ID: 954107181

View in Genome Browser
Species Human (GRCh38)
Location 3:48415682-48415704
Sequence ACAGCCACAGGGAGCGTGGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 5, 3: 23, 4: 277}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954107172_954107181 -1 Left 954107172 3:48415660-48415682 CCGCTCCGTGGCCCCAAACCACA 0: 1
1: 0
2: 0
3: 17
4: 207
Right 954107181 3:48415682-48415704 ACAGCCACAGGGAGCGTGGCAGG 0: 1
1: 0
2: 5
3: 23
4: 277
954107173_954107181 -6 Left 954107173 3:48415665-48415687 CCGTGGCCCCAAACCACACAGCC 0: 1
1: 1
2: 5
3: 46
4: 400
Right 954107181 3:48415682-48415704 ACAGCCACAGGGAGCGTGGCAGG 0: 1
1: 0
2: 5
3: 23
4: 277
954107169_954107181 13 Left 954107169 3:48415646-48415668 CCGCGTTGAAGCCTCCGCTCCGT 0: 1
1: 0
2: 0
3: 2
4: 39
Right 954107181 3:48415682-48415704 ACAGCCACAGGGAGCGTGGCAGG 0: 1
1: 0
2: 5
3: 23
4: 277
954107171_954107181 2 Left 954107171 3:48415657-48415679 CCTCCGCTCCGTGGCCCCAAACC 0: 1
1: 0
2: 0
3: 5
4: 174
Right 954107181 3:48415682-48415704 ACAGCCACAGGGAGCGTGGCAGG 0: 1
1: 0
2: 5
3: 23
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954107181 Original CRISPR ACAGCCACAGGGAGCGTGGC AGG Exonic
900131113 1:1087745-1087767 ACACCCCCAGGGAGCATGGCGGG + Intronic
900175723 1:1290591-1290613 ATTGCCCCAGGTAGCGTGGCAGG + Intronic
900226251 1:1534878-1534900 ACAGCCACAGGGTGGGGTGCAGG - Intergenic
900345883 1:2210066-2210088 ACAGCCACAGGGCACTAGGCAGG - Intronic
900807026 1:4774258-4774280 CCAGCCACAGGGAATGTGGGGGG + Intronic
901455742 1:9361830-9361852 ACATCTCCAGGGAGGGTGGCGGG - Intronic
902086615 1:13867774-13867796 ATAGCCAGAGGTAGAGTGGCCGG - Intergenic
903682939 1:25109152-25109174 AGAGACAGAGGGAGAGTGGCTGG - Intergenic
905011550 1:34750542-34750564 AGAGCCCCAGGCAGAGTGGCAGG + Intronic
905823679 1:41013879-41013901 TCTGCCACAGCCAGCGTGGCGGG - Intergenic
906319741 1:44808603-44808625 ACAGACACAGGGAGGGGGCCAGG - Exonic
907272423 1:53298742-53298764 TCAGCCCCAGGGGGCCTGGCTGG - Intronic
907726994 1:57029157-57029179 TCAGCCACAGCTAGAGTGGCTGG - Intronic
907822881 1:57988319-57988341 ACAGCCACAGAGTGAGTGGGGGG - Intronic
907906829 1:58790088-58790110 TCAGCCAAAGGCAGTGTGGCTGG - Intergenic
909405260 1:75281687-75281709 TCAGCCACAGCTAGAGTGGCTGG - Intronic
911839042 1:102659037-102659059 ACACTCACAGGGAGGGTGGGCGG - Intergenic
914048206 1:144107825-144107847 AGAGCCACAGGGACCGTGTTGGG + Intergenic
914130978 1:144857623-144857645 AGAGCCACAGGGACCGTGTTGGG - Intergenic
915556401 1:156663308-156663330 AGAGCCCCAGGAAGGGTGGCTGG - Intergenic
917484623 1:175444427-175444449 ACAGGTACAGGAAGTGTGGCTGG + Intronic
918052046 1:180982129-180982151 ACAGCCACGGGGAGCGGAGATGG + Intronic
918117467 1:181509281-181509303 ATTGCCACAGGTAGCCTGGCAGG + Intronic
