ID: 954106234

View in Genome Browser
Species Human (GRCh38)
Location 3:48411181-48411203
Sequence CTGCTGTCCCTGGGGAAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 635
Summary {0: 1, 1: 0, 2: 5, 3: 77, 4: 552}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954106234 Original CRISPR CTGCTGTCCCTGGGGAAGGC AGG (reversed) Intronic
900013465 1:134411-134433 CAGCTGTGCCGGGGGAAAGCTGG + Intergenic
900043533 1:490394-490416 CAGCTGTGCCGGGGGAAAGCTGG + Intergenic
900064971 1:725397-725419 CAGCTGTGCCGGGGGAAAGCTGG + Intergenic
900154612 1:1198935-1198957 CTGCTGTCCCTGTGGAGCGCAGG - Intergenic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
900397877 1:2460668-2460690 CTGATGACCCTGGTGGAGGCTGG + Intronic
900429894 1:2596506-2596528 TCGGTGTCCCTGTGGAAGGCTGG + Intronic
900469613 1:2847283-2847305 CTGCTGGCCTTGGGGGAGGCGGG - Intergenic
900595411 1:3478077-3478099 CCGCTGGCCCTGGGGCAGGAGGG + Intronic
900996372 1:6125459-6125481 CTGCTGCCCCTGGGGTATGGAGG - Intronic
901038746 1:6351667-6351689 CTGCTGCTCCTGGGAAATGCTGG - Intronic
901085940 1:6612778-6612800 CAGCTGTACGTGTGGAAGGCTGG - Intronic
901436500 1:9250179-9250201 CTGCTGTCCCGGGTGAGGGCGGG + Intronic
901604619 1:10449446-10449468 CTGCTGGCCCTGGGGCAGCCGGG - Intronic
901687042 1:10948724-10948746 CTGCTTCCCCTGGGGGAGGCTGG + Exonic
902244901 1:15114468-15114490 CAGCTGCCCCTGGGGAAGATAGG + Exonic
902383250 1:16062388-16062410 CTGCTGGCCCTGGGGCGGGGGGG - Intronic
902653872 1:17854206-17854228 CTGCTGCCCCTCGGGAATGGGGG - Intergenic
902923979 1:19683488-19683510 CGGAGGTCCCTGGGGAGGGCTGG - Intronic
903261230 1:22132787-22132809 CTGCTGTGCCAGATGAAGGCAGG - Intronic
903669644 1:25027973-25027995 CTCCTTTCCCTGGTGAGGGCCGG + Intergenic
904128515 1:28259461-28259483 CTGCGGTCCCCGGGGGAGGGCGG - Intergenic
904274621 1:29372252-29372274 CCTCTGTGGCTGGGGAAGGCTGG - Intergenic
905294047 1:36942853-36942875 CTGCTAACCCTGGGGAAGTGGGG + Intronic
905742886 1:40387960-40387982 CTGCTGGCCCTGGGCAATGAGGG + Intronic
906191146 1:43900200-43900222 CTGCTGTCCCTGCAGAACCCAGG - Intronic
906580979 1:46934954-46934976 TCGCTGTGCCTGGGAAAGGCTGG + Intronic
907387289 1:54134297-54134319 CTGCTGTCCCTGGGGTGGCCAGG - Intronic
907486508 1:54781685-54781707 CTGGTGTTCCTGGCCAAGGCGGG - Exonic
908462354 1:64357601-64357623 CCGCTGACCCTGGGGGCGGCGGG - Intergenic
909904572 1:81178860-81178882 CTGCTGGCCCTGGGCAATGAGGG - Intergenic
909942760 1:81630260-81630282 CTGCCTTTCCTGGAGAAGGCTGG - Intronic
910251050 1:85200377-85200399 CTGCTGTCCCTGGGAATGAAGGG - Exonic
911255230 1:95625521-95625543 ATGCTGTACTTGGAGAAGGCTGG + Intergenic
913397669 1:118389932-118389954 CTGCTATGCCAGGGGAAGGCAGG - Intergenic
914339406 1:146746213-146746235 CTGCTGTCCATGGGCAGGGGAGG - Intergenic
914753826 1:150552256-150552278 CTACTGCCCCAGGGGGAGGCAGG - Exonic
915312339 1:155010957-155010979 CTGCTGCTCCTGGAGAAGCCTGG + Exonic
916910117 1:169337330-169337352 CTGCTGGCCCTGGGCAATGAGGG - Intronic
917237019 1:172904820-172904842 CTGATATCCCTGAGGAAGGAAGG - Intergenic
917505777 1:175625668-175625690 CTGCTCTCACAGGCGAAGGCTGG - Intronic
918013649 1:180611213-180611235 CTGCTGTTGCTGGGGAAGAAAGG - Intergenic
918413902 1:184287842-184287864 CTGCTGTGAATGGGGCAGGCAGG + Intergenic
918962890 1:191303246-191303268 CTGCTGGACCTGGAGAAAGCAGG - Intergenic
919766027 1:201127805-201127827 CTGCAGTCCCTGGTGGAGGCTGG - Intergenic
919927983 1:202202408-202202430 CTCCTATCCCTTGGGATGGCTGG - Intronic
920400016 1:205670570-205670592 CTCCAGGCCCTGGGGGAGGCAGG - Intronic
920420131 1:205827620-205827642 CTGCTGTCCCCAGTGGAGGCTGG + Intergenic
920825511 1:209421181-209421203 CAGCTGGCCCTGGGGAAGCCTGG + Intergenic
921519432 1:216141343-216141365 GTGGGCTCCCTGGGGAAGGCTGG + Intronic
921897092 1:220412539-220412561 CTGCTGGCCCTGGGCAATGAGGG + Intergenic
922090282 1:222389318-222389340 CTTCTGTCCCTGGAGAAGTGAGG + Intergenic
922099874 1:222471412-222471434 CAGCTGTGCCAGGGGAAAGCTGG + Intergenic
922110190 1:222548382-222548404 CTGCTGTCTGTGGGGATGCCCGG + Intergenic
922261905 1:223950904-223950926 CAGCTGTGCCGGGGGAAAGCTGG + Intergenic
922522542 1:226268640-226268662 CTGCTTTCCCTCTGGAAGACTGG + Intronic
922605624 1:226888261-226888283 CGGCTGGCACTGGGGAAGACTGG - Intronic
922735169 1:227974836-227974858 CAGCTGTGCCGGGGGAAAGCTGG - Intergenic
923109622 1:230880191-230880213 GTGCTGTCACTGGTGATGGCTGG - Intergenic
923268420 1:232334275-232334297 CTGCTTTGGCTGGGTAAGGCAGG - Intergenic
923391265 1:233515785-233515807 CTTCTGAGCCTGTGGAAGGCAGG - Intergenic
923445739 1:234069670-234069692 CTGAGGACCCTGGGGGAGGCTGG - Intronic
923557587 1:235012928-235012950 CTTCTGTCCCTGGGGTTGTCAGG - Intergenic
923615458 1:235533581-235533603 CTGCTGTCCCAGGCTAACGCTGG - Intergenic
924343075 1:243053081-243053103 CAGCTGTGCCGGGGGAAAGCTGG + Intergenic
1063300399 10:4845168-4845190 CTGCTGGCCCTGGGCAATGAGGG - Intronic
1064415471 10:15145758-15145780 CTCCTGTCCCTGGGGGTGACAGG + Intronic
1064478804 10:15719732-15719754 CCGCGGTCCCCGGGGAAGCCAGG - Exonic
1065881370 10:30040215-30040237 CTGCTCCTCCTGGGGATGGCTGG + Intronic
1067211765 10:44265468-44265490 CTGCTGTCCATGGAGCAGTCTGG - Intergenic
1067533868 10:47093961-47093983 CTGTTGCCCCAGGTGAAGGCAGG - Intergenic
1067796520 10:49325720-49325742 CTGCTCTCCCCGGGGGAGCCGGG - Exonic
1069588564 10:69627761-69627783 CTGATGGCACTGGGGAAGGTGGG + Intergenic
1069819116 10:71216890-71216912 CTGCAGGCCCTGGGGGAGGGAGG - Intronic
1070352027 10:75601493-75601515 CTCTTTTCCCTGGGGAAGGCAGG - Intronic
1070540113 10:77409638-77409660 CTGTCGTGGCTGGGGAAGGCTGG - Intronic
