ID: 954105313

View in Genome Browser
Species Human (GRCh38)
Location 3:48406698-48406720
Sequence GCAGCCCTGTGAGCTGGTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 0, 2: 6, 3: 35, 4: 262}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954105313_954105324 8 Left 954105313 3:48406698-48406720 CCCCAACCAGCTCACAGGGCTGC 0: 1
1: 0
2: 6
3: 35
4: 262
Right 954105324 3:48406729-48406751 CCAAGGGCTTCCCTGCAAAGGGG 0: 1
1: 0
2: 1
3: 23
4: 205
954105313_954105318 -9 Left 954105313 3:48406698-48406720 CCCCAACCAGCTCACAGGGCTGC 0: 1
1: 0
2: 6
3: 35
4: 262
Right 954105318 3:48406712-48406734 CAGGGCTGCTGAGGTTCCCAAGG 0: 1
1: 0
2: 3
3: 45
4: 363
954105313_954105330 22 Left 954105313 3:48406698-48406720 CCCCAACCAGCTCACAGGGCTGC 0: 1
1: 0
2: 6
3: 35
4: 262
Right 954105330 3:48406743-48406765 GCAAAGGGGCAGTGTGAAGGGGG 0: 1
1: 0
2: 1
3: 48
4: 392
954105313_954105322 7 Left 954105313 3:48406698-48406720 CCCCAACCAGCTCACAGGGCTGC 0: 1
1: 0
2: 6
3: 35
4: 262
Right 954105322 3:48406728-48406750 CCCAAGGGCTTCCCTGCAAAGGG 0: 1
1: 0
2: 1
3: 22
4: 161
954105313_954105331 26 Left 954105313 3:48406698-48406720 CCCCAACCAGCTCACAGGGCTGC 0: 1
1: 0
2: 6
3: 35
4: 262
Right 954105331 3:48406747-48406769 AGGGGCAGTGTGAAGGGGGAAGG 0: 1
1: 0
2: 9
3: 108
4: 1115
954105313_954105319 -8 Left 954105313 3:48406698-48406720 CCCCAACCAGCTCACAGGGCTGC 0: 1
1: 0
2: 6
3: 35
4: 262
Right 954105319 3:48406713-48406735 AGGGCTGCTGAGGTTCCCAAGGG 0: 1
1: 0
2: 0
3: 32
4: 225
954105313_954105328 20 Left 954105313 3:48406698-48406720 CCCCAACCAGCTCACAGGGCTGC 0: 1
1: 0
2: 6
3: 35
4: 262
Right 954105328 3:48406741-48406763 CTGCAAAGGGGCAGTGTGAAGGG 0: 1
1: 0
2: 3
3: 22
4: 290
954105313_954105320 6 Left 954105313 3:48406698-48406720 CCCCAACCAGCTCACAGGGCTGC 0: 1
1: 0
2: 6
3: 35
4: 262
Right 954105320 3:48406727-48406749 TCCCAAGGGCTTCCCTGCAAAGG 0: 1
1: 0
2: 1
3: 20
4: 194
954105313_954105329 21 Left 954105313 3:48406698-48406720 CCCCAACCAGCTCACAGGGCTGC 0: 1
1: 0
2: 6
3: 35
4: 262
Right 954105329 3:48406742-48406764 TGCAAAGGGGCAGTGTGAAGGGG 0: 1
1: 0
2: 4
3: 29
4: 331
954105313_954105327 19 Left 954105313 3:48406698-48406720 CCCCAACCAGCTCACAGGGCTGC 0: 1
1: 0
2: 6
3: 35
4: 262
Right 954105327 3:48406740-48406762 CCTGCAAAGGGGCAGTGTGAAGG 0: 1
1: 0
2: 1
3: 24
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954105313 Original CRISPR GCAGCCCTGTGAGCTGGTTG GGG (reversed) Intronic
900163082 1:1233522-1233544 CCAGCCCCGTGAGCCGGTCGGGG - Exonic
900198864 1:1393291-1393313 GCAGCCCAGTGACTTGGTTGTGG - Intronic
900215370 1:1478801-1478823 GCAGGACTGGGAGCTGGGTGTGG + Intronic
900222631 1:1517468-1517490 GCAGGACTGGGAGCTGGGTGTGG + Intronic
901206120 1:7496835-7496857 GCAGCCCTGGGAGGTGGTGTTGG - Intronic
901229238 1:7632822-7632844 TCAGCCCTTGGAGTTGGTTGAGG - Intronic
902110820 1:14076821-14076843 GGTGCACTGTGAGCTGGTTGTGG + Intergenic
902611987 1:17602952-17602974 GCAGGCCTGGGAGCTGGTGTGGG + Intronic
