ID: 954105322

View in Genome Browser
Species Human (GRCh38)
Location 3:48406728-48406750
Sequence CCCAAGGGCTTCCCTGCAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 161}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954105317_954105322 1 Left 954105317 3:48406704-48406726 CCAGCTCACAGGGCTGCTGAGGT 0: 1
1: 0
2: 5
3: 65
4: 690
Right 954105322 3:48406728-48406750 CCCAAGGGCTTCCCTGCAAAGGG 0: 1
1: 0
2: 1
3: 22
4: 161
954105314_954105322 6 Left 954105314 3:48406699-48406721 CCCAACCAGCTCACAGGGCTGCT 0: 1
1: 0
2: 1
3: 27
4: 249
Right 954105322 3:48406728-48406750 CCCAAGGGCTTCCCTGCAAAGGG 0: 1
1: 0
2: 1
3: 22
4: 161
954105315_954105322 5 Left 954105315 3:48406700-48406722 CCAACCAGCTCACAGGGCTGCTG 0: 1
1: 0
2: 7
3: 42
4: 334
Right 954105322 3:48406728-48406750 CCCAAGGGCTTCCCTGCAAAGGG 0: 1
1: 0
2: 1
3: 22
4: 161
954105311_954105322 11 Left 954105311 3:48406694-48406716 CCTGCCCCAACCAGCTCACAGGG 0: 1
1: 0
2: 4
3: 40
4: 388
Right 954105322 3:48406728-48406750 CCCAAGGGCTTCCCTGCAAAGGG 0: 1
1: 0
2: 1
3: 22
4: 161
954105313_954105322 7 Left 954105313 3:48406698-48406720 CCCCAACCAGCTCACAGGGCTGC 0: 1
1: 0
2: 6
3: 35
4: 262
Right 954105322 3:48406728-48406750 CCCAAGGGCTTCCCTGCAAAGGG 0: 1
1: 0
2: 1
3: 22
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954105322 Original CRISPR CCCAAGGGCTTCCCTGCAAA GGG Intronic
901208487 1:7510966-7510988 CCCAGGAGCCTCCCTGGAAAAGG - Intronic
902065591 1:13683228-13683250 CAGAAGGGCTTCCCTGGAAATGG + Intergenic
903378786 1:22883010-22883032 CCCAGGGGCTTCCACCCAAAGGG - Intronic
904457967 1:30658557-30658579 CCCAAGCGCTTTCCTGCCACAGG - Intergenic
904786564 1:32987432-32987454 CCCAGTGGCTTCTCTGCACAGGG - Intergenic
905671286 1:39791906-39791928 TCTGAGGGCTTTCCTGCAAAAGG + Intergenic
907679188 1:56547743-56547765 CCCAAGAGGATCCCAGCAAATGG - Intronic
916099618 1:161383024-161383046 TCTAACGGCTTCCCTGCTAAGGG - Intergenic
916102206 1:161402268-161402290 TCTAAGGGCTTCCCGGCTAACGG + Intergenic
919785513 1:201255559-201255581 CCCACGGGCTCCCCTGCCAAGGG - Intergenic
1062971583 10:1653063-1653085 ACTTAGAGCTTCCCTGCAAAAGG + Intronic
1069726384 10:70582986-70583008 ACCCAGGGCTTCCCTCCCAAGGG - Intergenic
1069957568 10:72061368-72061390 CCCTAGGGCTGCCCCGCAGAGGG - Exonic
1070421455 10:76241670-76241692 CCCAAGGGCTCCTCTGCTACAGG - Intronic
1071843195 10:89494445-89494467 CCCAACTGATTCCCTGCTAATGG - Intronic
1071920570 10:90345418-90345440 CCCAAGGGTTAACATGCAAATGG + Intergenic
1072001464 10:91199539-91199561 CCCAAAGGCTTCTCTGAAGAGGG + Intronic
1075602554 10:123781129-123781151 CCCACTGGCTTAGCTGCAAAGGG - Intronic
1076165087 10:128275390-128275412 CCACAAGGCTTCCCCGCAAAAGG + Intergenic
1077234613 11:1473928-1473950 CCCAGGGGCCTCCGTGCAAGAGG - Intronic
1077305644 11:1867619-1867641 CCCAAGGGGTCCCCGGGAAAGGG - Intronic
