ID: 954104017

View in Genome Browser
Species Human (GRCh38)
Location 3:48399369-48399391
Sequence GGCCAACGGGACGGGCTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 201}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954104005_954104017 5 Left 954104005 3:48399341-48399363 CCCCTGCCCTCTGGCTTTCAGGT 0: 1
1: 1
2: 8
3: 76
4: 596
Right 954104017 3:48399369-48399391 GGCCAACGGGACGGGCTGGCAGG 0: 1
1: 0
2: 0
3: 21
4: 201
954104009_954104017 -1 Left 954104009 3:48399347-48399369 CCCTCTGGCTTTCAGGTGGCTTG 0: 1
1: 0
2: 4
3: 35
4: 271
Right 954104017 3:48399369-48399391 GGCCAACGGGACGGGCTGGCAGG 0: 1
1: 0
2: 0
3: 21
4: 201
954104001_954104017 20 Left 954104001 3:48399326-48399348 CCTGCCATTCAGGCTCCCCTGCC 0: 1
1: 0
2: 1
3: 21
4: 313
Right 954104017 3:48399369-48399391 GGCCAACGGGACGGGCTGGCAGG 0: 1
1: 0
2: 0
3: 21
4: 201
954104000_954104017 21 Left 954104000 3:48399325-48399347 CCCTGCCATTCAGGCTCCCCTGC 0: 1
1: 0
2: 2
3: 23
4: 305
Right 954104017 3:48399369-48399391 GGCCAACGGGACGGGCTGGCAGG 0: 1
1: 0
2: 0
3: 21
4: 201
954104006_954104017 4 Left 954104006 3:48399342-48399364 CCCTGCCCTCTGGCTTTCAGGTG 0: 1
1: 2
2: 17
3: 92
4: 508
Right 954104017 3:48399369-48399391 GGCCAACGGGACGGGCTGGCAGG 0: 1
1: 0
2: 0
3: 21
4: 201
954104007_954104017 3 Left 954104007 3:48399343-48399365 CCTGCCCTCTGGCTTTCAGGTGG 0: 1
1: 0
2: 5
3: 50
4: 328
Right 954104017 3:48399369-48399391 GGCCAACGGGACGGGCTGGCAGG 0: 1
1: 0
2: 0
3: 21
4: 201
954104010_954104017 -2 Left 954104010 3:48399348-48399370 CCTCTGGCTTTCAGGTGGCTTGG 0: 1
1: 0
2: 4
3: 26
4: 287
Right 954104017 3:48399369-48399391 GGCCAACGGGACGGGCTGGCAGG 0: 1
1: 0
2: 0
3: 21
4: 201
954104002_954104017 16 Left 954104002 3:48399330-48399352 CCATTCAGGCTCCCCTGCCCTCT 0: 1
1: 0
2: 4
3: 49
4: 643
Right 954104017 3:48399369-48399391 GGCCAACGGGACGGGCTGGCAGG 0: 1
1: 0
2: 0
3: 21
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954104017 Original CRISPR GGCCAACGGGACGGGCTGGC AGG Intronic
900242374 1:1623292-1623314 GCCCAACGGGGCAGGCAGGCTGG - Intronic
900508974 1:3049249-3049271 GGCCGAGGGGCCTGGCTGGCCGG + Intergenic
900596837 1:3483781-3483803 GGCACACCGGACGGGGTGGCGGG - Intergenic
900857783 1:5199914-5199936 GGCCAACGGGAAGTACTTGCAGG - Intergenic
900894364 1:5473041-5473063 GGCCAAGGGGCTGGGATGGCAGG + Intergenic
901138701 1:7014097-7014119 TGCCAAGGGGACCGGCTGGCTGG + Intronic
902360181 1:15938069-15938091 GGCCAGGGAGATGGGCTGGCAGG - Intronic
902491618 1:16786487-16786509 GGAAAAAGGGATGGGCTGGCTGG - Intronic