902672447 1:17984087-17984109 GCTGCCCTTTGAGTTGGATGGGG - Intergenic
902985900 1:20153939-20153961 GCAGCCCTAGGAGGTGGGTGAGG + Intergenic
903143691 1:21356063-21356085 GCAGACCTGAGAGCTGGGTGGGG + Intergenic
903365856 1:22805106-22805128 CCAGCCCTGGGAGGTGGTGGGGG - Intronic
903919608 1:26790084-26790106 TCAGCAGTGTGAGCTGGCTGAGG + Intronic
904636206 1:31883670-31883692 CCTTCCCTGTGGGCTGGTTGTGG - Intergenic
904916323 1:33973113-33973135 CCAGGCCTGGGATCTGGTTGAGG - Intronic
905675544 1:39822216-39822238 GCCTCCCTGTGAGCAGGATGGGG + Intergenic
906061571 1:42952553-42952575 ACAGCCCTGTGTGCTGTCTGTGG - Intronic
906310533 1:44750957-44750979 GAAGCCCTCTGAGATAGTTGAGG + Intronic
906312945 1:44766937-44766959 TCAGCCCTGCGAGGTGGGTGTGG + Exonic
906509015 1:46400695-46400717 ATAGCCCAGTGAGCTGGTTTGGG + Intronic
906561758 1:46763439-46763461 GCAGCCATGTGAGCTCCTAGTGG + Intronic
906791387 1:48661278-48661300 TGAGCCCTGTGAGATGGATGGGG + Intronic
906869762 1:49465263-49465285 GCAGACATGTCAGCTGGTTCTGG + Intronic
907419989 1:54340789-54340811 GCAGCCCTCTGGGCTGGTATGGG - Intronic
910053083 1:82999226-82999248 GCAGCCCTGTTAGCCTCTTGAGG - Intergenic
912491973 1:110067483-110067505 GCAGGCCTGAGAGCTGGGTCAGG - Intronic
912812218 1:112803074-112803096 GCAGGACTGTGGGCTGGTTCAGG - Intergenic
913345866 1:117810629-117810651 GCAGCCATTTGATCTGGTTAAGG - Intergenic
913529218 1:119721623-119721645 GCACCTCTGTGACCTGGTTCAGG + Intronic
914803530 1:150976481-150976503 GAAACCCTGGGAGCTGGTTAGGG - Intergenic
915146004 1:153796127-153796149 CCAGCCCTGGGACTTGGTTGTGG + Intergenic
916404221 1:164481725-164481747 GCAGCCCTATGAGATGCTTGTGG - Intergenic
917489302 1:175484005-175484027 GCTGCACTGTGAGCTCCTTGTGG + Intronic
918709938 1:187714484-187714506 GTGGCCCTGTGTGCTGGTTCTGG - Intergenic
922570446 1:226631637-226631659 CCAGCCCTGAGACCTGGCTGAGG - Intergenic
922584012 1:226720269-226720291 ACAGCCCTGGGAGGTGGCTGAGG - Intronic
924739773 1:246788254-246788276 GCAGCTGTGTGAGCAGTTTGGGG - Intergenic
1062925937 10:1315299-1315321 GAAGCCATGTGCGCTGGCTGGGG - Intronic
1062966705 10:1612636-1612658 GCAGCCCTGTGTGTTGCCTGAGG + Intronic
1064430720 10:15267873-15267895 GCAGCACTGTGAGGTGTTTGTGG - Intronic
1066094533 10:32059531-32059553 ACATCCCTGTGGGCTGGATGTGG + Intergenic
1067686867 10:48470998-48471020 GCAACCTTGTTAGCTGGTAGTGG - Intronic
1067762307 10:49057580-49057602 GCAGGCCTGTGAGATGGGGGTGG - Intronic
1067999857 10:51319972-51319994 GCACCACTGTGAGCTTGTTATGG - Intronic
1069568790 10:69481619-69481641 GCAGCCCTGTGAGTGGCTGGAGG + Intronic
1069742440 10:70693537-70693559 GCAGCCCTACAAGATGGTTGTGG + Intronic
1069930604 10:71878988-71879010 GCAGCCATGTGCGGTGGCTGCGG - Intergenic
1070162921 10:73876480-73876502 ACAGCCCTGAGAGCTGCTTTGGG + Intergenic
1073575224 10:104617425-104617447 CCCTCCATGTGAGCTGGTTGGGG + Intergenic
1074518850 10:114198448-114198470 CCACACCTGTGAGCAGGTTGGGG + Intronic
1076443769 10:130498066-130498088 GCAGCCCTGGGGGCTGGATCCGG + Intergenic