1070547880 10:77466823-77466845 CTGATGTCCATGAGGGAGGCAGG + Intronic
1070756015 10:78993747-78993769 CTGCTGTGCCTGCTGGAGGCAGG - Intergenic
1070768784 10:79070545-79070567 CGGCTGTCCCCGGGGAGGGGTGG - Intronic
1070795638 10:79214833-79214855 CTGCTGTTCATGAGGAAGGCGGG + Intronic
1070969210 10:80549686-80549708 CTGCTGGGCCTGAGGAAGGCAGG - Intronic
1071492084 10:86143126-86143148 CTGCTGTCCCTCAGGAACACTGG - Intronic
1071567711 10:86680296-86680318 CAGCTGACCCTGGGGAAGTGAGG + Intronic
1071872062 10:89806665-89806687 GTGCTGTCCGTGGGGCAAGCCGG + Intergenic
1072330653 10:94347155-94347177 CTGCTGTGCCTGCGGGAGGTCGG - Intronic
1073134914 10:101215142-101215164 CTCCAGGTCCTGGGGAAGGCCGG - Intergenic
1073593018 10:104774256-104774278 CTGCTGTCCCAGGGAAGGGCTGG - Intronic
1074434683 10:113424088-113424110 CTGCAGGTGCTGGGGAAGGCTGG + Intergenic
1074858314 10:117489962-117489984 CTGCTGTCCCCAGGGAAAGGTGG - Intergenic
1075587461 10:123667991-123668013 CTGTTGTCCCAGGGGAAGGCAGG + Intronic
1075626743 10:123969353-123969375 CTGCTTGCCCTGGGGAAGATGGG - Intergenic
1075924074 10:126236257-126236279 CTGGTGCCCTGGGGGAAGGCTGG + Intronic
1076334250 10:129694364-129694386 CAGCCCTCCCAGGGGAAGGCAGG - Intronic
1076969805 11:126625-126647 CAGCTGTGCCGGGGGAAAGCTGG + Intergenic
1077116005 11:884933-884955 CAGCTCTCCCTGGGCCAGGCGGG - Intronic
1077368758 11:2171912-2171934 CTGCTGTGCCTGATGGAGGCGGG + Intergenic
1077408101 11:2391587-2391609 CTTCTGTCTCTGGGGAGGACAGG - Intronic
1078105974 11:8358198-8358220 CTGGTGTCCCAGGAGAGGGCAGG - Intergenic
1078301204 11:10133557-10133579 CTGCTGGCCCTGGGCAATGGGGG - Intronic
1078532205 11:12145457-12145479 ATGCTGGCCCTGGAGAAAGCAGG + Intronic
1078798273 11:14616012-14616034 CTGATTTCCATGGGTAAGGCAGG - Intronic
1079108289 11:17588292-17588314 CTGCTCTCCCGTGGGGAGGCAGG + Intronic
1079110134 11:17600712-17600734 CTGTGGTCCCTGGGGCAGACAGG + Intronic
1080787215 11:35486567-35486589 CTGCTGTCCTTGAGAAAGCCTGG + Intronic
1081230145 11:40576228-40576250 CTGGTGTCCCTGGGGCTTGCTGG - Intronic
1083151646 11:60795406-60795428 CAGGTGTGCGTGGGGAAGGCAGG - Intronic
1083323882 11:61863614-61863636 CTGGAGACCCTGGGTAAGGCTGG + Intronic
1083748461 11:64747704-64747726 TTGCTGCCCCAGGGCAAGGCCGG - Intronic
1084170093 11:67396849-67396871 CTCCTGTCCCCTGGGAAGGTGGG + Intronic
1084190112 11:67494877-67494899 CACTTCTCCCTGGGGAAGGCCGG + Exonic
1084224248 11:67705665-67705687 AGGCTGTCCCTTCGGAAGGCAGG - Intergenic
1084491325 11:69480178-69480200 CCTCTCTCCCAGGGGAAGGCAGG + Intergenic
1084556570 11:69879472-69879494 CTGCTGGCCCAGGGGGAGGTGGG + Intergenic
1084608801 11:70187780-70187802 CTGATGTCCTTGGGGATGTCCGG - Exonic
1084873502 11:72113575-72113597 CTGCTGTCCCTGAAAGAGGCTGG - Intergenic
1084904357 11:72334611-72334633 CTGATGCCCCTGGAGAGGGCAGG - Intronic
1085055109 11:73398774-73398796 CTCCTTCCCCAGGGGAAGGCTGG + Intergenic
1085135699 11:74085787-74085809 CTGTTCTCCCTGGGGCAGGAAGG + Exonic
1085262385 11:75214479-75214501 CTGCTGTCCCTTGGCCAGGAGGG + Intergenic
1087179608 11:95128750-95128772 GTGCTGTCCCTGGAGGAGGCTGG + Exonic
1088824784 11:113484364-113484386 CTGATGTCCCTGAGGCAGGGTGG - Intergenic
1088847786 11:113682330-113682352 CTGCAGGCCCTGAGGAAGGAGGG + Intergenic
1089256631 11:117197691-117197713 CTGCTGTTCCTGGGGAGGTAAGG - Intergenic
1089314489 11:117582310-117582332 GAGCTGTGGCTGGGGAAGGCAGG + Intronic
1089540956 11:119188682-119188704 CTGCTGCCCCGGGGCGAGGCGGG - Exonic
1089557051 11:119320601-119320623 CTGCGGTCCCTGGGAAAGCCAGG - Intronic
1089595139 11:119573814-119573836 CTGCAGGCCCTGGGAAATGCAGG + Intergenic
1089755785 11:120685571-120685593 CCCATGTCCCTGGGGCAGGCCGG + Intronic
1089979707 11:122762192-122762214 CTGTTGTCCTTGGGTAAGACAGG + Intronic
1090307690 11:125704955-125704977 CTGCTGGCCCTGGGCAATGAGGG - Intergenic
1090490044 11:127152324-127152346 CTCCTGTCTCTGGGGAAGGAAGG + Intergenic
1091229011 11:133975722-133975744 CTCCTCTCTCTGGGCAAGGCCGG - Intergenic
1091288560 11:134423299-134423321 CTGGAGTCCCTGTGGAGGGCGGG + Intergenic
1091590231 12:1838396-1838418 TTGCTGTCCCTGGAAACGGCTGG - Intronic
1092062574 12:5563504-5563526 CTGATGTCCGTGGGGATGTCTGG + Exonic
1092480755 12:8857268-8857290 TTGCAGTACCTGGAGAAGGCAGG + Exonic
1092669931 12:10851459-10851481 CTGCAGTCCTGGTGGAAGGCAGG + Intronic
1092708246 12:11308251-11308273 CTGTTGTCCCTGGGCAGGTCTGG + Exonic
1092899470 12:13044727-13044749 CCGCTGTCCCGAGGGGAGGCTGG + Intronic
1094502458 12:31033506-31033528 CTTCTCACCCTGGGGAAGACTGG + Intergenic
1094526855 12:31236954-31236976 CTGCTGAACCTGGGGAGGGGTGG - Intergenic
1096116905 12:49060260-49060282 CTGCTCCCCCCGGGGAAGGGAGG + Intergenic
1096186951 12:49587650-49587672 CAGCTGGTCCCGGGGAAGGCTGG + Exonic
1096216635 12:49801378-49801400 CTGCTTCTCCTGGGGAAGGGAGG + Intronic
1096333493 12:50735141-50735163 CTGTTGACCATGGGGAAGGTGGG + Intronic
1096478815 12:51924557-51924579 CTGGGGTCCCTGAGGAAGTCAGG - Intergenic
1096506560 12:52097420-52097442 GTGCTATCCATGGGGAAGGGGGG - Intergenic
1096651150 12:53062530-53062552 CTGCTTCCCCAAGGGAAGGCGGG - Intronic
1097081165 12:56432264-56432286 CTGCATTATCTGGGGAAGGCAGG - Intronic
1098230905 12:68370881-68370903 CTGCTGTGCCTGGGCACTGCAGG - Intergenic
1101446085 12:104737854-104737876 AGGCTGTCCCCTGGGAAGGCTGG + Intronic
1101461969 12:104905765-104905787 CTGCTGTCCCCGGGCAATGGGGG - Intronic
1102032839 12:109752988-109753010 CTGCTGGCCCAGGGGTAGGCAGG - Intronic
1102240333 12:111320893-111320915 CTGCTGTCCCTGGGTCCCGCAGG + Intronic
1102471949 12:113164178-113164200 CTGCTGTCCCTGCTGGAAGCGGG + Exonic