1078870831 11:15343059-15343081 TTAAAGGGCTTCCCTGCTAAAGG - Intergenic
1079183986 11:18220414-18220436 CCCAAGGTCATGCCTGCCAAGGG + Intronic
1081858127 11:46316686-46316708 CCCAAGCCCTTCCCTGCACAAGG - Intronic
1083174955 11:60943769-60943791 GCCAGGGGCTTCCCCGCAAGAGG - Exonic
1084192967 11:67507191-67507213 CCCATGCTCTTCCCTGGAAATGG + Intronic
1091647254 12:2283316-2283338 CCCAAAGTCTCCCCTGAAAAAGG - Intronic
1092453217 12:8622813-8622835 CCCAATAGCTTCCCTGACAAGGG + Intergenic
1093985580 12:25528735-25528757 CCAGAGGGCTTCACTGCAGATGG - Intronic
1096424269 12:51487839-51487861 CCCAAGAGATTCCATGCAGATGG + Intronic
1096502516 12:52073565-52073587 CCCAAGGGCCACCCTGCAAAAGG - Exonic
1096826975 12:54286943-54286965 CACAAGGACGTTCCTGCAAAAGG - Intronic
1100113198 12:91270661-91270683 TCAAAGGGCTTCCTTGGAAAGGG + Intergenic
1101974001 12:109338913-109338935 CCCTATTGCTTCCCAGCAAAAGG - Intergenic
1103457726 12:121079744-121079766 CCCCAGGTCTCCTCTGCAAATGG + Intergenic
1103586727 12:121961710-121961732 CCTCAGAACTTCCCTGCAAAGGG - Intronic
1104370530 12:128220210-128220232 ACCAAGGGCATACCTGGAAAAGG + Intergenic
1104730436 12:131102707-131102729 CCCGTGGGCTTCCCTGCAGCAGG - Intronic
1113924269 13:113931485-113931507 CCCGAGGGCCTCCCCGCCAAGGG - Intergenic
1115416898 14:33145841-33145863 CCCAAGGGTTTCCATGGAACTGG + Intronic
1117800198 14:59435375-59435397 ACAAAGGGCTTCACAGCAAATGG + Intronic
1120000024 14:79292318-79292340 CCAATGGGCTTCCCTGTCAAAGG - Intronic
1120174108 14:81275466-81275488 TCCAAGGGCTTCCGTGTCAAAGG + Intronic
1121720420 14:96105100-96105122 CCTAAGGGCTTCCCTGGACACGG - Intergenic
1122020823 14:98836500-98836522 CCCAAGGGCTGACCTTAAAATGG - Intergenic
1122955383 14:105067972-105067994 CCCAAGGGCTACCTTGCATGTGG + Intergenic
1123833831 15:24168299-24168321 CCCATGGCCATCCCTGTAAACGG + Intergenic
1126058977 15:44760181-44760203 CCCAGGGGCTTCTCTGAAGAAGG + Intronic
1128360024 15:66955574-66955596 ACCAAGGGATTCCATGCAAGAGG - Intergenic
1130905910 15:88240844-88240866 CCAACGGGCTGCCCTGCTAAGGG + Intronic
1131165902 15:90142020-90142042 ACCAAGGGCTTCCCTGGACAAGG + Intergenic
1132244697 15:100285594-100285616 CCCCAGGTCTTCCTTGGAAATGG - Intronic
1133116813 16:3582268-3582290 TCCCAGGTCCTCCCTGCAAATGG + Exonic
1133298237 16:4766096-4766118 CCCCAGGGCTGCCCTTCAGATGG - Intronic
1133367945 16:5225906-5225928 CCCAAGGATTCCCCAGCAAAGGG - Intergenic
1137644129 16:50059509-50059531 CCCAAGGAAGTCACTGCAAAGGG - Intergenic
1137734051 16:50711241-50711263 CTCAAGGGCTTCTCTGAACAGGG + Exonic
1138207178 16:55133649-55133671 CCCAAGGCCTGCCCTGAAAACGG + Intergenic
1138413187 16:56855517-56855539 CACAGGGGCTTCCCTCCAATGGG - Intergenic
1139289379 16:65843703-65843725 CCCAAAGCCTTCCCTGGAAAGGG - Intergenic
1140911920 16:79461998-79462020 TCCAGGAGTTTCCCTGCAAATGG + Intergenic
1142115506 16:88354172-88354194 CCCAAGGGGTTCCCTTCTACGGG + Intergenic