1076820738 10:132938186-132938208 GCAGCCCTGCGAGGAAGTTGGGG - Intronic
1077324829 11:1959210-1959232 GCAGGCATGTGAGGTGGGTGTGG - Intronic
1077490953 11:2860758-2860780 GTAGCCGTGTGAGCTGGAGGGGG - Intergenic
1079203458 11:18394547-18394569 GCAGCACTCTGAGCTGGGCGCGG - Intronic
1081909980 11:46694486-46694508 GCAGCTCTGTGCGGGGGTTGTGG + Intronic
1081998959 11:47382445-47382467 GCAGGCCTGTAAGCTGCTGGAGG - Intergenic
1083125440 11:60560697-60560719 GCAGCTCTGTCAGCTGGGTTTGG - Intergenic
1083148374 11:60774852-60774874 GCAGGGGAGTGAGCTGGTTGAGG + Intronic
1083371406 11:62185223-62185245 TCAGCCATTTGAGCTTGTTGGGG + Intergenic
1084010557 11:66346222-66346244 GCAGGCCTGCGAGCTGCATGTGG - Exonic
1084149666 11:67282240-67282262 GAAGCCCAGTGAGCTGCCTGGGG - Intronic
1084293680 11:68195375-68195397 ACAGCCCTGTGAGGTGGATGGGG - Intronic
1089286443 11:117410899-117410921 GCCTCCCTGGGGGCTGGTTGGGG + Intronic
1089620978 11:119721968-119721990 GGAGGCGTGTGAGCTGGTGGTGG + Intronic
1089731391 11:120521443-120521465 GTGGCCCTGTGAGCTCTTTGGGG - Intronic
1202807809 11_KI270721v1_random:14387-14409 GCAGGCATGTGAGGTGGGTGTGG - Intergenic
1092112045 12:5970825-5970847 GCAGCCTTGGGAGCTGGTGCTGG - Intronic
1092680989 12:10981068-10981090 TCAGCCCTGAGAACTGGCTGAGG - Intronic
1095755265 12:45758296-45758318 GCAGCCCCGTGGGCTGTATGAGG + Intronic
1099447981 12:82774876-82774898 CCCTCCCTGTCAGCTGGTTGTGG - Intronic
1100392742 12:94158317-94158339 GCAGCCTGGTGAGCTGCTTGTGG - Intronic
1100811461 12:98342971-98342993 ACAGCCCTATGAGCTAGTTTTGG + Intergenic
1101735451 12:107459806-107459828 GCAGCCCTGTGTGCTGTGGGTGG + Intronic
1102167576 12:110818970-110818992 GCAGCCCTGAGGGCTGTTAGTGG + Intergenic
1102199819 12:111049564-111049586 GCAGGCCTGTGAGGTTGGTGAGG + Intronic
1102447609 12:113015529-113015551 GCATACCTGTGTCCTGGTTGAGG + Intergenic
1102950345 12:117026939-117026961 GCAGCCCTATGAGCAGGATGTGG + Intronic
1103480124 12:121245331-121245353 CCAGCCCTGGGAGCTGGCAGGGG - Intronic
1105447497 13:20470354-20470376 GCAGCCCGGAGAGCTTGGTGTGG - Intronic
1106671575 13:31911669-31911691 GCAGCGCTGTGAGAAGGCTGAGG - Intergenic
1106755180 13:32815167-32815189 GCATGCCTGTGAGCTGGCTCTGG + Intergenic
1107665150 13:42680853-42680875 CCAGCCCTCTGAGCAGGTTCAGG + Intergenic
1113376630 13:109770155-109770177 GCAGCCCTTTGAGCCGGTGGGGG + Intronic
1114269346 14:21091609-21091631 GCAGCCCTATGGGATGGGTGTGG - Intronic
1115475047 14:33805434-33805456 GCAGCCTTGTGAGCTGGAGGTGG + Intergenic
1115972782 14:38964472-38964494 GGAGCCCTGTGAGATGGCAGTGG - Intergenic
1121775467 14:96587730-96587752 CCAGCCCTATCAGCTGGTGGGGG + Intergenic
1122150885 14:99725586-99725608 AGATCCCTGTGAGGTGGTTGTGG + Intronic
1122804345 14:104249103-104249125 CCAGCCCTGGCAGCTGGTAGGGG - Intergenic
1202902731 14_GL000194v1_random:52772-52794 GCAACTCTGTGAGCTGGGTGGGG - Intergenic
1124604320 15:31159773-31159795 GCAGCCTGGTGAGCTGGGTATGG + Intronic