1102473259 12:113172318-113172340 TGGCTGGCCCTGGGGCAGGCAGG - Intronic
1103363148 12:120365869-120365891 CAGCTGCCCCTGGGAAAAGCGGG - Intronic
1105504352 13:20997582-20997604 CTGCTGTCCCTCGGGGAAGCTGG + Intronic
1105600863 13:21885854-21885876 CTTCTGTCCATGGGGTAGTCGGG + Intergenic
1105725773 13:23160518-23160540 CTGCGGTCGCTGAGGAAGGACGG + Intergenic
1106813851 13:33386347-33386369 CTGGAGCCCCTGAGGAAGGCAGG - Intergenic
1107114224 13:36729245-36729267 CCACTTTCCCTGGGGATGGCAGG + Intergenic
1108858967 13:54829753-54829775 CTGCTGGCCCTGGGCAATGAGGG - Intergenic
1109097243 13:58134070-58134092 CTGCTGTCTCTGAGGAATCCGGG - Intergenic
1111591016 13:90348706-90348728 CTGCTGGCCCTGGGCAATGAGGG + Intergenic
1113372336 13:109734605-109734627 CTCCTCTCCCTGGAGCAGGCGGG + Intergenic
1113535832 13:111065670-111065692 CAGCTGTGCCAGGGAAAGGCGGG + Intergenic
1113657572 13:112077995-112078017 TTGCTGTGCCTGGGGAGGCCAGG - Intergenic
1113694048 13:112331374-112331396 CTTCTGTGGCTGCGGAAGGCTGG - Intergenic
1113808306 13:113122654-113122676 CAGCTCTGCCTGGGGAAGGTGGG + Intergenic
1113967738 13:114163979-114164001 CCGTCGTCACTGGGGAAGGCTGG - Intergenic
1114265190 14:21069631-21069653 CTGTGTTGCCTGGGGAAGGCGGG - Intronic
1114488388 14:23079007-23079029 CTGCTGTCCCTGGAGACTCCAGG + Exonic
1114593527 14:23891864-23891886 CTGCTGGCCCTGGGCAATGAGGG + Intergenic
1115094260 14:29615980-29616002 CTGAAGTGCCTGTGGAAGGCTGG + Intronic
1115258364 14:31426884-31426906 CTGCTGTCCCTGGCCACTGCAGG - Intronic
1117101021 14:52347803-52347825 CAGCTGTCTCTGGGGACGGAGGG + Intergenic
1118327421 14:64791138-64791160 ATGCTGTGCCTGGGGAGGGTGGG - Intronic
1118764433 14:68900403-68900425 CTGGACTCCCTGGAGAAGGCAGG + Intronic
1118907590 14:70033796-70033818 CTACTGTCCTTGGTGAATGCAGG - Intergenic
1119153280 14:72385634-72385656 CTTGTGTCCCTGGGCAGGGCAGG - Intronic
1119182388 14:72613844-72613866 CAGCTGTCCCCGGGGAGGCCTGG - Intergenic
1119485626 14:74984857-74984879 CTGCTCCTCCTGGGGAAGCCTGG + Intergenic
1120792763 14:88600207-88600229 CTGCCCTTGCTGGGGAAGGCGGG + Intronic
1121020855 14:90579225-90579247 CTGCTGGCCCTGGAGAGGGGTGG - Intronic
1121273417 14:92652285-92652307 CTGAGGTCCCTTGGGGAGGCAGG - Exonic
1121439571 14:93940186-93940208 CTGCTCTCTCTGGGGGAGGACGG + Intronic
1122079089 14:99254493-99254515 TTGCTGGCCCTGGAAAAGGCAGG + Intronic
1122287733 14:100661864-100661886 CAGCTGGCCCTGAGGAAGGAAGG + Intergenic
1122532248 14:102436605-102436627 CTGCTGTGCCTGGCCAAGGGTGG + Intronic
1122633490 14:103118923-103118945 CTGCTCCTCTTGGGGAAGGCTGG + Intergenic
1122693501 14:103542272-103542294 GTGCTCTGCCTGGGGAAGGCAGG + Intergenic
1122956196 14:105072674-105072696 TGGCTGTCCCTGGGGCAGGCAGG + Intergenic
1123038768 14:105481940-105481962 CTGCTGTCCCTGGCGGGGTCAGG - Intergenic
1123129841 14:105976069-105976091 GTGATGTCCATGTGGAAGGCAGG - Intergenic
1124193680 15:27601535-27601557 CTGCGGTCCCTCAGGGAGGCTGG + Intergenic
1124351113 15:28956220-28956242 TTGCTGTCTCTAGGGCAGGCAGG + Intronic
1124514797 15:30357520-30357542 CTGCTGTCACCTGGGAGGGCTGG + Intergenic
1124662393 15:31560872-31560894 CTGCTGTTCCGGGTGAAAGCTGG - Intronic
1124728124 15:32173242-32173264 CTGCTGTCACCTGGGAGGGCTGG - Intergenic
1126639665 15:50812076-50812098 CTGCAGTCCCTGGGCAATGAGGG + Intergenic
1127487442 15:59432404-59432426 GTGCTGTCCTTGGGGAAGACAGG + Intronic
1128087724 15:64897433-64897455 CAGCTGCCCCTGCAGAAGGCTGG + Intronic
1129297621 15:74608621-74608643 CTGCTGGCCCAGGGGCAGGTGGG - Intronic
1129731323 15:77934312-77934334 CTTCTGTGCTTGGGGGAGGCAGG - Intergenic
1131256468 15:90865912-90865934 CTGCTATCCCTGGGGTGGTCAGG - Intergenic
1131487284 15:92831902-92831924 CTGCAGCCTCTGGGGGAGGCAGG + Intergenic
1131821105 15:96274525-96274547 ATGCTGTCTTTGGGGAAAGCCGG + Intergenic
1132474435 16:126617-126639 CTGGTGTCCCTCAGAAAGGCTGG - Intronic
1132925730 16:2428418-2428440 GGGCTTTTCCTGGGGAAGGCAGG - Intergenic
1133013846 16:2929878-2929900 GTCCTGTCCCTGGAGATGGCTGG + Exonic
1133234893 16:4383156-4383178 GTGCAGTCCCTGGGCACGGCGGG + Exonic
1133284827 16:4685846-4685868 CTGCTGTCCCTGTAGATGGGAGG + Intronic
1133303146 16:4795328-4795350 CTGCTGGCCCTGGGGAGGGCGGG + Intronic
1133784492 16:8963735-8963757 CTGCGGGCCCTGGGGCCGGCGGG + Intronic
1134268459 16:12712021-12712043 CTACTGTCCCTGAGAAATGCAGG + Intronic
1134276344 16:12779900-12779922 CTCCTGTCCCTCAGGGAGGCAGG - Intronic
1135522112 16:23185815-23185837 ATGCTGCCCTTGAGGAAGGCGGG + Intronic
1135929975 16:26728072-26728094 CCGCTTTCCCTGGGGAAGCAGGG + Intergenic
1137244705 16:46693101-46693123 TTGCTGTGTCTGGGGAAGACTGG - Exonic
1137393896 16:48103651-48103673 CTGCTGTTCCTGGGGTGAGCTGG - Intronic
1137556582 16:49474099-49474121 CTGCGCTCCCTGGAGCAGGCTGG + Intergenic
1137814517 16:51385875-51385897 CTTCTGTCCCTGAGCAAGGAGGG - Intergenic
1139281983 16:65779057-65779079 CAGCCGGCCCTGAGGAAGGCAGG - Intergenic
1139994869 16:70971134-70971156 CTGCTGTCCATGGGCAGGGGAGG + Intronic
1141409116 16:83820582-83820604 CTGCTGCCCCTGTGGAAGGAAGG + Intergenic
1141675914 16:85517231-85517253 CTGGTGTCTCTGTGGGAGGCGGG + Intergenic
1141756836 16:85996986-85997008 CTGCAGGCCCTGGGGGAAGCGGG - Intergenic
1141762806 16:86039677-86039699 ATGCTTGCTCTGGGGAAGGCTGG + Intergenic
1141766438 16:86062742-86062764 CCGAAGTCCCTGGCGAAGGCCGG + Intergenic
1142148537 16:88502661-88502683 CTGCTGGCGCTGGGGCAGCCCGG - Intronic
1142281490 16:89150508-89150530 CTGGTGTCCCTGGGCAGGGGCGG - Intronic
1142450874 16:90172507-90172529 CAGCTGTGCCGGGGGAAAGCTGG - Intergenic
1142456692 17:61184-61206 CAGCTGTGCCGGGGGAAAGCTGG + Intergenic