920646564 1:207808045-207808067 ACGGCCTGAGGGAGCGTGCCAGG - Intergenic
924113585 1:240724125-240724147 ATGGCCTCAGGCAGCGTGGCTGG + Intergenic
1062832138 10:612941-612963 ACACCCACTGGGAGGGGGGCCGG - Intronic
1062960456 10:1569458-1569480 ATTCCCAGAGGGAGCGTGGCTGG + Intronic
1064122531 10:12632378-12632400 ACAGCAAGAGGGCCCGTGGCTGG + Intronic
1064203084 10:13300480-13300502 ACAGAAACAGGGTGCGGGGCAGG - Intronic
1065226048 10:23545028-23545050 TCAGCCACAGCTAGAGTGGCTGG - Intergenic
1067038475 10:42935626-42935648 CCAGTCACAGGGGGCGTGCCGGG - Intergenic
1067711970 10:48656812-48656834 AGAGCCACACGCAGCATGGCTGG + Intergenic
1070476786 10:76836680-76836702 GCAGCCACAGTAAGTGTGGCTGG + Intergenic
1070598519 10:77849502-77849524 GCTGCCACAGGGAGCAGGGCTGG - Intronic
1072530480 10:96313967-96313989 GCAGCCACAGGGAGGCTGTCAGG - Intronic
1074499765 10:114012801-114012823 ACAGCCCCAGAGAGAGGGGCAGG - Intergenic
1075275006 10:121085502-121085524 ACAGCCACAATGGGCGGGGCTGG - Intergenic
1075991568 10:126843000-126843022 ACAGCCTGAGGGCGAGTGGCAGG + Intergenic
1076365567 10:129919376-129919398 ACAGCCACAGGGAATAAGGCTGG + Intronic
1076401975 10:130190621-130190643 GCAGCCGCAGGCAGCGGGGCGGG - Intergenic
1076429557 10:130391940-130391962 GCAGGCACAGGGAACGTGGAGGG - Intergenic
1076769366 10:132654600-132654622 ACAGCCAGAGGGCACCTGGCTGG - Intronic
1077288519 11:1778217-1778239 AGAGCCACAGGGAGCGGGAAGGG + Intergenic
1077433022 11:2525467-2525489 GCACCCAGAGGGAGCCTGGCAGG + Intronic
1077495787 11:2885957-2885979 ACACCCACCGGGGGCGGGGCGGG + Intergenic
1078094889 11:8290676-8290698 ACGCCCACTGGAAGCGTGGCTGG - Intergenic
1078927823 11:15890345-15890367 ACATTCACAGTGAGGGTGGCTGG - Intergenic
1079256702 11:18837327-18837349 ACAAACACAGGGAGTGGGGCGGG + Intergenic
1081707182 11:45189436-45189458 GCAGCCACTGGGAGAGTAGCTGG + Intronic
1082609480 11:55280689-55280711 CCAGGCTCAGGGAGTGTGGCAGG + Intergenic
1083820646 11:65169566-65169588 ACGGCCTCAGGGAGCCTGGGAGG + Intergenic
1083961115 11:66015564-66015586 GCAGGCACAGGGTGGGTGGCAGG + Intergenic
1084023138 11:66430216-66430238 TGAGCCACAGGGACCGTGCCAGG - Intergenic
1086721587 11:90128023-90128045 TCAGCCACAGGTGGAGTGGCTGG + Intergenic
1088684921 11:112276674-112276696 ACAGTTTCAGGGAGTGTGGCTGG + Intergenic
1089497915 11:118916987-118917009 ACAGCCTCAGGGAGGAGGGCTGG + Intronic
1091168740 11:133502318-133502340 ACAGACAGAGGCAGGGTGGCAGG + Intronic
1091223387 11:133944087-133944109 ACAGCAACAAGGAGGGGGGCAGG + Intronic
1093999152 12:25675683-25675705 ACCACCACAGGGAGCAAGGCAGG - Intergenic
1096777260 12:53971951-53971973 ACAGCCCCAGGGACAGAGGCTGG + Intergenic
1098599899 12:72318505-72318527 ACAGTCACAGTGACCTTGGCCGG + Intronic
1101532683 12:105588334-105588356 ACCCACACAGGGAGCGTGGCTGG - Intergenic