905260278 1:36712367-36712389 GACCGACAGGACAGGCTGGCAGG + Intergenic
906352123 1:45070340-45070362 GGCCAACGGCATGGGCAGCCAGG + Intronic
906711622 1:47934483-47934505 TGCCAGCGGGAGGGGCAGGCGGG + Intronic
907627523 1:56044610-56044632 GGCCATCAGGAAGGGCAGGCTGG + Intergenic
909904580 1:81178874-81178896 GGCCAGCAGGGCTGGCTGGCTGG + Intergenic
911798121 1:102099634-102099656 GGCCAACAGAACCGGTTGGCAGG - Intergenic
913975152 1:143450029-143450051 GGCCAACTGGACGCCCTGGGAGG - Intergenic
914069545 1:144275645-144275667 GGCCAACTGGACGCCCTGGGAGG - Intergenic
914109610 1:144690709-144690731 GGCCAACTGGACGCCCTGGGAGG + Intergenic
916989908 1:170231800-170231822 GGCCAAAGGGAAGCCCTGGCAGG + Intergenic
917962281 1:180154740-180154762 GGCCGGCGGGGCGGGGTGGCTGG + Intergenic
920013694 1:202888708-202888730 GGGCAGAGGGCCGGGCTGGCTGG + Intronic
920887019 1:209938617-209938639 ACCCCACGGGACGGGCTGGGAGG + Intronic
924740341 1:246791103-246791125 GGCCAGCGGGATGGGGTGGTGGG + Intergenic
1069495770 10:68901695-68901717 CGCCAACGGGAAGGGCTGAGGGG - Intronic
1071003742 10:80859333-80859355 GGCCAGCAGGGCTGGCTGGCTGG - Intergenic
1073242096 10:102065692-102065714 GTCCAGCGGGGAGGGCTGGCCGG - Exonic
1073565067 10:104527972-104527994 GTCCAATGGGAGGGGCTGGCAGG + Intergenic
1077409576 11:2397218-2397240 AGCCCACAGGACGGGCGGGCTGG - Exonic
1078339861 11:10490989-10491011 GGCTAACGACATGGGCTGGCTGG + Intronic
1081994571 11:47355184-47355206 GGCCAGCGGGGAGGCCTGGCGGG + Exonic
1082050515 11:47767130-47767152 CGCCGACGGGGCGGGCTGGCTGG + Exonic
1082961657 11:58923699-58923721 AGCCAAGGGGAGGGGCAGGCTGG - Intronic
1084192709 11:67506034-67506056 TGTCAAGGGGAGGGGCTGGCGGG - Intronic
1084321751 11:68377183-68377205 GGGCCACAGGAGGGGCTGGCTGG + Intronic
1084380965 11:68812530-68812552 AGCCAACTGGAGGGGCTTGCCGG + Exonic
1088262873 11:107960884-107960906 AGCCAATGGGAGGCGCTGGCTGG - Intronic
1089207112 11:116773103-116773125 GGCCACCGGGACGCGCTCGCAGG + Intergenic
1089411540 11:118247131-118247153 GGCCAACGGGAGGCATTGGCAGG - Intronic
1091001193 11:131911607-131911629 GGACAACGTGACGGTCCGGCAGG + Exonic
1091108254 11:132942945-132942967 GGACAACGTGACGGTCCGGCAGG - Exonic
1091215048 11:133895832-133895854 GGCCAGCAGGACTTGCTGGCAGG + Intergenic
1092168012 12:6354938-6354960 GGCCAGTAGGAGGGGCTGGCAGG - Intronic
1092617170 12:10225895-10225917 GGCCAGCAGGGCTGGCTGGCTGG + Intergenic
1096252264 12:50040792-50040814 GGACAGCGGGACAGGCAGGCAGG + Intergenic
1096652764 12:53069984-53070006 AGGCAAAGGGAGGGGCTGGCCGG - Intronic