1125009661 15:34857457-34857479 AGAGCCCTGTGAGCTGGGTGCGG + Intronic
1128146204 15:65333793-65333815 GTGCCCCTGTGACCTGGTTGGGG + Intronic
1129604427 15:77017914-77017936 CCGGCCCTGTCAGCTGGGTGGGG + Intronic
1130004653 15:80083315-80083337 CCAGCCCTGTGAATTGGTGGTGG + Intronic
1130302416 15:82689810-82689832 ACAGCCATGTGGGCTGGGTGTGG + Intronic
1130738035 15:86570958-86570980 GCTGGCCTGTGAGCAGTTTGTGG + Intronic
1132058353 15:98669697-98669719 GCAGCCTTGTCAGGTGGGTGTGG + Intronic
1132559175 16:585371-585393 GCAGCCCAGTGAGCAGCTGGGGG - Intergenic
1132806705 16:1778345-1778367 GCAGCCCTGAGAGCTCCATGGGG + Intronic
1133143531 16:3766291-3766313 GTAGCCCTTTCAGCTGATTGTGG - Intronic
1135520415 16:23172692-23172714 GCTGCCTTGTGAGCTGGAGGGGG - Intergenic
1136425099 16:30164798-30164820 GCAGTCATGGGAGCTGGGTGTGG + Intergenic
1139608961 16:68040881-68040903 GAGGTCCTGTGAGCTGGGTGAGG - Intronic
1140641428 16:76977835-76977857 GCAGCCCTGAGGGCTGCTGGTGG - Intergenic
1141028464 16:80568821-80568843 GGAGCCATGAGAACTGGTTGTGG - Intergenic
1141834182 16:86527820-86527842 GAAGTCCTGTGAGGTGGGTGAGG - Intergenic
1142253107 16:89001830-89001852 GGAGCCCCGGGAGCTGGATGAGG - Intergenic
1142409867 16:89910515-89910537 GCAGCCCCGTGAGCCGGGTTGGG + Intronic
1142419814 16:89963311-89963333 GCCGCCCTGTGTCCTGGCTGAGG + Intronic
1142472914 17:173076-173098 GCAGTCCTGTGTGTTGGCTGGGG - Intronic
1142741039 17:1932194-1932216 GAAGGCCTGTGAGCAGGTTGGGG - Intergenic
1143184609 17:5002809-5002831 CCAGCCCCGTGAGCTGGTCATGG - Exonic
1143343649 17:6233755-6233777 GCAGCTCTCTGGGCGGGTTGTGG + Intergenic
1144290947 17:13825603-13825625 GGAGCCCTGTGAGATGTCTGTGG - Intergenic
1144622851 17:16829573-16829595 GCAACCCTGTGAGGTGGGTGTGG - Intergenic
1144760775 17:17706163-17706185 GCAGCCCTATGGGATGCTTGGGG + Intronic
1144883580 17:18443143-18443165 GCAACCCTGTGAGGTGGGTGTGG + Intergenic
1144957666 17:19027303-19027325 GGGGCCCTGTGAGCCGGGTGAGG + Intronic
1144977490 17:19147213-19147235 GGGGCCCTGTGAGCCGGGTGAGG - Intronic
1145148648 17:20501243-20501265 GCAACCCTGTGAGGTGGGTGTGG - Intergenic
1147277554 17:39331591-39331613 ACTGCCCTGTGAGCTCCTTGAGG + Intronic
1147473270 17:40684652-40684674 TCAGCCCTGTGAGCAGGCAGTGG + Intergenic
1147577175 17:41609509-41609531 GCAACCCTGTGAGGTGGGTATGG - Intergenic
1147807638 17:43143427-43143449 GCAGCCCTGTGTGCGTGCTGTGG - Intergenic
1148836479 17:50468399-50468421 GCAGCTCAGTGACCTTGTTGTGG + Exonic
1151334688 17:73432993-73433015 GGAGCCCTCTGAGCTGCCTGGGG + Intronic
1151602327 17:75113903-75113925 GCAGCCGTGGGAGCAGGTTTAGG + Intronic
1151807629 17:76416428-76416450 GCATCCCTCTGAGCTGCTTCTGG + Intronic
1152687541 17:81701944-81701966 GCCGCACTGTGAGCTGGCTGTGG + Exonic
1153422708 18:4926265-4926287 GCTGTCCTGTGCGCAGGTTGGGG - Intergenic
1154943007 18:21132877-21132899 GCCCCCCTCTGGGCTGGTTGAGG - Intergenic
1154975124 18:21450031-21450053 GTGCCCCTGTCAGCTGGTTGTGG + Intronic