1101878539 12:108610974-108610996 ACAGGCACAGGGACCCTGCCAGG - Intergenic
1102768442 12:115452608-115452630 ACAGACACAGGGAGAGGGGAGGG - Intergenic
1103553998 12:121754950-121754972 ACAGATACAGTGAGCGTGACAGG + Intronic
1103914664 12:124370065-124370087 ACAGCCAGCAGGAGCGGGGCGGG + Intronic
1103924899 12:124418269-124418291 TCAGCCCCAGGCATCGTGGCTGG + Intronic
1103940934 12:124500811-124500833 ACAGCCTCAGGGTGAGGGGCAGG + Intronic
1103962995 12:124621205-124621227 ACAGCCCCTGGGACTGTGGCTGG - Intergenic
1104806414 12:131592200-131592222 AGAGCCACTGGGAGTGGGGCGGG - Intergenic
1105356695 13:19665450-19665472 ACAGCCACGGGGAGGGTGAGAGG - Intronic
1105588862 13:21772550-21772572 ACAGAGACAGAGAGCGAGGCAGG - Intergenic
1106790931 13:33154144-33154166 CCATCCACAGGGAGGGTGTCGGG + Intronic
1108699800 13:52933935-52933957 GCAGCCACCGTGAGCGGGGCTGG - Intergenic
1111684279 13:91482710-91482732 ACAGCAAGAAGCAGCGTGGCAGG - Intronic
1112467752 13:99658599-99658621 TCGGCCACAGGCAGCGGGGCGGG + Intronic
1112955796 13:105056675-105056697 AGAGTCACAGGGAGGGTGGAGGG + Intergenic
1113662889 13:112118911-112118933 CCAGGCACGGGGAGCATGGCAGG + Intergenic
1113993069 14:16043518-16043540 ACAGACACAGTGAGAGAGGCAGG - Intergenic
1114182535 14:20378423-20378445 ATAGCCACAGGCAGCTGGGCTGG - Exonic
1114199888 14:20510265-20510287 ACAGCAACAGGGAATGTGGTAGG + Intronic
1116792107 14:49350118-49350140 AAAGCCACAGGTAGCTTGACAGG + Intergenic
1117493187 14:56273223-56273245 AAAGCCACAGGGAGAGGGCCTGG - Intronic
1119672000 14:76526993-76527015 ACAGCAACAGGGAGTCTGACTGG + Intergenic
1119726521 14:76924851-76924873 GCAGCCACAGGGAGCTGGGCGGG - Intergenic
1121736881 14:96224969-96224991 GAAGCCACAGGGAGCAAGGCAGG + Intronic
1122027185 14:98886585-98886607 CCAGCCTCAGGGAGCCTGTCTGG - Intergenic
1122587466 14:102819200-102819222 ACAGGCACAGCAAGAGTGGCAGG - Intronic
1122593529 14:102872480-102872502 ACAGCCACAGGGGGCGAGAAGGG - Intronic
1124840203 15:33234469-33234491 ACAGCCACACGGAGCCTGGATGG - Intergenic
1125967957 15:43889382-43889404 ACAATCTCAGGGAGCGGGGCAGG + Intronic
1128619118 15:69133825-69133847 GCAGCCAGAGTGAGGGTGGCAGG - Intergenic
1128645647 15:69376942-69376964 ACAGCCACAGTGGCAGTGGCTGG - Intronic
1130541308 15:84822494-84822516 ACAGCCGAAGGGAGTGTGGATGG + Intronic
1131253330 15:90845221-90845243 GCAGCCCCAGGGGGCCTGGCAGG - Intergenic
1132264888 15:100461096-100461118 AGAGCAACAGGAAGCTTGGCTGG + Intronic
1132827892 16:1914079-1914101 GCAGCCACAGGGAGACTGGGAGG + Intronic
1134201810 16:12205479-12205501 ACAGCAAGAGGGAGGGTGGTGGG - Intronic
1140885217 16:79236857-79236879 ACAGCCATAGGGAGCATGCGAGG + Intergenic
1141485994 16:84340735-84340757 ACAGCCACAGGGAGCAGGGGTGG + Intergenic
1141618256 16:85222147-85222169 AGAGCCACAGGGAGCGGGGAGGG - Intergenic