1142598131 17:1039534-1039556 CTGCTGTCCCTCTTCAAGGCAGG - Intronic
1142712912 17:1733046-1733068 GTAGTGTCCCTGGGGAAGGCAGG + Intronic
1143545401 17:7592346-7592368 CCACAGTCACTGGGGAAGGCAGG + Exonic
1143579802 17:7818835-7818857 CTGTTGTGCCTGGGGTAGACTGG - Intronic
1144697449 17:17314619-17314641 CCGCTGTCCCTTGGCCAGGCTGG + Intronic
1144788593 17:17845296-17845318 CTGCTGCCCCTGGGGCAGCCAGG + Intronic
1145253376 17:21309031-21309053 CTGCTGTACCTGGGATTGGCTGG + Intronic
1145311755 17:21704684-21704706 CTGCAGTCCCTGGGCAAGCAGGG + Intergenic
1145323201 17:21778898-21778920 CTGCTGTACCTGGGATTGGCTGG - Intergenic
1146673358 17:34756920-34756942 CTGCTGTCCCTGGTGATGCAGGG - Intergenic
1146946572 17:36877598-36877620 CTGCTATGCCAGAGGAAGGCCGG + Intergenic
1147133022 17:38419912-38419934 CTGCTGTGACTGGGAAAGGAGGG - Intergenic
1147650944 17:42061759-42061781 CTGCAGTCCCTGGGGGCAGCAGG - Intronic
1148193336 17:45695541-45695563 CAGCTTTCCCTCTGGAAGGCTGG + Intergenic
1148351850 17:46946980-46947002 CTGCTGCCCCTGGGGAAGGTGGG + Intronic
1150680595 17:67281281-67281303 CTCATCTCCCTGGGGAAGCCAGG - Intergenic
1151293452 17:73166285-73166307 CTGCAGGCCCTGAGGGAGGCGGG + Intronic
1151363116 17:73600423-73600445 CTGCCTCCCCTGGGGGAGGCGGG + Intronic
1151517148 17:74604007-74604029 CTGCTGTCCCAGGTGAAGCTGGG - Intergenic
1151714079 17:75822678-75822700 CACCTGGCACTGGGGAAGGCCGG - Intronic
1151942058 17:77298964-77298986 CTGCTGTGCCTGGCCTAGGCTGG + Intronic
1152512647 17:80800980-80801002 CTGCTGTCCCTGGGCCACACGGG - Intronic
1152539200 17:80966475-80966497 CTGGTGGCCCTGGGGACAGCAGG - Intergenic
1152919497 17:83058895-83058917 CTGATGTGGCTGTGGAAGGCGGG + Intergenic
1153526686 18:6001496-6001518 CAGCAAACCCTGGGGAAGGCGGG + Intronic
1154086838 18:11313865-11313887 CTGCTTTTCCTGGGGCTGGCAGG - Intergenic
1154294984 18:13139932-13139954 CTGCTGGCCCCGGAGCAGGCTGG - Intergenic
1154494741 18:14947255-14947277 CTGGTGGCCCTGGGGGTGGCTGG + Intergenic
1155856385 18:30839411-30839433 CTGCTGGCCCTGGGTAATGAGGG - Intergenic
1156112875 18:33748544-33748566 CTGCTTTCCTCGGGTAAGGCTGG - Exonic
1156312916 18:35941112-35941134 CAGCAGTCCCTGGGGCTGGCAGG + Intergenic
1157152196 18:45229267-45229289 CTTCTGGCCCTCTGGAAGGCAGG - Intronic
1157555598 18:48611018-48611040 CAGGGGTCCCTGGAGAAGGCAGG + Intronic
1159763433 18:72456448-72456470 CTTCACTCCCTGGGGAAGGAGGG - Intergenic
1160313452 18:77819353-77819375 ATCCTGTGCCTGGGGAAGGCTGG + Intergenic
1160646608 19:196543-196565 CAGCTGTGCCGGGGGAAAGCTGG + Intergenic
1160780703 19:876828-876850 GGGCTGTCCCTGTGGCAGGCAGG - Intronic
1160803099 19:979606-979628 CTCCTCTCCCTGGGGCCGGCGGG - Intergenic
1160841722 19:1149369-1149391 CGGCTGTCGCTGGAGAAGGCAGG + Exonic
1161166547 19:2790979-2791001 CTGCTGGCTCTGGGAGAGGCTGG - Intronic
1161515591 19:4694504-4694526 ATGCAGTCACTGGGGAAGGCTGG + Intronic
1162158975 19:8697964-8697986 CTGCTGTCCCAGGGGCAGGCCGG + Exonic
1162342986 19:10102920-10102942 CTGCAGGCCCTGGGGCAGCCAGG + Intergenic
1162632710 19:11941548-11941570 CTGCTGGCCCTGGGCAATGAGGG - Intronic
1163344827 19:16734023-16734045 AAGCTGACCCTGTGGAAGGCTGG - Intronic
1163374281 19:16920975-16920997 TAGCTGTCCCTGGGGTGGGCGGG + Intronic
1163568378 19:18065401-18065423 TTGCAGACCCTGGAGAAGGCTGG - Intronic
1163790842 19:19305372-19305394 CTTCTATCCCTGGGAAAGGACGG - Intronic
1163828209 19:19535515-19535537 GAGCTGCACCTGGGGAAGGCAGG - Exonic
1164461702 19:28454588-28454610 CTGGGGTCCCTGGGGAGGTCCGG - Intergenic
1164758450 19:30708517-30708539 CTGTTGTCCCTGGGGAGGACAGG + Intronic
1165177240 19:33939251-33939273 CTCCTGTACATGGGGAGGGCTGG + Intergenic
1165266038 19:34664431-34664453 CTGGTGTCCCTGGGCAGGGCTGG - Intronic
1165307608 19:35011949-35011971 CCGATGTCCCTGGAGCAGGCAGG + Intronic
1165434353 19:35788176-35788198 CCGTTGTTTCTGGGGAAGGCGGG - Exonic
1165462848 19:35954222-35954244 CTTCTGTGCCTGAGGAAGGAGGG - Intergenic
1166090874 19:40508128-40508150 CTCCTGGCCCTGGGGTAGGCAGG - Intronic
1166416162 19:42596092-42596114 CTGCTGTCCTTCGTGAAGCCAGG - Intronic
1166422985 19:42652907-42652929 CTGCTGTCCCTCATGAAGTCAGG + Intronic
1167262599 19:48467529-48467551 TTGCTGTCCCTGGGCTGGGCAGG - Intronic
1167571787 19:50293104-50293126 ATGCTGTCCCTGGGTAACCCTGG - Intronic
1168423065 19:56217724-56217746 CTGCAGTCCTTGGGGAAGCGGGG + Intergenic
1168634890 19:57988585-57988607 CTGCTCTCTGTGGGTAAGGCAGG - Exonic
925102698 2:1262348-1262370 CTCCTGTCCCTGTGGAAGGATGG - Intronic
925369817 2:3336415-3336437 CTGCCCTCCATGTGGAAGGCAGG + Intronic
925906251 2:8541197-8541219 CTGCCATGCCTGGGGCAGGCAGG - Intergenic
926321721 2:11753077-11753099 CTCCTGTCCCTGGGCAAGGAGGG + Intronic
926761942 2:16285785-16285807 CTGCAGTCCCTGGGCAGGTCAGG + Intergenic
927010154 2:18895785-18895807 CTGGTGGCCCTGGGGAAAGGAGG - Intergenic
927472683 2:23386830-23386852 CTGCGTTGCCTGGGGAAGGCGGG + Intronic
927508331 2:23628869-23628891 CAGCTGACCCTGGGGAGGGCGGG + Intronic
928197970 2:29228669-29228691 ATGCTGTCGCTGAGGAAGCCTGG + Intronic
928249109 2:29659383-29659405 CTGTTCTGCCTGGGGAAGGTGGG + Intronic
929329817 2:40668625-40668647 CTGTTGTCTCTGGGGAAGGAAGG - Intergenic
929455299 2:42060932-42060954 TTGCTGACCCTGGCTAAGGCAGG - Intergenic
929963870 2:46519099-46519121 AGGCTGTCACTGGGGAAGGCTGG + Exonic
932568633 2:72924943-72924965 CTGCTGTTCCTGGGCAAAACTGG + Intronic
932764424 2:74460974-74460996 CTGCTGTCCTCAGGGAAGGTGGG - Intergenic
933771165 2:85745059-85745081 CAGCTGTCCCTGGGGCATCCAGG + Intergenic
933998626 2:87688100-87688122 CAGATGTCCCTGGTGGAGGCTGG + Intergenic
934791892 2:97068877-97068899 CAGATGTCCCTGGTGGAGGCTGG - Intergenic
