ID: 954105322

View in Genome Browser
Species Human (GRCh38)
Location 3:48406728-48406750
Sequence CCCAAGGGCTTCCCTGCAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 161}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954105314_954105322 6 Left 954105314 3:48406699-48406721 CCCAACCAGCTCACAGGGCTGCT 0: 1
1: 0
2: 1
3: 27
4: 249
Right 954105322 3:48406728-48406750 CCCAAGGGCTTCCCTGCAAAGGG 0: 1
1: 0
2: 1
3: 22
4: 161
954105315_954105322 5 Left 954105315 3:48406700-48406722 CCAACCAGCTCACAGGGCTGCTG 0: 1
1: 0
2: 7
3: 42
4: 334
Right 954105322 3:48406728-48406750 CCCAAGGGCTTCCCTGCAAAGGG 0: 1
1: 0
2: 1
3: 22
4: 161
954105311_954105322 11 Left 954105311 3:48406694-48406716 CCTGCCCCAACCAGCTCACAGGG 0: 1
1: 0
2: 4
3: 40
4: 388
Right 954105322 3:48406728-48406750 CCCAAGGGCTTCCCTGCAAAGGG 0: 1
1: 0
2: 1
3: 22
4: 161
954105313_954105322 7 Left 954105313 3:48406698-48406720 CCCCAACCAGCTCACAGGGCTGC 0: 1
1: 0
2: 6
3: 35
4: 262
Right 954105322 3:48406728-48406750 CCCAAGGGCTTCCCTGCAAAGGG 0: 1
1: 0
2: 1
3: 22
4: 161
954105317_954105322 1 Left 954105317 3:48406704-48406726 CCAGCTCACAGGGCTGCTGAGGT 0: 1
1: 0
2: 5
3: 65
4: 690
Right 954105322 3:48406728-48406750 CCCAAGGGCTTCCCTGCAAAGGG 0: 1
1: 0
2: 1
3: 22
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954105322 Original CRISPR CCCAAGGGCTTCCCTGCAAA GGG Intronic