1101817125 12:108153773-108153795 GGCCAACGGGAGGCCCTGGCAGG - Intronic
1103493869 12:121345638-121345660 GGCCAATGGGAGGCACTGGCAGG - Intronic
1107861384 13:44664438-44664460 GGCCAATGGGACTGGGTGGAAGG + Intergenic
1110029560 13:70590005-70590027 AGCCAACGCGCCGGGCTGACAGG + Intergenic
1111485557 13:88895104-88895126 GGCCATCAGGAAGGGCTGTCTGG - Intergenic
1112467172 13:99654382-99654404 GGCAAAGAGGAGGGGCTGGCTGG + Intronic
1117461913 14:55953745-55953767 GGCCATCAGGAAGGGCAGGCTGG - Intergenic
1119168146 14:72512991-72513013 GGCCAACATGACAGGTTGGCAGG - Intronic
1121613158 14:95294777-95294799 GGCCAATGGGAGGCGCTGGCAGG + Intronic
1122904617 14:104795945-104795967 TGGCCCCGGGACGGGCTGGCTGG - Intergenic
1122940056 14:104977222-104977244 GGCCAGGGGGTTGGGCTGGCCGG - Intronic
1122940337 14:104978299-104978321 GGCGCACGGGGCGGGCGGGCGGG + Exonic
1123180968 14:106469898-106469920 GGCCATCAGGAAGGGCAGGCTGG - Intergenic
1202852529 14_GL000225v1_random:30510-30532 GGCACCCGGGACAGGCTGGCAGG + Intergenic
1202853603 14_GL000225v1_random:36803-36825 GGCACCCGGGACAGGCTGGCAGG + Intergenic
1202858252 14_GL000225v1_random:64478-64500 GGCACCCGGGACAGGCTGGCAGG - Intergenic
1202859559 14_GL000225v1_random:72764-72786 GGCACCCGGGACAGGCTGGCAGG - Intergenic
1202860733 14_GL000225v1_random:79596-79618 GGCACCCGGGACAGGCTGGCAGG - Intergenic
1202868268 14_GL000225v1_random:136609-136631 GGCACCCGGGACAGGCTGGCAGG - Intergenic
1202945937 14_KI270726v1_random:26881-26903 GGCCATCAGGAAGGGCAGGCTGG + Intergenic
1123705702 15:22949430-22949452 GGCCAGCGGTACAGGCTGACAGG + Intronic
1124357089 15:29003710-29003732 GGCCATGGGGAAGGGCAGGCTGG + Intronic
1125071305 15:35557127-35557149 AGCCAGCGGGACGCACTGGCAGG - Intergenic
1128721925 15:69956438-69956460 GGACAGCAGGAGGGGCTGGCAGG - Intergenic
1129744374 15:78007914-78007936 GGCCAGCGGGAGGTGCTGGCAGG - Intronic
1131307095 15:91254727-91254749 TGCCAAAGGTTCGGGCTGGCAGG - Intronic
1132693768 16:1193154-1193176 GGTAAACGGAACAGGCTGGCGGG - Intronic
1136111017 16:28063611-28063633 GGCGTGCGGGGCGGGCTGGCGGG + Intergenic
1136533873 16:30887838-30887860 GGGCAACAGGACAGGCAGGCCGG + Intronic
1136590800 16:31216603-31216625 CGCCCCCGGGAGGGGCTGGCCGG + Intronic
1138105177 16:54284201-54284223 GGCCAGGGGGACTGGCTGGCGGG - Intronic
1138580719 16:57939116-57939138 GGCCTGCAGGAGGGGCTGGCAGG + Intronic
1139361467 16:66402524-66402546 GGCCAAAGGGATGGGCATGCTGG + Intronic
1139521190 16:67483549-67483571 AGCCAAGGGCACGGGGTGGCCGG - Exonic