934814726 2:97314833-97314855 CAGATGTCCCTGGTGGAGGCTGG + Intergenic
934822968 2:97393650-97393672 CAGATGTCCCTGGTGGAGGCTGG - Intergenic
935222464 2:101027301-101027323 ATGCTGTCCCCTGGGCAGGCTGG + Intronic
935276121 2:101476593-101476615 ATGGTGTCCCTGTGGAAGGGAGG - Intergenic
935684294 2:105669933-105669955 CTGCTGCTCCTGGGCAAAGCTGG + Intergenic
936270680 2:111046368-111046390 ATGCTGGCCCTGGAGAAGGGTGG + Intronic
936978631 2:118243340-118243362 CACCTGTGCTTGGGGAAGGCAGG + Intergenic
937316131 2:120933139-120933161 CAGCTGCACGTGGGGAAGGCAGG + Intronic
938175787 2:129127525-129127547 CAGCATTCCCTGAGGAAGGCAGG - Intergenic
938230582 2:129655230-129655252 CTGCTGTCCCTGTGGACGCATGG - Intergenic
938293557 2:130162956-130162978 GGGCTGTCCCTGTGGAGGGCAGG - Intronic
938307607 2:130265890-130265912 CAGCAGCCCCTGGGGAATGCTGG - Intergenic
938447725 2:131390952-131390974 CAGCAGCCCCTGGGGAATGCTGG + Intergenic
938462998 2:131510005-131510027 GGGCTGTCCCTGTGGAGGGCAGG + Intergenic
938726038 2:134109598-134109620 CTGCTGGCCCTGGGCAATGAGGG - Intergenic
939777364 2:146403944-146403966 CTGCTGGCCCTGGGCAATGAGGG - Intergenic
940219388 2:151335858-151335880 CTCCTTTCCCTGTGGAAGACTGG + Intergenic
940638891 2:156328235-156328257 CGGCTTTCTCTAGGGAAGGCCGG + Intronic
940734873 2:157439483-157439505 CTGCTCGCCCTAGGGAAAGCGGG - Intronic
941983390 2:171485353-171485375 CAGCAGTTCCTGGGGAAGGAAGG - Intergenic
942524004 2:176833593-176833615 TTGCTTTCCATGAGGAAGGCCGG + Intergenic
944352536 2:198745959-198745981 CTCCTCTCCCTGGGTAAGGTTGG - Intergenic
946080347 2:217113224-217113246 CTCCTGTTCCTGGGAAAGGTGGG + Intergenic
946156193 2:217808241-217808263 CTCCTGTCCCTGGGGAATGGGGG - Intronic
947106886 2:226676827-226676849 CTGCTGTGGCTGGGGAGGACAGG + Intergenic
948117045 2:235501018-235501040 CTGCTTTCCATGGGACAGGCTGG + Intronic
948427507 2:237897005-237897027 GTGCTGTCCGTGGGGATGGTGGG + Intronic
948829211 2:240589588-240589610 CTGCTGTGTTGGGGGAAGGCAGG + Intronic
948867702 2:240783941-240783963 CTGCTGGGCCTGGGGAGGGGCGG - Intronic
948931420 2:241134844-241134866 CTGGAGTTCCTGGGGCAGGCTGG - Intronic
948997770 2:241592456-241592478 AAGCTGTCCCTGGGGCAAGCTGG + Intronic
1169799496 20:9500374-9500396 CTGCTGGCCTGGGGGAAGGCTGG - Intergenic
1170270345 20:14520695-14520717 CAGCTCTACCTGGGGAAGTCAGG - Intronic
1171024182 20:21613849-21613871 ATGCGATCCCTGGGGAAGTCAGG + Intergenic
1171232696 20:23500304-23500326 CTGCTGTCCCTGTGGTCCGCAGG - Intergenic
1171465427 20:25324586-25324608 CAGCTGTCTCTGGTGAAGACAGG + Intronic
1172095880 20:32460332-32460354 TTGGTGTCACTGGGGAAGGCAGG - Intronic
1172135110 20:32681475-32681497 CAGCTGGCTCTGGGGAAGGAAGG - Intergenic
1172834551 20:37864594-37864616 CTGCTGGTTCTGGGGAAGGCTGG - Intronic
1173842010 20:46163675-46163697 CTGATTTCCCAGGGGAAGGGGGG - Intergenic
1175254144 20:57628902-57628924 CTGCTGGCCCTGGGCAATGAGGG + Intergenic
1175328738 20:58148156-58148178 AGGCTGTCCCCAGGGAAGGCTGG - Intergenic
1175348118 20:58297614-58297636 CTGCTGTCCATGAGGGAGGAGGG - Intergenic
1175951699 20:62587131-62587153 CTGCTGTAAGTGGGGAACGCTGG + Intergenic
1176034944 20:63031630-63031652 CTGCTGACTCTGGGGAGGGACGG + Intergenic
1176086504 20:63297677-63297699 CTGCGGACCCCGGGGAGGGCCGG + Intronic
1176091528 20:63320553-63320575 CTGGAGGCCCTGGGGCAGGCTGG + Intronic
1176278898 20:64289679-64289701 CAGCTGTGCCGGGGGAAAGCTGG - Intergenic
1176293860 21:5060238-5060260 CTGCAGACGCTGGAGAAGGCGGG - Intergenic
1176308101 21:5134910-5134932 CTGTTGTCCCTGAGGATGGATGG - Intronic
1178157387 21:29871099-29871121 CTGCTCTCCCTGGATAAGGCTGG + Intronic
1178985381 21:37298653-37298675 CTGCTGTCCCCTGGGAAGGGAGG + Intergenic
1179434373 21:41350187-41350209 CTGCTGGCCCTGGAGGAGGCAGG - Intronic
1179439123 21:41380824-41380846 CTCCAGTGCCTGGGGCAGGCAGG - Intronic
1179599158 21:42464472-42464494 CTGCTGGCCCTGGGGTGGGGAGG - Intergenic
1179655697 21:42842882-42842904 CTGCTGTCCCTGCAGAATCCTGG - Intergenic
1179848959 21:44127122-44127144 CTGTTGTCCCTGAGGATGGATGG + Intronic
1179863399 21:44203410-44203432 CTGCAGACGCTGGAGAAGGCGGG + Intergenic
1180041820 21:45283974-45283996 CCTCTGTCCCCGGGGGAGGCAGG - Intronic
1180073467 21:45450171-45450193 CTCTGGTCCCTGGGGAAGGAGGG + Intronic
1180922374 22:19527539-19527561 CTGCTTTCCCAGGGGAAGAATGG + Exonic
1181288518 22:21772505-21772527 GTGCTGGCCCTGAGGATGGCCGG - Intronic
1181461604 22:23089139-23089161 CTGCCGTCTCTGAGGAAGTCAGG + Intronic
1181493978 22:23277672-23277694 CTGCTGAGCCTGGGCAAGTCTGG + Intronic
1182009311 22:26987005-26987027 CTTCTGTCCCTGGAGTGGGCTGG + Intergenic
1182376961 22:29855674-29855696 CTGCTGTGCCTGGGGTGGGCAGG + Intergenic
1182668124 22:31973618-31973640 CTGATGACCCTGGGGGAGGGAGG + Intergenic
1183287766 22:36978270-36978292 CGGCTGCCCCTGCGGAAGGGGGG - Intergenic
1183354165 22:37349567-37349589 CTGATGTCCCTGGGGTAGGAGGG - Intergenic
1183410737 22:37653804-37653826 CTGGTGACCTTGGGGGAGGCTGG - Exonic
1183716618 22:39536973-39536995 CTGCTGTCCCTGGGACTGGTGGG - Intergenic
1183947682 22:41335981-41336003 CTGCTGGTCCTGGGAAAGGAAGG + Intronic
1183952154 22:41357960-41357982 CAGCTTTCCCTCCGGAAGGCTGG + Exonic
1184095592 22:42314628-42314650 CTGTTCTCCCTGGGAGAGGCGGG - Intronic
1184814078 22:46857306-46857328 CTGCTGCCCCTGGGTGGGGCTGG + Intronic
1184968407 22:47997783-47997805 GTGCTGTCCCAGGGACAGGCAGG + Intergenic
1185045082 22:48524727-48524749 CTGCTGGCCCTGGGGAAGCTCGG - Intronic
1185110365 22:48897090-48897112 CTGCTGTCCCGGGGAGAGGGGGG + Intergenic
1185222591 22:49636462-49636484 CTCCGGACCCTGGGGGAGGCTGG - Intronic