1156453203 18:37278333-37278355 GCAGACATTTGAGTTGGTTGTGG - Intronic
1157296499 18:46448601-46448623 CCAGCCCTGTGAGATGGGCGAGG - Intronic
1157504815 18:48218812-48218834 GCAGCCCTGAGGGCTAGTGGTGG - Intronic
1160880408 19:1317062-1317084 CCAGCCCTCTGGGCTGGATGCGG + Intergenic
1161677648 19:5661457-5661479 TCAGCCCTGGGACCTGGCTGGGG + Intronic
1161937774 19:7382718-7382740 GCAGCCCTGTGGGTTGCTTCAGG - Intronic
1162925831 19:13930147-13930169 GCAGCAGGGTGAGCTGGTCGCGG + Exonic
1163584390 19:18156056-18156078 GCTGCCGTGTGCGCTCGTTGAGG - Exonic
1165126932 19:33604731-33604753 GGAGCCCTGTGAGCTGGAGTGGG + Intergenic
1165225647 19:34352866-34352888 GCTGCCTTGTGTGCTGGTGGGGG - Exonic
1165236814 19:34428450-34428472 GCTGCCCCGGGAGCTGGCTGAGG + Exonic
1165751946 19:38265366-38265388 CCAGGCCTGTGAGATGGTGGGGG + Intronic
1165895705 19:39139664-39139686 CCAGCCCTGAGACCTGGATGGGG - Intronic
1167499846 19:49839494-49839516 GAAGCTCTGTGACTTGGTTGTGG + Intergenic
926687107 2:15706600-15706622 GAAGGCCTGAGAGCTGGTTGTGG + Intronic
927189848 2:20510091-20510113 CCAGCCCTGAGAGCAGGGTGTGG - Intergenic
928215915 2:29361360-29361382 GCAGCTCTGTGGGATGGTTCTGG - Intronic
931216246 2:60247639-60247661 GCAGCCCTGGGAGCTGCTGTTGG + Intergenic
932332776 2:70907449-70907471 GCAGCCGTGTGAGCCGGCAGGGG - Intronic
933749644 2:85595135-85595157 ACAGTCCCATGAGCTGGTTGAGG + Intergenic
933990591 2:87631393-87631415 GGATCCCTGTGAGCAGGGTGAGG + Intergenic
934503928 2:94877622-94877644 GCAGCTCTGTGAGCTGGGTGGGG + Intergenic
934543641 2:95196526-95196548 GCAGCCGTGGCAGCTGGGTGGGG + Intergenic
934636585 2:95994718-95994740 TCTGCCCTGTGAGCTGCTTGAGG + Intergenic
934797063 2:97110708-97110730 TCTGCCCTGTGAGCTGCTTGAGG - Intergenic
934836349 2:97592721-97592743 TCTGCCCTGTGAGCTGCTTGAGG + Intergenic
935396505 2:102615312-102615334 GTAGCACTGTTAGCTGGGTGTGG + Intergenic
936303255 2:111319431-111319453 GGATCCCTGTGAGCAGGGTGAGG - Intergenic
937221241 2:120344361-120344383 GCGGCCCGGGGAGCTGGGTGAGG + Intergenic
937476549 2:122220320-122220342 TCAGACCTGTGAGATGGTGGGGG + Intergenic
938096344 2:128466669-128466691 GCAGCCGTGGAAGCTGCTTGTGG - Intergenic
944557212 2:200899402-200899424 GTGGCCCTGTGTGCTGGTTCTGG + Exonic
946132148 2:217614905-217614927 GCAGCCATATCAGCTGGCTGAGG + Intronic
946352643 2:219165334-219165356 GCAGCCCAGGGAACTGGTGGAGG + Exonic
947527938 2:230890811-230890833 GGAGCCCTGTGGACTGGGTGGGG - Intergenic
947933430 2:233983275-233983297 GCAGCCCTGGGGGTTGGTTCAGG - Intronic
948291986 2:236832384-236832406 GCAGGCCTGGGAGCAGGTGGGGG + Intergenic
948487801 2:238291756-238291778 TCACCTCTGTGAGCTGGCTGAGG - Intergenic
948826373 2:240575191-240575213 GCAGCCCTGTGAGCCGGGGAGGG - Intronic
948987321 2:241533378-241533400 TCAGGCCTGGGAGCTGGGTGAGG + Intergenic
1169898267 20:10527207-10527229 GCAGAACTGTGAGCTCTTTGAGG - Intronic
1171484322 20:25476542-25476564 GCAGCCCTGTGGAGTGGATGGGG - Exonic
1173611456 20:44371134-44371156 TCAGCGCTGGGAGCAGGTTGTGG + Intronic