1139544748 16:67644992-67645014 GGGCGACGGGGCGGGCGGGCAGG + Exonic
1139651101 16:68362465-68362487 GCCCCAGGGGACAGGCTGGCAGG - Intronic
1142186146 16:88695583-88695605 GGCCACAGGGAAGGGCAGGCTGG + Intergenic
1203104480 16_KI270728v1_random:1346245-1346267 AGCCAGCTGGACGGGCGGGCAGG + Intergenic
1203129034 16_KI270728v1_random:1616123-1616145 AGCCAGCTGGACGGGCGGGCAGG - Intergenic
1142851683 17:2707607-2707629 GGCCTAGGAGACTGGCTGGCAGG + Intronic
1143078861 17:4366697-4366719 GGCCGAGGGGTCGGGCTAGCGGG - Intergenic
1143524386 17:7463606-7463628 GGCCCAGGCGGCGGGCTGGCTGG + Exonic
1144572511 17:16408274-16408296 GGGCAAGGGGACCAGCTGGCTGG - Intergenic
1144745242 17:17609527-17609549 GTCCAACCAGACGGGATGGCAGG - Intergenic
1146187148 17:30731574-30731596 GGCCAACGGGCTGGGCGGCCCGG + Intergenic
1146332183 17:31936934-31936956 GGCCAACGGGCTGGGCGGCCCGG + Intergenic
1146492494 17:33292609-33292631 GGGCTACGGGCCGGGCTGGTGGG - Exonic
1147768249 17:42851149-42851171 GGGCAAGGGGGCGGGGTGGCCGG - Intergenic
1148035553 17:44656806-44656828 GCCGAACGGGGCGGGCGGGCGGG + Intronic
1151482734 17:74379919-74379941 GGCCAGCAGGAGGGGCTGGCAGG - Intergenic
1151678474 17:75611885-75611907 GGCCATCGGGACGCCCTGGCTGG + Intergenic
1151786097 17:76275772-76275794 GGCCAGCGGGGAGGCCTGGCAGG + Intronic
1152686646 17:81696946-81696968 GGCCAGCGGCAGGGGCCGGCTGG - Exonic
1153095126 18:1392271-1392293 GGCCAATGGGAGGCACTGGCAGG - Intergenic
1157195513 18:45617431-45617453 GGCCAGCGGGTCAGGCTGGGTGG - Intronic
1160011394 18:75109290-75109312 GGCCCATGGGAGGAGCTGGCTGG - Intergenic
1160715172 19:573115-573137 GGCCGATGGGACCGGCGGGCGGG - Intronic
1160763494 19:797301-797323 GGCCAGTGGGAGGTGCTGGCGGG + Exonic
1161070104 19:2255739-2255761 GGCCAGCGGGACAGGCTAACAGG + Intronic
1161242662 19:3231089-3231111 GGCCAAAGGGAAGGGCTGTTAGG + Intronic
1161502509 19:4624325-4624347 GGCTACAGGGACAGGCTGGCAGG - Intergenic
1161732366 19:5969115-5969137 GGAGAACGGGAAGGGCTGGGTGG + Intronic
1162101680 19:8342889-8342911 GCCCAGCGCGAGGGGCTGGCTGG + Intronic
1162757225 19:12867585-12867607 GGCAAGCGGGAGGGGCTGGGCGG + Exonic
1163441609 19:17324831-17324853 GTCCAACGGGGCGGGCGGGCAGG - Exonic
1163551432 19:17968001-17968023 GGCCCATGGGACGGGAGGGCAGG + Intronic
1167376290 19:49114199-49114221 CGCCAACAGGACCGACTGGCCGG + Intergenic
1168247045 19:55117605-55117627 GGCCCCCGGGGCGGGCGGGCGGG - Intergenic
925036733 2:692712-692734 GGCCTGCGGCACCGGCTGGCGGG + Intergenic
925919835 2:8631205-8631227 GGCCAAGGGGAAGGGCTGGGAGG - Intergenic