949484658 3:4526484-4526506 CTGCTGGCCTTGGTGATGGCAGG + Intronic
950398070 3:12749345-12749367 TAGCTGTCTCTGGGCAAGGCAGG - Intronic
950456846 3:13097828-13097850 CATTTGTCACTGGGGAAGGCTGG + Intergenic
950551031 3:13665971-13665993 CTGTTGTGTCTGGGGAAGGGAGG + Intergenic
950719793 3:14874882-14874904 CAGCTGGTCCTGGGGAAGCCAGG + Intronic
951693460 3:25421040-25421062 CTGCTGCCCCTGTGGAAGACAGG - Intronic
953158675 3:40398167-40398189 CTGCAGACCCTGGTGAAAGCTGG + Intronic
953195047 3:40724308-40724330 CTGAGGTCCCAGGGGCAGGCTGG - Intergenic
953389824 3:42527638-42527660 CAGCTTCCCCTGGAGAAGGCAGG + Intronic
954100541 3:48369197-48369219 CTGTTGTCCCTGGCTCAGGCTGG - Intergenic
954106234 3:48411181-48411203 CTGCTGTCCCTGGGGAAGGCAGG - Intronic
954127453 3:48539798-48539820 CCTCTGGCCCTGGGGAAGGAAGG + Intronic
954619800 3:51989052-51989074 CAGCTGTCACTGGGCAGGGCAGG - Exonic
954852381 3:53614496-53614518 GAGCTGGCCCTGGAGAAGGCAGG + Intronic
960246502 3:115405633-115405655 CTGATTTCCCTCTGGAAGGCTGG - Intergenic
961040325 3:123673841-123673863 CTGCTGGCCATGGGACAGGCAGG + Intronic
961090567 3:124107666-124107688 CTGCTGTGTCTGGAGGAGGCTGG + Intronic
961454165 3:127016088-127016110 CCTCTGTCCCTGGGGAGGGCTGG - Intronic
961454354 3:127016834-127016856 TTCCTGTCTTTGGGGAAGGCAGG + Intronic
961460455 3:127046785-127046807 CTGCTGGCCCTGGGCAATGAGGG + Intergenic
961567980 3:127777042-127777064 TTGCTTTCTCTGGGGAAGACGGG + Intronic
961652340 3:128422788-128422810 TGGCTGTCCCTGGGGTAGGCAGG - Intergenic
961991239 3:131193863-131193885 CTGCTGTGCCTAGTGAATGCTGG - Intronic
962232370 3:133676668-133676690 CTGCTGGGGCTAGGGAAGGCTGG + Intergenic
963160922 3:142149765-142149787 CAGCTGTCCCTGGAGGCGGCGGG - Intergenic
966680367 3:182635839-182635861 CAGCTGATCTTGGGGAAGGCTGG - Intergenic
966985399 3:185175513-185175535 CTCCTGTTCCTGGGCAGGGCTGG - Intergenic
968059558 3:195717025-195717047 CTGCAGTGCGTGGGGAGGGCAGG - Intergenic
968318310 3:197742964-197742986 TTGCCCTCCCTAGGGAAGGCAGG - Intronic
968371073 3:198222979-198223001 CAGCTGTGCCGGGGGAAAGCTGG - Intergenic
968450834 4:675232-675254 CTGGTGTCCATGGGGCTGGCGGG - Intronic
968615340 4:1575197-1575219 TTGCAGTCCCTGAGGAGGGCTGG + Intergenic
968732073 4:2273900-2273922 CTCCTGTTCATGGAGAAGGCTGG - Intronic
968911645 4:3479539-3479561 GACCTGTCCCTGGGGAAGGAGGG - Intronic
968943883 4:3653595-3653617 CTCCTTCCCCTGGTGAAGGCTGG - Intergenic
969054478 4:4393069-4393091 CTGCTGTCCCTGGTTGAGGCAGG + Intronic
969423662 4:7111425-7111447 TTGCTGGGCCTGGGGATGGCAGG + Intergenic
969440734 4:7215237-7215259 CTGCTGGCCCCGGGCAAGGAGGG + Intronic
969497676 4:7535293-7535315 CTGCTGTCTCGGAGGCAGGCAGG + Intronic
969594774 4:8142803-8142825 GTGTTGTCCTTGGGGAGGGCAGG - Intronic
970446410 4:16126535-16126557 CTCATGTCCCTGGGGATGCCGGG - Intergenic
971384230 4:26128145-26128167 CAGCTGGGCCTTGGGAAGGCAGG + Intergenic
972341684 4:38157574-38157596 ATGCTCTCCCTGGGGGAGGGTGG - Intergenic
972960751 4:44448845-44448867 CGGCTCTCCGTGGGGAGGGCGGG + Intergenic
973954395 4:56049001-56049023 CAGCTGTCCCTGGGCGAAGCCGG + Intergenic
973981626 4:56313079-56313101 CTGCATTCCCTGGGCCAGGCTGG + Intronic
974827309 4:67147990-67148012 CAGCTGTCCCCAGGCAAGGCAGG - Intergenic
975699392 4:77048472-77048494 CTGTTGTCCTTGGAGAAGTCTGG + Exonic
976161223 4:82201496-82201518 CTGCAGTCCATGGGCAAGTCTGG + Intergenic
978021536 4:103819536-103819558 CTGCTTTCCTTGGGAATGGCAGG + Intergenic
979259757 4:118635463-118635485 CAGCTGTGCCGGGGGAAAGCTGG - Intergenic
982265966 4:153538615-153538637 CTGCTTGCCCTGAGGGAGGCGGG - Intronic
983802385 4:171949143-171949165 CTGATGGCCTTGGGGAAAGCAGG + Intronic
983928566 4:173429156-173429178 CAGCTGTCCCTGGGGAAATCAGG - Intergenic
985010110 4:185573607-185573629 CTTCTGGTCCTGGGGATGGCAGG + Intergenic
985522053 5:378547-378569 TTGGCTTCCCTGGGGAAGGCCGG - Intronic
985732379 5:1556526-1556548 CTGCTGGCCCTGGGGAGGCCAGG - Intergenic
985752124 5:1686698-1686720 CTGCTCTCCCTGGGCAGGGTCGG + Intergenic
986060877 5:4188875-4188897 CTGCTCTGCCTGGGGAATGCTGG + Intergenic
986168389 5:5295511-5295533 CTGACATCCCTGGGCAAGGCTGG + Intronic
986316929 5:6595614-6595636 CTGCTTTCCCTGCGGGAGTCTGG + Intergenic
986377619 5:7148445-7148467 CTGCTATGCCTTGGGAAGGTGGG + Intergenic
986626159 5:9725426-9725448 CTGCTGGCCCTGGGCAATGAGGG + Intergenic
986767029 5:10937604-10937626 CTGCAGGCTCTGGGGAAGGGAGG + Intergenic
986769420 5:10958276-10958298 CTGCTGTCCCTGGGCTGAGCTGG + Intergenic
990014867 5:51047626-51047648 CTGCTCACTCTGGGGAAGACAGG - Intergenic
990056562 5:51587853-51587875 CTGCTGTCCTTGGGGAGTGATGG + Intergenic
991227815 5:64292960-64292982 CTGCTGGCTCTGGGGAATCCAGG - Intronic
991975921 5:72183660-72183682 CTGCTGTCCCAGGAGCAGGCAGG + Intronic
992263432 5:74993206-74993228 CTGATGACCCTGGGCAAGACAGG - Intergenic
992454362 5:76902688-76902710 TTGCTGTCCTTGGGGGAGGCAGG + Intronic
993328586 5:86569775-86569797 CTGCTGGCCCTGGGCAAAGAGGG - Intergenic
995038857 5:107565981-107566003 CTATTGTCCCTCAGGAAGGCTGG + Intronic
996094982 5:119389015-119389037 CTGCTGTCCGTGGAGATGGAGGG + Intronic
996559150 5:124809954-124809976 CTCCCGTCCCTGTGAAAGGCAGG - Intergenic
997197113 5:131987598-131987620 CTGATGTCTCTGGGGAGGCCAGG + Intronic
997585507 5:135040762-135040784 CTCCAGTCCCTGAGAAAGGCAGG - Intronic
998050315 5:139026983-139027005 CTGCTCTCCTTAGGCAAGGCAGG - Exonic
998158587 5:139800118-139800140 CAGCTGCCCCTGTGGAAGCCAGG + Intronic
999149022 5:149414618-149414640 CTGGTGTCCCCTGGGAAGGCAGG - Intergenic
999268987 5:150285449-150285471 CAGCTCTGCCTGGGAAAGGCAGG + Intronic