1173810873 20:45954320-45954342 GCAGCGCTGTTAGCATGTTGAGG - Intronic
1174142531 20:48425877-48425899 GGAGCCCCGGAAGCTGGTTGTGG - Intergenic
1175492464 20:59388503-59388525 GCAGCTCTCTGAGCAGGTAGGGG - Intergenic
1175669242 20:60887700-60887722 GGAGCCCTGTCAGCTGCTGGTGG + Intergenic
1176622095 21:9067539-9067561 GCAACTCTGTGAGCTGGGTGGGG - Intergenic
1176822221 21:13667503-13667525 GTGGCTCTGTGAGCTGTTTGAGG - Intergenic
1177228849 21:18293044-18293066 GCAAACCTGAGAGCTAGTTGAGG + Intronic
1179551375 21:42146082-42146104 GCAGCCCTAGGAGCTGGTGCTGG + Intergenic
1183231178 22:36583107-36583129 GCAGAGGTGTGAGCTGGATGGGG - Intronic
1183290712 22:37000109-37000131 CCAGCCCTGTGAATAGGTTGAGG - Intronic
1183604118 22:38858813-38858835 GCAGACCTGTTAGCTGGCTTGGG + Intergenic
1183705000 22:39470713-39470735 CCAGTCCTCTGAGCTGGGTGCGG - Intronic
1185060437 22:48603660-48603682 GCACCTCTGTGGGCTGGTTGGGG - Intronic
949418960 3:3844992-3845014 GCAGCGTTGTGAGCTGGGTTAGG - Exonic
950260283 3:11538243-11538265 GCTGACCTGTCAGCTGGTTCAGG + Intronic
950708166 3:14796617-14796639 CCACCCCTGTCAGCTGGCTGGGG - Intergenic
952791540 3:37204498-37204520 GCAGCAGAGTGAGCTGGTGGTGG + Intergenic
952919779 3:38276475-38276497 CCAGCCCTGTCAGCTATTTGTGG - Intronic
953036514 3:39216367-39216389 GCAGCACTCTGAGCTACTTGAGG - Intergenic
953376033 3:42429344-42429366 CCAGCCCTTTGAGATGGCTGGGG - Intergenic
954105313 3:48406698-48406720 GCAGCCCTGTGAGCTGGTTGGGG - Intronic
954431278 3:50472125-50472147 TCAGCCCTGAGTGGTGGTTGGGG - Intronic
954446520 3:50549793-50549815 GCAGCCCTGTGGGCAGCTGGGGG - Intergenic
956989885 3:74751234-74751256 GCAGCCATGTAAGCTGCTTGTGG - Intergenic
958752748 3:98211867-98211889 GAAGCCCTGTGAGCTTGGTGTGG - Intergenic
961591928 3:127987765-127987787 GCAGGGCTGTGAGATGGCTGGGG + Intergenic
962343110 3:134601758-134601780 GCACCCTTGTGAGCTGGTTCTGG + Intronic
964269522 3:154940165-154940187 AGAGCCCTGTGAGCTGCTTCTGG + Intergenic
965532817 3:169791652-169791674 GCAGCCCTGGGAGATGGTATAGG + Intergenic
968190023 3:196660795-196660817 GCAGCTCCGACAGCTGGTTGTGG - Exonic
968841484 4:3009736-3009758 GCAGCGCTGCTAGCTGGGTGGGG + Intronic
969517743 4:7656944-7656966 GCAGGCCAGTGAGCTGGCCGGGG - Intronic
969871820 4:10109505-10109527 GCAGCTCCTTGAGCTGGCTGAGG + Intronic
978429690 4:108620689-108620711 GCAGTCCTTTGAGCTGGTGTAGG + Exonic
978679337 4:111359889-111359911 GAATCGCTGTGAGCTGGCTGTGG + Intergenic
978838586 4:113183120-113183142 GCCGTGCTGGGAGCTGGTTGTGG + Intronic
979878305 4:125922283-125922305 GCAGTCCTGAGAGCTGCTCGTGG + Intergenic
981514938 4:145597268-145597290 GCAGCCCACTGAGCAGGGTGGGG - Intergenic
986722865 5:10572459-10572481 GGAGCCCTGTGATGTGGATGTGG + Intronic
987335971 5:16898125-16898147 GGGGCCCTGTGAGCTGCTTGTGG - Intronic
989645762 5:43631025-43631047 TCAGATCTGTGAGCTTGTTGGGG + Intronic
989709980 5:44387294-44387316 GCAGGGGTGTGGGCTGGTTGGGG - Intronic
989943553 5:50186697-50186719 GGAGCCCTTTGAGCTTATTGTGG - Intergenic