925988800 2:9237032-9237054 GGCCAAGGGGAGGGGAAGGCAGG + Intronic
927503246 2:23596156-23596178 AGCCAGCCGGACGGGCAGGCCGG + Intronic
927714119 2:25341640-25341662 GGACGGCGGGCCGGGCTGGCCGG - Intronic
929133634 2:38602633-38602655 GGCCGGAGGGACCGGCTGGCAGG + Exonic
930596157 2:53390383-53390405 GGCCAAATGGAATGGCTGGCTGG + Intergenic
932893131 2:75613067-75613089 GGCCAATGGGAGGTGCTGGTGGG - Intergenic
933277780 2:80302185-80302207 GGCAGCCGGGACGGGCCGGCGGG - Exonic
933589345 2:84214645-84214667 GGCCAGTGGGAGGTGCTGGCTGG - Intergenic
934179852 2:89611002-89611024 GGCCAACTGGACGCCCTGGGAGG - Intergenic
934290148 2:91685263-91685285 GGCCAACTGGACGCCCTGGGAGG - Intergenic
934933940 2:98451200-98451222 GGCCAGCTGGGCTGGCTGGCTGG - Intronic
935371397 2:102350689-102350711 GGCCAATGGGAGGCACTGGCAGG + Intronic
935796325 2:106644773-106644795 GGACAGCGAGATGGGCTGGCAGG + Intergenic
937908439 2:127064058-127064080 GGCCATGGGGCTGGGCTGGCTGG - Intronic
938368797 2:130756161-130756183 GGCCAGCGGGAGGGGCGGGCCGG - Intronic
942456380 2:176140997-176141019 GCCCAGCGGGAGGGGCTGGTTGG - Intergenic
948449130 2:238058120-238058142 GGCCGGCGGGGCCGGCTGGCAGG + Intronic
948619712 2:239226790-239226812 GGCTCACGGGTGGGGCTGGCAGG + Intronic
948644958 2:239398806-239398828 GGCTAAGGGGACGGGGTGGAGGG - Intronic
948826960 2:240577517-240577539 GGCCGCCTGGCCGGGCTGGCAGG + Intronic
948992612 2:241562483-241562505 GTCCCATGGGACGGGCAGGCTGG - Intronic
1168732999 20:103614-103636 GGGCCATGGGAGGGGCTGGCAGG - Intergenic
1173018248 20:39245993-39246015 GGCCATCTGGTCAGGCTGGCAGG + Intergenic
1174253447 20:49236385-49236407 GGCGAACAGCACGTGCTGGCAGG + Exonic
1175947844 20:62566961-62566983 TGCCAGAGGGTCGGGCTGGCGGG - Intronic
1176018857 20:62952657-62952679 GGCCACCAGGGCGGGCAGGCGGG - Exonic
1176099942 20:63360360-63360382 GCCCAACAGCACGGGCAGGCTGG - Intronic
1176259485 20:64172008-64172030 GGCCAGTAGGAGGGGCTGGCAGG - Intronic
1177711370 21:24779552-24779574 CACCAACTGGACGGGCTTGCTGG - Intergenic
1178074164 21:29000274-29000296 GGCCGGCGGGGCGGGCAGGCAGG - Intergenic
1178660009 21:34499357-34499379 GGCCAACAGGATGGGCAGACAGG - Intergenic
1179252070 21:39678970-39678992 GGCCATCAGGAAGGGCAGGCTGG + Intergenic
1180008040 21:45032417-45032439 GGGAAACGGGCCGGGCAGGCAGG + Intergenic
1180049926 21:45326407-45326429 GGCCCTCGGGACTGTCTGGCCGG + Intergenic
1180903584 22:19392638-19392660 GGCCAAGGGGATGGGCAGGAGGG + Intronic
1181047185 22:20220653-20220675 GGACAGCAGGAAGGGCTGGCTGG + Intergenic
1181112034 22:20607868-20607890 GGCCAAGGGCACAGTCTGGCGGG - Intergenic