1144872098 17:18377928-18377950 CCCAAGGACTCCCCAGCCAAGGG + Exonic
1146064708 17:29625070-29625092 CCCAAGCGCTTCCCTCTAGAAGG - Intergenic
1146648905 17:34594135-34594157 CTCAAGGGCTTCCATTCCAATGG - Intronic
1146886953 17:36477524-36477546 CACAAAGTCTTCTCTGCAAAAGG - Intergenic
1148245033 17:46024903-46024925 CCCACAGGCTGCCCTGCAGAGGG - Exonic
1148582767 17:48754969-48754991 CCAAAGGGCTTCGCTCCAGAGGG - Intergenic
1149417953 17:56479946-56479968 CCCAAAGGCTGCTCTTCAAAAGG - Intronic
1151416409 17:73968848-73968870 CACAAGGGCTTCCTTGAAACTGG + Intergenic
1151749190 17:76027134-76027156 CCCAAGGGCTCCCCCGCCAAGGG - Exonic
1152299038 17:79484780-79484802 CCCATGGACTTCCCTGCCCAGGG - Intronic
1152422738 17:80202879-80202901 CCGAGGGGCTTCCCTGCAAGTGG - Intronic
1157879545 18:51307226-51307248 GCAAAGGTCTTCCATGCAAATGG + Intergenic
1158182236 18:54729347-54729369 ACCAAGAGCTTTCCTGAAAAAGG + Intronic
1158312185 18:56170850-56170872 CACAGGGGCTTCTGTGCAAAGGG - Intergenic
1160917379 19:1503683-1503705 CCCAGGGGCTCCCCAGCCAAGGG - Intergenic
1163141820 19:15354882-15354904 CCCAACGCCTTCCCTGGAACAGG + Exonic
1163493040 19:17628058-17628080 CCCATGGGGTCACCTGCAAATGG + Intronic
1165060164 19:33201259-33201281 CCGGAGGGCTTCCCTGGGAAGGG + Intronic
1165146999 19:33737201-33737223 CCTAAGGGCTTCTCTGCGTATGG + Intronic
926216217 2:10907171-10907193 TGCAAGGGCTACCCTGGAAAAGG - Intergenic
926664633 2:15507730-15507752 CTCAAGGGATTCGCTGCATATGG - Intronic
926725932 2:15997994-15998016 GCCCAGGGCTTCTCAGCAAAGGG - Intergenic
927015896 2:18961412-18961434 TGCAAGGCCTTGCCTGCAAAAGG + Intergenic
927503847 2:23600554-23600576 CTCCCGGGCTTTCCTGCAAAGGG + Intronic
928277699 2:29918000-29918022 TCCAAGGGCTTCTCTGCTATTGG - Intronic
930007887 2:46912613-46912635 CCCAAGTGCTTCCCTTCAGAAGG + Exonic
930030689 2:47056493-47056515 GGCAAGGCCCTCCCTGCAAAGGG + Intronic
935672572 2:105568364-105568386 CTCAAAGACTTCTCTGCAAATGG - Intergenic
937428430 2:121818359-121818381 ACCCAGGGCTGACCTGCAAAGGG - Intergenic
938695657 2:133833169-133833191 CCCACTGGCTACCCTGCACATGG - Intergenic
940722743 2:157299415-157299437 TCCCAGGGCTTCCCTGCATCAGG + Intronic
943890107 2:193276331-193276353 TCCAAGGGATTCCCGGCAATTGG - Intergenic
944581323 2:201135291-201135313 TCTAAGGGCTTCTCTGAAAAAGG - Intronic
948135691 2:235634411-235634433 CCCAAGGGCATCCCTGAGATGGG + Intronic
1171150038 20:22819835-22819857 CCCAGGGTCTTCCTTGCAACAGG + Intergenic
1171462562 20:25307161-25307183 GGCAGGGGCTGCCCTGCAAATGG + Intronic
1172061732 20:32191073-32191095 CCCAAAGGCTACCCTTCCAAAGG + Intergenic
1174039292 20:47687563-47687585 CCTCAGAGCTTCCCTTCAAAGGG - Intronic
1174558415 20:51412828-51412850 CTCATGGGTCTCCCTGCAAAAGG + Intronic
1175905617 20:62378026-62378048 TCCTAAGGCTGCCCTGCAAAGGG - Intergenic
1175982414 20:62745765-62745787 CCCCAGGGCTTCCCTGCTGTTGG + Intronic