999698306 5:154205492-154205514 CTGCAGTCCTTGGGAAAGCCTGG - Intronic
1000066028 5:157693947-157693969 CTGCTGGCCCTGGGCAATGAGGG + Intergenic
1000353420 5:160370578-160370600 CTGCTGCCGCTGAGGAAAGCCGG - Exonic
1000733588 5:164869078-164869100 TTGCTGTCCTTGCAGAAGGCTGG + Intergenic
1002428006 5:179187066-179187088 CAGCCGGCTCTGGGGAAGGCTGG - Intronic
1002596747 5:180328668-180328690 GTGCTGTCCCTGAGCAGGGCAGG - Intronic
1002663640 5:180807347-180807369 GTGTTGTCCCTGGGAAAAGCAGG + Intronic
1002730310 5:181328535-181328557 CAGCTGTGCCGGGGGAAAGCTGG - Intergenic
1002754220 6:145569-145591 CAGCTGTGCCGGGGGAAAGCTGG + Intergenic
1002780020 6:358622-358644 CGGCAGGCCCTGGGCAAGGCAGG + Intergenic
1002853888 6:1020835-1020857 CTGCTGGCCTTGGTGAAGGCAGG - Intergenic
1006298058 6:33178814-33178836 GTGCTGATCCTGGGGAAGCCTGG + Intronic
1006358529 6:33574525-33574547 CTGCTGTCCCTCGGGCTGCCAGG - Intronic
1006673170 6:35742737-35742759 CAGCTGCCCATGGGGAAGGCAGG - Intronic
1007396277 6:41579510-41579532 CTGCTGACCCAGGGGTAGGAGGG + Intronic
1007582421 6:42967401-42967423 CTCCTGGCCCAGGGGAAGGTGGG + Exonic
1007662907 6:43497271-43497293 CAGACGTCCCTGGGGAAGGAGGG + Intronic
1007699743 6:43759632-43759654 CTGCTGCCCCTGGGGAGGTCTGG + Intergenic
1007964004 6:45986780-45986802 CTGCTGTACTTGTGGAATGCAGG - Intronic
1008441330 6:51535012-51535034 CTGCTATCAGTGGGCAAGGCTGG - Intergenic
1009407109 6:63326705-63326727 CTGCTGGCCCTGGGCAATGAGGG - Intergenic
1010378445 6:75201928-75201950 CGGCTGTCCCTGAGGGAGGCAGG + Intronic
1011143687 6:84189477-84189499 CTGCTGGCCCTGGGCAATGGGGG + Intronic
1011751654 6:90460555-90460577 CAACTGTCACTAGGGAAGGCAGG - Intergenic
1013410785 6:109881394-109881416 CTGCTGGCCCTGGGCAATGAGGG - Intergenic
1013955349 6:115834851-115834873 CTGCTGGCCCCGGGGAATGGGGG - Intergenic
1015227396 6:130873340-130873362 CTGCTGTCCCTCAGGCAGGTTGG - Intronic
1015317615 6:131834403-131834425 CTGCTTTGCCTGGGGAAGTAAGG + Intronic
1016614340 6:146029030-146029052 CTGTGGTCACTGAGGAAGGCGGG - Intronic
1016743925 6:147558048-147558070 CTGCTGTTGCTGGAGCAGGCAGG + Intronic
1017023959 6:150165440-150165462 CTAAAGTCCTTGGGGAAGGCTGG + Intronic
1017445649 6:154505068-154505090 CTGTGGTCCCTGGGAAAGGGAGG - Intronic
1017950085 6:159129019-159129041 CTGATGGGCCTGGGGAGGGCAGG - Intergenic
1019262180 7:87844-87866 CTGATGGCCCTGGGGCAGGTGGG - Intergenic
1019478690 7:1256168-1256190 CTGGTGTGCGTGGGGAAGGCGGG - Intergenic
1019534251 7:1520325-1520347 CTGCTCTCACTGGGGACGGGGGG - Intergenic
1019549162 7:1593700-1593722 CTGCTGGCCAAGGGGAAGGAAGG + Intergenic
1019561970 7:1663951-1663973 CTCCTGTCCCGTGAGAAGGCAGG - Intergenic
1019565676 7:1677879-1677901 CCCCTGTCCTTGGGGTAGGCAGG + Intergenic
1019667312 7:2258343-2258365 CAGCTGTCCCGCGGGAACGCAGG - Intronic
1019722611 7:2582390-2582412 GTCCTGTCCCTGAGTAAGGCTGG - Intronic
1020071050 7:5227246-5227268 TTTCTGTCACTTGGGAAGGCAGG - Exonic
1020114834 7:5470579-5470601 CTGCCTGCCCTGTGGAAGGCTGG - Intronic
1020687307 7:11311488-11311510 GTGCTCTCCCTAGGGAAGTCTGG - Intergenic
1022396565 7:29992235-29992257 ATGCAGACCCTGGGGAAAGCAGG - Intergenic
1022468992 7:30670473-30670495 CTGCTGACCCCTGGGAAAGCAGG + Intronic
1022704509 7:32789796-32789818 TTGCTCTCCCTGGGGCAGGAGGG + Intergenic
1022750429 7:33219083-33219105 CTGCTGGCCCTGGGCAATGAGGG + Intronic
1022806951 7:33831945-33831967 CTGCTTTGGCTGGGGAAGGCCGG - Intergenic
1022908682 7:34879540-34879562 TTGCTCTCCCTGGGGCAGGAGGG + Intergenic
1023243980 7:38180379-38180401 CTGCTTTCCAAGTGGAAGGCAGG - Intronic
1023845256 7:44116736-44116758 CTACTCGCCCTGGGGAAGGAGGG + Intronic
1023966959 7:44967759-44967781 CTGCTCTCCCAGAGGATGGCTGG - Intronic
1024104696 7:46071180-46071202 CTACCGTCCTTGGGGAAAGCTGG + Intergenic
1024648133 7:51385593-51385615 CTGCTGTGCTGGGGGAAAGCTGG + Intergenic
1024729511 7:52238825-52238847 CAGGTGTGCCTGGGGAAGGGTGG - Intergenic
1025051991 7:55740078-55740100 CAGCTGTGCCGGGGGAAAGCTGG + Intergenic
1025128948 7:56365746-56365768 CAGCTGTGCCGGGGGAAAGCTGG + Intergenic
1025177332 7:56808634-56808656 CAGCTGTGCCGGGGGAAAGCTGG + Intergenic
1025694460 7:63767754-63767776 CAGCTGTGCCGGGGGAAAGCTGG - Intergenic
1026942244 7:74293830-74293852 CTCCTGTCCCGGGGCAGGGCTGG - Intronic
1027250187 7:76393866-76393888 GTGCTGTCTCCCGGGAAGGCTGG + Exonic
1027665885 7:81042817-81042839 CTGCTGGCCCTGGGCAATGAGGG + Intergenic
1029250530 7:99233012-99233034 CTACAGCCCCTGGGGCAGGCAGG - Intergenic
1031921075 7:127600990-127601012 AAGATGGCCCTGGGGAAGGCAGG - Intronic
1032051981 7:128655454-128655476 CAGCTGTGCCGGGGGAAAGCTGG - Intergenic
1032090838 7:128910719-128910741 CAGCAGGCGCTGGGGAAGGCGGG + Exonic
1032162673 7:129522782-129522804 CTGCTGTCCTTGGTGCCGGCTGG - Intergenic
1032257433 7:130308427-130308449 CTGCTGTCCCTGGGCTCGCCTGG + Intronic
1032267207 7:130378040-130378062 CTGCTCCCCATGGGGAAGGAAGG - Intergenic
1032268394 7:130383806-130383828 CTCCTGTCCTTGGGGGAAGCAGG + Intronic
1033039562 7:137905614-137905636 GTGCTGGCCGTTGGGAAGGCAGG + Intronic
1033725915 7:144118584-144118606 CTGCTGCTCCTCGGGATGGCGGG + Intergenic
1034554234 7:151839829-151839851 ACGGTGTCCCTGGGGAAGGCGGG - Intronic
1034671885 7:152865271-152865293 CTGCTGTACCAAGGGAAGGCAGG - Intergenic
1034961117 7:155365205-155365227 GTGCCATCCCTTGGGAAGGCAGG + Intronic
1035355742 7:158275165-158275187 GTGCTGTCCCTGCTGGAGGCTGG - Intronic
1035404402 7:158588160-158588182 GCACTGTCCCTGGGGACGGCGGG + Intergenic
1035676291 8:1458692-1458714 CAGCCTTCCCTGGGGAAGACAGG + Intergenic
1035873558 8:3162229-3162251 ATGCTGTTGCTGGGGAGGGCTGG + Exonic
1036767910 8:11560612-11560634 CTGCTATCCCTGGCCCAGGCTGG + Intronic