1182479369 22:30596958-30596980 GGCCAGCGGGGCCGGCCGGCTGG - Intronic
1183208251 22:36433809-36433831 GGCCAGCGGGAGGGGCGGGCTGG + Intergenic
1183570304 22:38648257-38648279 GGCCAGGGAGAAGGGCTGGCAGG + Intronic
1184146570 22:42614893-42614915 GGCCGAAGGGGCGGGCTCGCGGG - Exonic
1184689130 22:46109546-46109568 GGCCAACGGGGGGAGCTTGCTGG - Intronic
1184851368 22:47123176-47123198 GGCCAAAGGGAAGGGCTGGGTGG - Intronic
1184865069 22:47197716-47197738 TCCCAGCGGGAGGGGCTGGCTGG + Intergenic
1185118643 22:48952511-48952533 GGCCATCGGGAGCGGCTGGCAGG - Intergenic
949919930 3:8992755-8992777 GGCACACTGGGCGGGCTGGCTGG - Intronic
950720221 3:14877247-14877269 GGCCAACGGGGAGGCCTGGCAGG - Intronic
953614680 3:44478905-44478927 GGCCAATGGGAAGCCCTGGCAGG - Intergenic
954104017 3:48399369-48399391 GGCCAACGGGACGGGCTGGCAGG + Intronic
954447241 3:50553333-50553355 GTCCAGCTGGAGGGGCTGGCAGG - Intergenic
954617199 3:51975179-51975201 GCCCAACGGGATGAGCGGGCGGG - Exonic
960708477 3:120504458-120504480 GGCCAGTGGGAGGGGCTGGCAGG + Intergenic
960988790 3:123297213-123297235 GGCCAACAGGACAGGGAGGCTGG - Intronic
961012738 3:123447375-123447397 GGCCACCGGGACTGGATTGCGGG - Intronic
961828320 3:129610439-129610461 GGCCCAAGGGACGGGAGGGCAGG - Intergenic
963264756 3:143228989-143229011 AGCCAACGGGAGTGGTTGGCAGG - Intergenic
963530658 3:146469811-146469833 GGGAGACGGGACGGGCTGGGCGG - Intronic
964605170 3:158553145-158553167 GGCCAACGGGAGGGACTGTCAGG + Intergenic
968976513 4:3824907-3824929 AGCCAACGGGAAGAGCTAGCAGG - Intergenic
969273162 4:6116564-6116586 GGCCAACAGGACTGGTTTGCGGG - Intronic
969475191 4:7418347-7418369 GGCCCAGGGGTCAGGCTGGCTGG + Intronic
969614414 4:8244084-8244106 GAACAACGGGACTGGCTGCCTGG - Intergenic
969829428 4:9782620-9782642 GGCCAACTGGACGCCCTGGGAGG + Exonic
971511987 4:27437851-27437873 GGCTATCAGGAAGGGCTGGCTGG + Intergenic
972629615 4:40832273-40832295 GGCCATCGTGAAGGTCTGGCCGG + Intronic
976334556 4:83870522-83870544 GGCCAATGGGAGGTGCTGGTAGG + Intergenic
979224172 4:118265652-118265674 GGCCGGCGGGGCCGGCTGGCTGG - Intergenic
982021348 4:151208275-151208297 GGCCATCAGGAAGGGCAGGCTGG - Intronic
986272471 5:6245869-6245891 GCCCAAGGGGATAGGCTGGCTGG + Intergenic
997602598 5:135150570-135150592 GGCCATGGGCACAGGCTGGCGGG + Intronic
998094234 5:139388332-139388354 GGTCCAAGGGAGGGGCTGGCTGG - Intronic
999177033 5:149638946-149638968 GGCCAATGGGAGGCACTGGCAGG + Intergenic
999763270 5:154719157-154719179 GGCCAATAGGCCAGGCTGGCAGG - Intronic