1176059583 20:63166626-63166648 CCCAAGGGCTCCCCAGCTTATGG + Intergenic
1176135587 20:63520799-63520821 CCCGCGGTCTTCTCTGCAAATGG + Exonic
1178617026 21:34143517-34143539 CCCAGGGGGTGCCCTGCACAAGG + Intergenic
1179821637 21:43940443-43940465 CCCAGGAGTTCCCCTGCAAAGGG - Intronic
1182411140 22:30187733-30187755 CCAAAGAGCTGCCCTGAAAATGG + Intergenic
1184829770 22:46977179-46977201 CTCTAGAACTTCCCTGCAAATGG - Intronic
1185119455 22:48957395-48957417 ACCAAGGCCTTCTCTGCCAAGGG - Intergenic
1185214966 22:49593543-49593565 CCCAAGGGCACCCCTTCAAGTGG + Intronic
953711355 3:45273731-45273753 CCAAAGGGCTTCCCTGCAGTTGG - Intergenic
954105322 3:48406728-48406750 CCCAAGGGCTTCCCTGCAAAGGG + Intronic
954351447 3:50047542-50047564 CCCAAAGGCTTACTTGCCAATGG + Intronic
954542572 3:51404152-51404174 CCCAACTGTTTCCCTTCAAAAGG + Intronic
955358291 3:58250220-58250242 CCCCAGTGCTTTCCTGAAAAGGG + Intronic
960277416 3:115743842-115743864 ACCAAGGACTGCCCTGGAAAGGG + Intergenic
960741270 3:120836125-120836147 CCTGTGGGCTTCCCTTCAAAAGG - Intergenic
966182057 3:177197108-177197130 CCCCAGCGCTTACCTGGAAACGG + Intronic
968725659 4:2246704-2246726 CCAAGGGGGTTCCCTCCAAAAGG + Intergenic
971090823 4:23343237-23343259 TCCAAGAACTTCCCTGCAGATGG - Intergenic
973126088 4:46586726-46586748 CCCCAGGGTGTCCCTGCATAGGG + Intergenic
978536598 4:109769740-109769762 CCCAAGAGGCTCCCTGCCAAAGG - Intronic
979805598 4:124966774-124966796 CACAATAGCCTCCCTGCAAACGG + Intergenic
984510566 4:180673641-180673663 CTCAAGGGCTATCCTGCCAAGGG + Intergenic
986485226 5:8229415-8229437 CCCAACAGCATCACTGCAAAGGG + Intergenic
986874477 5:12091414-12091436 CCCAAGGGCTTGTCTAGAAAAGG + Intergenic
990156914 5:52888078-52888100 TCCCAGGGCTTACCTTCAAATGG - Intronic
992747068 5:79830350-79830372 CCCTGGGGCTTTCCTTCAAAGGG + Intergenic
997481887 5:134191789-134191811 CTCAAGACCTTCACTGCAAAGGG + Intronic
1001746663 5:174097993-174098015 CCCGAGGCCTTCCCAGCAGAAGG + Intronic
1002989941 6:2229074-2229096 CCCCAGGGCTTCACTGCAGATGG + Intronic
1007387761 6:41531067-41531089 CCCAAGAGCCTCCCTGCACTGGG + Intergenic
1007949018 6:45853080-45853102 CCCAAGGCCCTCCCAGCAAGGGG + Intergenic
1009295409 6:61940963-61940985 CCTAACTGCTTCCCTGCAAATGG - Intronic
1014258281 6:119186203-119186225 CCCAAGGACTTTCCAGCAAAGGG - Intronic
1016256975 6:142119040-142119062 GCCAAGGGCAGCCCTGCAAATGG + Intergenic
1018221521 6:161585113-161585135 CCCAAGTGCCTCCCTAGAAAAGG - Intronic
1019778300 7:2925301-2925323 AACAAAGGCTTCTCTGCAAATGG + Intronic
1020828015 7:13056227-13056249 ACCAAGAGTTTCCCAGCAAATGG + Intergenic
1020970605 7:14932810-14932832 CCAAAGGGCTTCCAGGCAACTGG + Intronic
1022328135 7:29351839-29351861 TCCAAGGTCTTCCCTGCACATGG - Intronic
1023170589 7:37386813-37386835 CCCAAGCCCTTCCCTGCACACGG + Intronic
1024101462 7:46036760-46036782 CCCCTTGGCTTCCCTGCTAAAGG + Intergenic