1037629374 8:20639499-20639521 CTGCTGTGCCTTGGGAAGTCTGG + Intergenic
1037966595 8:23138943-23138965 CAGCTGTGCTTAGGGAAGGCAGG - Intronic
1037983518 8:23272225-23272247 CTGCTGGCCCTGGGCAATGAGGG + Intronic
1039284857 8:36028935-36028957 CTGCTGGCCCTGGGCAATGAGGG + Intergenic
1040471187 8:47737322-47737344 CTGCTGTCCCGGCGGCCGGCAGG + Exonic
1041034666 8:53776150-53776172 CTGCTGGCCCTGGGCAATGACGG - Intronic
1041699177 8:60768614-60768636 CAGCTGTCCCTGGGGATTGTGGG + Intronic
1041714300 8:60920325-60920347 ATGCTGGGCCTGGAGAAGGCAGG + Intergenic
1041830211 8:62144727-62144749 CGGCCGTCCCTGGGAAAGCCGGG - Intergenic
1042511593 8:69617985-69618007 CTGGATTCCATGGGGAAGGCAGG - Intronic
1044727944 8:95208233-95208255 GTGCTGTCCCTGGAAAGGGCTGG - Intergenic
1044754102 8:95444063-95444085 CTGCTTTCCCTGGGGACCGCAGG + Intergenic
1044932687 8:97265253-97265275 CTGCTGTCCATGTGGGAGGCTGG + Intergenic
1045193233 8:99904144-99904166 CTGCTGACCTAGGGGAACGCTGG + Intergenic
1045239259 8:100384602-100384624 CTGCAGAGCCTGGGGAAGCCTGG - Intronic
1045265600 8:100616324-100616346 ATGATGTCTTTGGGGAAGGCAGG + Intronic
1046254674 8:111680593-111680615 TTGTTTTCCCTAGGGAAGGCAGG - Intergenic
1047408073 8:124601739-124601761 CTGCTGCCCCGGGGGATGCCTGG + Intronic
1048205585 8:132412727-132412749 CTGCTGTCCCAGGGCAGGGGAGG - Intronic
1048324624 8:133429485-133429507 CAGATGTCCCTGAGGAAGGCAGG - Intergenic
1049234572 8:141506093-141506115 CTGCTGTGCCTGGGGGAAGCCGG - Intergenic
1049544061 8:143221429-143221451 CCGATGCCCCTGGGGAGGGCCGG + Intergenic
1049659321 8:143812671-143812693 GAGCTGTCCCTGGGGAGGGGAGG - Intronic
1049676853 8:143893266-143893288 CTGCTGTCCCTGTGGTAGACAGG - Intergenic
1049752914 8:144294039-144294061 CTGTTCTCCCTGGGGAGGGATGG + Intronic
1051469679 9:17423610-17423632 CTGCGGTCCTTGGGCAAGTCTGG - Intronic
1052359556 9:27539585-27539607 TCGCTTTCCCTAGGGAAGGCAGG + Intergenic
1052974623 9:34401597-34401619 CTGCCATCCCGGGGGAGGGCTGG - Intronic
1053123726 9:35563429-35563451 CTTCTGCCTCTGGGGATGGCGGG - Intronic
1053173371 9:35906376-35906398 CTGCCGTCCGTGGAAAAGGCAGG - Exonic
1053424826 9:38003949-38003971 CTTCTGTTACTGGGGAGGGCAGG + Intronic
1054758347 9:68981450-68981472 CTGCTGCCCCTAGGGAATGGCGG + Intronic
1056080972 9:83093549-83093571 CTGCTGGCCCTGGGCAATGAGGG - Intergenic
1056888989 9:90471644-90471666 CTGCTGTCTCTGGGCAATGGAGG - Intergenic
1057148149 9:92772375-92772397 CTGCTGCACCCAGGGAAGGCTGG - Intergenic
1057350398 9:94292455-94292477 CTGGTCTCCCTGGGTAAGGCTGG + Exonic
1057644074 9:96856467-96856489 CTGCTCTCTCTGGGGAGGGCGGG - Intronic
1057857993 9:98617004-98617026 ATGCAGTACCTGGGGAAGCCTGG - Intronic
1058917971 9:109585968-109585990 CTGATATCCCTGGGAAAGGCTGG - Intergenic
1060599497 9:124868848-124868870 CTGCCGGTACTGGGGAAGGCTGG - Exonic
1060723722 9:125994338-125994360 CTGCTGGCGCTGGAGAAGGAAGG + Intergenic
1060931058 9:127489826-127489848 CTGCTGTCCCTGCTCCAGGCAGG + Intronic
1061034456 9:128105982-128106004 CTGCTGTCCCTGGGGTACCACGG - Intronic
1061044382 9:128156934-128156956 CTGTTCTACCTGAGGAAGGCAGG - Intergenic
1061177625 9:129007187-129007209 CTGCAGCCTCGGGGGAAGGCAGG + Intronic
1061227387 9:129288660-129288682 CTGCTTTCCCTGGGGGAACCTGG + Intergenic
1061445672 9:130635897-130635919 CTGCTCTCCCTCCGGACGGCTGG - Intronic
1061662652 9:132140456-132140478 TTGCTGTGCCTGGACAAGGCTGG + Intergenic
1061799326 9:133105482-133105504 CTCCTGTCCCTGGGGTAGGCAGG + Intronic
1062084778 9:134642819-134642841 ACGCTGTCCCTGGGGAAAGCAGG - Intronic
1062208640 9:135351243-135351265 CGGCTGTGCCTGGGGAGTGCCGG - Intergenic
1062300334 9:135863843-135863865 CTGCTGTCTGTGTGGAAGCCTGG - Intronic
1062547217 9:137069255-137069277 CCGTAGTCCCTGGGGATGGCTGG - Intronic
1062567871 9:137171296-137171318 GTGCTGTCCCTGGAGGAGGAGGG - Intronic
1062584604 9:137243560-137243582 CTTCAGTCACTGGGGAAAGCAGG + Exonic
1062677974 9:137759482-137759504 CTGCTGTCTCTGGTGAGGTCGGG + Intronic
1062754722 9:138281049-138281071 CAGCTGTGCCGGGGGAAAGCTGG - Intergenic
1203791082 EBV:151887-151909 CTGCTCTTCCTGGGTGAGGCCGG - Intergenic
1203578629 Un_KI270745v1:25209-25231 CAGCTGTGCCGGGGGAAAGCTGG - Intergenic
1185557765 X:1034847-1034869 CTGCAGTCCCCGGGAAAGGCAGG + Intergenic
1185599370 X:1328198-1328220 CTGGGATCCCTGGGGAAGGGGGG + Intergenic
1186257893 X:7742378-7742400 CTGCAGTCCCAGGGGAAGAAGGG + Intergenic
1186900569 X:14050997-14051019 TTGCTGTCCCCTGGGAAGGTGGG - Intergenic
1189263408 X:39694395-39694417 TTGCTGTTCCTGTGGAAGGCTGG + Intergenic
1190881184 X:54493951-54493973 CTTCAGTCCCAGTGGAAGGCAGG + Intronic
1192040311 X:67613295-67613317 GTTCTGTCCCAGGGAAAGGCAGG + Intronic
1192250416 X:69408483-69408505 CTGCCCTACATGGGGAAGGCAGG + Intergenic
1194206823 X:91019893-91019915 CTGCTATCCATGGGCCAGGCAGG - Intergenic
1195237129 X:102911478-102911500 CAGCTGTCCCTAGGGAAAGTTGG + Intergenic
1195255019 X:103081951-103081973 CTGCTGGTCCTGGGGAAGTGGGG + Intronic
1196793991 X:119488116-119488138 CTGCCGGCCCTGGGGAATGAGGG - Intergenic
1197344839 X:125319315-125319337 CTGCTGGCCCTGGGCAATGAGGG - Intergenic
1197838686 X:130722266-130722288 ATGCTGCCCCTGGGGAAGCAAGG - Intronic
1199345588 X:146734866-146734888 CTGCTCTCTCTTGGGGAGGCAGG - Intergenic
1200228722 X:154433448-154433470 CAGTTGTCTCTGGGGGAGGCTGG + Intronic
1200552574 Y:4594682-4594704 CTGCTATCCATGGGCCAGGCAGG - Intergenic
1200780335 Y:7209897-7209919 CTGCTGGCCCTGAGGAAGGTGGG + Intergenic
1202381263 Y:24277829-24277851 CAGCTGTGCCAGGGGAAAGCTGG - Intergenic
1202489522 Y:25392297-25392319 CAGCTGTGCCAGGGGAAAGCTGG + Intergenic