990280968 5:54250353-54250375 GAAGCCCTGTGATATGGTTTGGG - Intronic
990988869 5:61665875-61665897 GCTGTCCTGTGGGCTGGGTGGGG - Intronic
991915065 5:71597461-71597483 GAAGCCCTGTGACCAGGTAGAGG + Intronic
991979917 5:72220108-72220130 GCTGCACTGTGAGCTGGCTGTGG - Intronic
995347199 5:111134465-111134487 ACAGCGCTGTGAGCTGGGTGGGG - Intergenic
996746644 5:126851913-126851935 GCAGCCCTGTGAGCTGGGGAAGG - Intergenic
997868318 5:137484264-137484286 AGAGCCCTTTGAACTGGTTGTGG - Intronic
998144106 5:139716528-139716550 ACAGCCCTGGGAGATGGTTCTGG - Intergenic
999291897 5:150431213-150431235 GCAGGCTTGTGAACTGCTTGAGG + Intergenic
1001922852 5:175614024-175614046 GGAGCCCTTTGGGCTGGCTGAGG + Intergenic
1002211802 5:177603925-177603947 GCAGCTCTGTGAACTGGGAGTGG + Intronic
1002522312 5:179798602-179798624 GCAGGCCTGTGAGCTGCTGCAGG + Intronic
1002568994 5:180129445-180129467 GGAGCCCTGTGCTCTGGTGGCGG - Intronic
1002940427 6:1710838-1710860 GCACCCCTGTGAGTTTGTGGAGG + Intronic
1003256154 6:4476708-4476730 GGAGCCCTGAGGGCTGGTAGTGG - Intergenic
1004704391 6:18110438-18110460 GCAGAGCTGTGAGCTGCATGGGG - Intergenic
1004741355 6:18464260-18464282 ACATCCCTTTGAGCTAGTTGAGG + Intronic
1007102649 6:39260666-39260688 ACAACCCTGTAAGCTGCTTGTGG - Intergenic
1010516975 6:76785256-76785278 GCAGCCATGTCAGCTGGTTGTGG - Intergenic
1014543261 6:122701243-122701265 GCAGCCCTGTGTGAGGTTTGTGG - Intronic
1015926898 6:138319830-138319852 TCTGTCCTGTGAGCTGGTGGTGG + Exonic
1016989337 6:149918559-149918581 GCAGCTCTGTGAGCTCCCTGAGG - Intronic
1017642779 6:156510357-156510379 GCATCCCTGTGAGATGCTTGTGG + Intergenic
1018065853 6:160124781-160124803 GCAGCCATGTGGGCAGGTAGAGG + Intronic
1018904104 6:168065135-168065157 ACAGCCCTGGGAGCTGGTGTGGG - Intronic
1019344849 7:524460-524482 GCAACCCTCTGAGCTGGCTGTGG - Intergenic
1019565451 7:1676602-1676624 GCAGCCCTGGAACCTGGATGGGG + Intergenic
1019684720 7:2374845-2374867 GCAGACCTGTCTGCGGGTTGTGG + Intronic
1020242877 7:6409322-6409344 GCAGCCCTGGGCTCTGGCTGGGG - Exonic
1022829116 7:34047057-34047079 GCAGCCCAGCGAGTGGGTTGTGG + Intronic
1022943208 7:35258428-35258450 GCTGTCCTGTGAGCAGGCTGCGG - Intergenic
1022973897 7:35539734-35539756 AGAGCCCTGTGAGGGGGTTGGGG + Intergenic
1023872804 7:44271928-44271950 GCAGGCCTGTGAGCTGCTCATGG + Intronic
1023878451 7:44305606-44305628 GCACCCCTGTGAGGTGGGGGAGG + Intronic
1024909787 7:54433589-54433611 GCAGGCCTGGGAGCAGGCTGGGG + Intergenic
1026846709 7:73702789-73702811 GCAGCCCTGGGTGCTGGTGTGGG + Intronic
1029124546 7:98287365-98287387 CCAGCCCTGTGCTCTGGCTGAGG + Intronic
1032555286 7:132826604-132826626 GCAGGCATGTGAGCAAGTTGGGG + Intronic
1033227822 7:139575021-139575043 GCAGCCCTGTGAGGTGGGTGAGG + Intronic
1033577943 7:142704170-142704192 GTAGCCCTGAGGGCTGCTTGTGG - Intergenic
1035044505 7:155954793-155954815 GCAGCCCTGTCAGGAGGTGGAGG - Intergenic
1037813582 8:22100536-22100558 GCACCCCTGGGAGCTGGGTGGGG + Intronic