1029156513 7:98521327-98521349 CCCATCGTCTTCCCTGCAGAGGG + Intergenic
1031798690 7:126213771-126213793 CACAAGGGTTTCTCTGCTAATGG - Intergenic
1033412294 7:141129111-141129133 CTCAAGGGCATCCCTGAAATGGG - Intronic
1033505648 7:141997152-141997174 CCCATGGGTCTCCCTGAAAAAGG + Intronic
1034655736 7:152728409-152728431 CCCATGTGTTTCACTGCAAAAGG + Intergenic
1034974389 7:155439433-155439455 CCCAAGGGACTCCCTGCATGAGG - Intergenic
1039438451 8:37577995-37578017 CCCAAGGGCTTCCTGGCCAGTGG + Intergenic
1039967627 8:42294737-42294759 CCCAAGGGATCCCCTGCACATGG + Intronic
1041480678 8:58316544-58316566 CCAAAGGGCTGCCCTGAAAATGG - Intergenic
1042285551 8:67105954-67105976 CCAAAGAGCATCCCTGCAAAAGG - Exonic
1044907866 8:97024281-97024303 CACTAGGGCTTCCCTCCAGAAGG + Intronic
1045010967 8:97958024-97958046 CTAAAAGGCTTCCCTGCACAGGG - Intronic
1045267702 8:100634340-100634362 CTCAAGGGCTTTCCTGTAAGTGG + Intronic
1045865964 8:106865899-106865921 CCCAAGGTCCTCCCAGCAAGTGG - Intergenic
1046412106 8:113859197-113859219 CCCAGGGTCTTGCCTGCACATGG + Intergenic
1048596349 8:135870866-135870888 CCCAAGGGATTTCCTTCAAGAGG + Intergenic
1049349968 8:142159214-142159236 CACACTTGCTTCCCTGCAAATGG + Intergenic
1049350226 8:142160440-142160462 CACACTTGCTTCCCTGCAAATGG - Intergenic
1049851979 8:144837521-144837543 CCCCAGGGCTTCTCTGCGATGGG - Intronic
1050284669 9:4088890-4088912 CCAAAGGGCTTCACCCCAAAAGG + Intronic
1050717275 9:8544095-8544117 CCCAATAGGTTCCCAGCAAATGG - Intronic
1050759160 9:9044921-9044943 CCTAAGTGCTTCTCAGCAAATGG - Intronic
1051247614 9:15127312-15127334 GCGAAGGGATTCACTGCAAAGGG + Intergenic
1051527672 9:18065096-18065118 TCCAAGGGCTTCTCTGCAGCTGG + Intergenic
1052174295 9:25438912-25438934 ACCACTGGCTTCCTTGCAAACGG - Intergenic
1052997759 9:34560050-34560072 CCCAAGCCCTTCCCTGCTCAGGG - Intronic
1055767192 9:79676202-79676224 CCCAAGGCCTTTCTGGCAAAGGG + Intronic
1056272660 9:84961885-84961907 GCCTAGGGCCTCCTTGCAAATGG - Intronic
1056932396 9:90889892-90889914 CCCAAGGGCTGCCCTCCCCAGGG - Intronic
1057424992 9:94941155-94941177 CCCAAGGGTTGCCCTTCAGAGGG - Intronic
1057468512 9:95337599-95337621 CAGACAGGCTTCCCTGCAAAAGG + Intergenic
1057863134 9:98657915-98657937 CCCGAGGCCTTCCCAGCAATGGG + Intronic
1058755392 9:108078611-108078633 CCAAAGGGCTTCCTAGGAAAGGG + Intergenic
1058813367 9:108662112-108662134 CACAAGGTCTTCCACGCAAAGGG + Intergenic
1059413469 9:114148949-114148971 TCCAAGGACATCCCTGCAACAGG - Intergenic
1060113765 9:120925446-120925468 CCAAAAGGGTTCCCAGCAAACGG + Intronic
1061374304 9:130215001-130215023 CCCAAAGGCCTCCCTGCAGATGG - Intronic
1061378957 9:130242877-130242899 CCCAGGGGCCTCCCTGGACAAGG + Intergenic
1061578415 9:131522265-131522287 CGCATGGGCTTCCCAGCAGAGGG - Intronic
1189646463 X:43138178-43138200 TCCAAGGTCTTCCCTCCAAATGG + Intergenic
1200498910 Y:3920522-3920544 CCCAAGGGATTCCCTCCTAGTGG - Intergenic