1002718392 5:181243373-181243395 GGCCTACGGGCCGGGCGGGGCGG - Intronic
1004908508 6:20259666-20259688 GGCCGGCGGGGCGGGCCGGCCGG - Intergenic
1004924626 6:20404228-20404250 GGACAAAGGGAGGGGGTGGCGGG - Intronic
1005854478 6:29850451-29850473 GGGCAACGTGACAGGCCGGCGGG - Intergenic
1017880613 6:158560243-158560265 GGCCGAGCGGGCGGGCTGGCTGG + Intronic
1018200654 6:161391838-161391860 GGCCATCAGGAAGGGCAGGCTGG - Intronic
1018893222 6:167996850-167996872 GGACAGCGGGGCGGCCTGGCCGG + Intronic
1019516036 7:1440639-1440661 GGCCAGGAGGACGGGCCGGCAGG - Exonic
1022854820 7:34304010-34304032 GGCCAAGGGGACAGGCGGGAGGG + Intergenic
1023435306 7:40135250-40135272 GGCCCACGGAACGGGGTTGCAGG - Intronic
1023752723 7:43387212-43387234 GCCCAAGGGAAGGGGCTGGCTGG - Intronic
1026033969 7:66817699-66817721 GGCCGACGGGAGAGGCTGTCTGG - Intergenic
1026800362 7:73396428-73396450 GCCCAAGGGGAAGGGATGGCAGG + Intergenic
1033029119 7:137807853-137807875 GGTCAAGGGGACAGGCAGGCAGG - Intronic
1035203099 7:157279249-157279271 GGCTTCCGGGACGGGCTGGACGG + Intergenic
1036812928 8:11880053-11880075 AGCCACTGGGATGGGCTGGCAGG + Intergenic
1037664352 8:20955358-20955380 GGCCAATGGGGCGTTCTGGCAGG + Intergenic
1037707437 8:21326960-21326982 GGCCAGCGGGACGTGCAGGTGGG + Intergenic
1038261848 8:26002816-26002838 AGCCAACGGGACAGGCAGGCAGG + Intronic
1039171356 8:34749512-34749534 AGCCAACGGGAGGTGCTGGAGGG - Intergenic
1040807435 8:51409284-51409306 GGGCGGCGGGAGGGGCTGGCGGG + Exonic
1043709863 8:83403037-83403059 GGCCAGCAGGGCTGGCTGGCTGG - Intergenic
1049089745 8:140505678-140505700 GGCCAAGGGGAGAGGCTGGTGGG + Intergenic
1049259153 8:141629524-141629546 GGCCTGCTGGACTGGCTGGCTGG + Intergenic
1049288802 8:141790903-141790925 GGCCAAGGGGACAGGCTGAGGGG + Intergenic
1049453482 8:142675267-142675289 GGCCAAGGGGCCTGGCTGGTGGG + Intronic
1049473444 8:142786431-142786453 GGCCAAGGGGACGGGCGGGTGGG - Intronic
1058786479 9:108393608-108393630 GGCCACCAGGGCTGGCTGGCTGG - Intergenic
1060509406 9:124221216-124221238 GGCCAAGGGGAAGCACTGGCAGG + Intergenic
1061499271 9:130992875-130992897 GGGCAAGGGGACAGGATGGCAGG + Intergenic
1061708109 9:132468473-132468495 GGCCCAGGGCAGGGGCTGGCAGG - Intronic
1062121352 9:134835648-134835670 GGCCCATGGGCCGGGCTGTCCGG - Intronic
1185652377 X:1657770-1657792 GGCCAGCGGGGAGGGCTGCCCGG - Intergenic
1195690196 X:107617872-107617894 GGCCATCAGGAAGGGCAGGCTGG + Intergenic
1198214574 X:134545005-134545027 GGCCGCCGGGTCGGGCTGGTGGG + Intergenic
1200218841 X:154380714-154380736 GGGCGAGGGGACTGGCTGGCAGG - Intronic