonic
965576963 3:170227309-170227331 CAGGCACATGATGCTGTCGTAGG + Intronic
965812294 3:172603716-172603738 CTTACACAGCAGGCTCTCTTGGG + Intergenic
967030888 3:185605502-185605524 CCTGCACTGGATCCTGTATTAGG - Intronic
967824811 3:193869652-193869674 CCTGCGCCGGACGCTGTCTTTGG + Intergenic
975210698 4:71696541-71696563 CTTGTACAAAATTCTGTCTTGGG + Intergenic
977756189 4:100675011-100675033 ATTGCCCAGCATGCTGACTTAGG - Intronic
979029439 4:115622119-115622141 CTTGTACAGCATGCTGACTAAGG + Intergenic
985658265 5:1143089-1143111 GTTGCCCAGGAGGCTGTGTTGGG - Intergenic
987829542 5:23077481-23077503 TTTGCACAGGATGTTGTATCGGG - Intergenic
989228619 5:39060801-39060823 CTTATACATGATGCTGTCTTTGG + Intronic
990850926 5:60203801-60203823 CTTGCATAGGATGGTGGCTAGGG - Intronic
994265746 5:97714401-97714423 CTTACTCAGGCTGCTGTCATTGG + Intergenic
997409500 5:133680384-133680406 CTTGGAAAGGATCCTGTGTTTGG - Intergenic
999658562 5:153834659-153834681 CTGGCACATGATGCTGTGATGGG + Intergenic
1002888201 6:1313519-1313541 CTTGCGCAGGATGCTGTCGATGG - Exonic
1003563862 6:7205737-7205759 CTTGCACAGGGTGTACTCTTTGG + Intronic
1003725818 6:8762253-8762275 CTTGGACAGGATGAGGTCTAAGG - Intergenic
1004028768 6:11845666-11845688 CTTGCACAGGCTGCTTAGTTTGG + Intergenic
1006247768 6:32755172-32755194 TGTGCACAGGATGGTGTGTTTGG + Intergenic
1006908939 6:37551420-37551442 TTTACACAGGCTGCTGTCTCCGG + Intergenic
1007368619 6:41411946-41411968 CTTGAACAGGATGCATTCTCAGG - Intergenic
1007886214 6:45233124-45233146 TTTGTACAAGAGGCTGTCTTTGG + Intronic
1008062518 6:47013630-47013652 CCTCCACATGATGCTCTCTTAGG - Intronic
1011388572 6:86824380-86824402 CTCACACAGGATGCTCTTTTAGG - Intergenic
1012858076 6:104526994-104527016 CTTGCACGGGAAGGGGTCTTGGG - Intergenic
1016840552 6:148520240-148520262 CTTGCTCAGGGTCCTGTCTGAGG - Intronic
1017522618 6:155215031-155215053 CTGGCACAGGATGGTAGCTTGGG + Intronic
1018643381 6:165925949-165925971 GTTACACAGGATGCTGCCATTGG + Intronic
1019255039 7:44169-44191 ATTTCACAGGGTGCTGTTTTGGG + Intergenic
1019421331 7:952650-952672 CTTGCAAAGGGAGCTGTCTTAGG - Intronic
1020548642 7:9568916-9568938 CTTGCACATGCTTCTGTCTCAGG + Intergenic
1020844068 7:13260400-13260422 CTTGCACAAGAATCTGTCTCAGG + Intergenic
1021039193 7:15840079-15840101 CTTGCACAATATGCTGCCTATGG + Intergenic
1024251300 7:47507770-47507792 CTGGCACAGGAGGCTGTGTTGGG - Intronic
1024555529 7:50600030-50600052 CTTCCACAGGAGGCTTTATTTGG - Intronic
1029635104 7:101778384-101778406 CTGGCACAGGCTGGTGGCTTTGG + Intergenic
1030318326 7:108139004-108139026 TTTGCAAAGGATTATGTCTTAGG + Intergenic
1032727396 7:134603560-134603582 CTTGCTCTGGTGGCTGTCTTGGG + Intergenic
1035967571 8:4210205-4210227 CATGCCCAGCATGCTGGCTTGGG - Intronic
1042040675 8:64585670-64585692 CTGGCACATGCTGCAGTCTTAGG - Intergenic
1044275750 8:90297647-90297669 GATGCCCAGGTTGCTGTCTTGGG - Intergenic
1045314232 8:101029280-101029302 CTTGCACATGATGCAGTGTGGGG + Intergenic
1045803085 8:106123880-106123902 ATTGTATAGGATGCTGTGTTAGG + Intergenic
1047055342 8:121158090-121158112 CTTGCCCAGGATGCTATATTTGG - Intergenic
1049315895 8:141967302-141967324 AGTGCCCAGGATGCTGTCTGCGG - Intergenic
1049468681 8:142765357-142765379 CTTGCCCAGGAAGCAGCCTTGGG + Intronic
1051014799 9:12461764-12461786 ATTGAACAGGATTCTGTTTTAGG - Intergenic
1051358106 9:16258328-16258350 CTTGTGCAGGAAGCAGTCTTGGG - Intronic
1051392032 9:16575706-16575728 CTGGCACAGGAGGCTTTTTTGGG - Intronic
1052753435 9:32515940-32515962 CTTGCACAGGATTCCGTCCCAGG + Intronic
1053156402 9:35783379-35783401 CTTGCACAGTAGGGTGACTTTGG - Intergenic
1055890406 9:81117749-81117771 CTGGATCAGGATGCTGTGTTGGG - Intergenic
1058720382 9:107758893-107758915 CTTCCAATGGATGCTCTCTTAGG - Intergenic
1061079321 9:128360749-128360771 TTTTCTCAGGATGATGTCTTGGG + Exonic
1061166386 9:128925001-128925023 GTTGCACAGGTTGCTGTGGTTGG + Intronic
1187676689 X:21723345-21723367 CACCCACAGGATGCTGTCCTTGG + Intronic
1188977366 X:36691306-36691328 CTTGCACATGATACCATCTTTGG - Intergenic
1188980490 X:36722375-36722397 GTTGCAAAGGATGTTCTCTTTGG - Intergenic
1192678410 X:73225125-73225147 GTTACACAGGATGCTTTTTTTGG + Intergenic
1192807792 X:74525117-74525139 ATTCCACAGAATCCTGTCTTGGG - Intronic
1194289837 X:92057333-92057355 GTGGCACAGAATGCTGTCATAGG + Intronic
1197087966 X:122501683-122501705 CTTGCCCAGGTTGCTGTTGTAGG - Intergenic
1197846896 X:130812836-130812858 TTTGCTCAGGATGCTTTATTTGG - Intronic
1201386834 Y:13450434-13450456 CTTGCACAAGCTCCTGTTTTAGG + Intronic