1037965047 8:23127746-23127768 GCAGTCCTGAGATCTGGGTGGGG + Intergenic
1038152825 8:24957669-24957691 CCAGCCCTGAGCGCTGGGTGTGG + Intergenic
1038229638 8:25688336-25688358 GCAGCCCTGGGAGGTGGAAGAGG - Intergenic
1040523611 8:48198735-48198757 GCAGCCCTGTGTGGGGCTTGGGG + Intergenic
1041373637 8:57190742-57190764 GCAAGCGTGTGAGCTGGTGGGGG + Intergenic
1043398068 8:79857868-79857890 GCAGCCCCCTGACCTGGTGGAGG + Intergenic
1043784708 8:84384221-84384243 ACAACCCTGTGAGCTGGGTAGGG - Intronic
1044599055 8:93985552-93985574 ACAGCCCTGTGGGCCGGTAGTGG + Intergenic
1045966428 8:108030213-108030235 GCAGCTGGATGAGCTGGTTGAGG + Intronic
1046110608 8:109719107-109719129 GCAGCCCTTCAAGCTGATTGTGG + Intergenic
1047327212 8:123851386-123851408 GCAAACCTTTCAGCTGGTTGAGG + Intergenic
1047754397 8:127907535-127907557 GCAGCTCTGTGGGCTGGCTGGGG + Intergenic
1048302646 8:133262750-133262772 GCAGCCATGTGATCTGTTTCTGG + Intronic
1048329412 8:133461843-133461865 GCAGCCCTGTGGGCAGGGGGAGG + Intronic
1049432675 8:142572477-142572499 TCAGCCTTGTGAGCTGGTGGTGG - Intergenic
1049507624 8:143012058-143012080 GCTGCCCAGTGAGCTGCATGGGG + Intergenic
1049617176 8:143580766-143580788 GCAGCTCTGGGCCCTGGTTGGGG - Intronic
1049655642 8:143795736-143795758 GCAGCCCTGTGAGCTGTGATGGG - Intronic
1049682556 8:143926194-143926216 GCAGGGCTGTGTGCTGGGTGTGG - Intronic
1049961310 9:740970-740992 GCAGTCCTGTCTGCTGGTTACGG - Intronic
1056817679 9:89813232-89813254 GGATCTCTGTGAGCTGGATGAGG - Intergenic
1057019877 9:91688946-91688968 TCAGTCCTGTGGGCTGGTTTGGG + Intronic
1060941261 9:127544363-127544385 GCAACCTTGTGAGGTGGTGGTGG - Intronic
1061806117 9:133138545-133138567 ACAACCCTGTGAGCTGGGTCCGG + Intronic
1061892741 9:133631302-133631324 GCAGCCCTGAGTGCTGGTGCAGG + Intergenic
1062062067 9:134502156-134502178 GCAGTCCTGGGGGCAGGTTGGGG - Intergenic
1062234929 9:135503208-135503230 GCTGCCCTGTGAGCTGCACGGGG + Intronic
1062264614 9:135681314-135681336 GGGGCCCTGAGAGCTGGTGGAGG + Intergenic
1203745291 Un_GL000218v1:37961-37983 GCAGCTCTGTGAGCTGGGTGGGG - Intergenic
1203564818 Un_KI270744v1:81523-81545 GCAGCTCTGTGAGCTGGGTGGGG + Intergenic
1189292337 X:39895222-39895244 GGAGGTCTGTTAGCTGGTTGGGG + Intergenic
1190061961 X:47217529-47217551 GCAGCCCTTTGAGCTGGACTTGG + Intergenic
1193554269 X:82933373-82933395 GCAGCCATGGAAGCTGCTTGAGG + Intergenic
1196196340 X:112841382-112841404 GCAGAGCTGTGACCTGGGTGGGG - Intergenic
1197235197 X:124054299-124054321 GCAGCTCAGTGAGATGGTAGTGG + Intronic
1197274804 X:124465734-124465756 GCAGACTGGAGAGCTGGTTGGGG - Intronic
1197353502 X:125405203-125405225 GCAGGCATTTGGGCTGGTTGTGG + Intergenic
1197750278 X:129959325-129959347 GCAGCCATGTGTGCAGGTTCAGG - Intergenic
1197863810 X:130997317-130997339 GCAGTCATGAGAGCAGGTTGTGG + Intergenic
1199799234 X:151232969-151232991 GGAGCCCTGTGAGGTAGGTGGGG - Intergenic
1200755678 Y:6987898-6987920 GCAGCCCTGTGTGTGTGTTGGGG + Intronic
1201158612 Y:11152980-11153002 GCAGCTCTGTGAGCTGGGTGGGG - Intergenic