1141620819 16:85235751-85235773 CCCGCCCCAGGAAGCGTGGCGGG + Intergenic
1141726562 16:85793212-85793234 ACAGTCACAAGGGGCGTGGGGGG - Intronic
1141969654 16:87472393-87472415 ACAGCCACAGGGATCCAGGCTGG + Intronic
1142130097 16:88428391-88428413 TCAGCCCCAGGGAGCGTGGCCGG + Exonic
1144632004 17:16878631-16878653 GCAGCCGAAGGGAGGGTGGCAGG + Intergenic
1147989148 17:44322775-44322797 CAAGCCACAGGGAGCATGGGAGG - Intronic
1148798116 17:50207136-50207158 GCAGCCATAGGGGGCGTGGCCGG + Intergenic
1151209766 17:72535793-72535815 GCAGCCTCAGGGAGCAGGGCAGG + Intergenic
1151460893 17:74253382-74253404 ACAGCCACAGGGTGCCTGGAGGG + Intronic
1151688656 17:75666001-75666023 ACAGCAACAGTGAGGGTGGTAGG - Intronic
1152762488 17:82116341-82116363 CCACCCACAGGGTGCATGGCAGG + Intronic
1152914573 17:83026850-83026872 ACAGACACACAGAGCGGGGCAGG + Intronic
1152914592 17:83026946-83026968 ACAGACACACAGAGCGGGGCAGG + Intronic
1152914602 17:83026994-83027016 ACAGACACACAGAGCGGGGCAGG + Intronic
1152914638 17:83027138-83027160 ACAGACACACGGAGGGGGGCAGG + Intronic
1153960268 18:10134402-10134424 AGAGCCACTGGGAGGCTGGCAGG - Intergenic
1155676349 18:28434002-28434024 ACAGCCACAGGGAGCCTAAGTGG - Intergenic
1157485020 18:48080699-48080721 CCAGCCACTGTGAGCTTGGCTGG + Intronic
1157584668 18:48793403-48793425 AAAGCCACAGGGAGCAAAGCTGG - Intronic
1157729243 18:49989472-49989494 ACAGGGACAGGAAGCATGGCAGG + Intronic
1160006649 18:75073375-75073397 CCAGCAGCATGGAGCGTGGCAGG + Intergenic
1160091913 18:75834940-75834962 ACAGCCATGGAGAGCTTGGCTGG - Intergenic
1160399430 18:78599229-78599251 ACAGCCACAGGGGTCATGCCAGG + Intergenic
1161206729 19:3045330-3045352 TCAGCCACAGGGAAGGTGCCAGG + Intronic
1161232201 19:3179973-3179995 GCAGCCACCGGGTGCGTGCCAGG + Exonic
1161286288 19:3470017-3470039 ACAGCCTCCAGGAGCGTTGCTGG - Intergenic
1161482392 19:4517542-4517564 ACAGGCTCAGGGTGAGTGGCTGG - Exonic
1161646561 19:5456655-5456677 CCAGCCTCCGGGAGCGTAGCTGG - Exonic
1161967651 19:7557160-7557182 ACCGCCACAGGGAGCCTGCGCGG - Exonic
1162187972 19:8922058-8922080 GCAGCCACAGAGGGCCTGGCCGG - Intronic
1162818136 19:13208237-13208259 ACAGCCACAGGGAGGAGGGAGGG + Intronic
1165412371 19:35670095-35670117 AGAGGCACTGGGAGCGAGGCAGG + Intronic
1166733041 19:45069329-45069351 CCACCCACAGGGAGCTGGGCAGG - Intronic
1166887856 19:45972839-45972861 ACATCCCCAGGGAGGGAGGCTGG + Intronic
1167322726 19:48806482-48806504 ACAGGGACAGGGAGAGAGGCCGG + Intronic
1167501434 19:49850971-49850993 ACAACTTCAGGGGGCGTGGCGGG - Intronic
1167748821 19:51368008-51368030 ACAGTCACCGCCAGCGTGGCTGG + Exonic
1168311063 19:55461123-55461145 AAGGCCAAAGGGGGCGTGGCTGG + Intronic
1168604452 19:57747264-57747286 ACAGGCACAGGGAGCGGTGCAGG + Intronic
1168628126 19:57934967-57934989 ACAGGCACAGGGACCGGCGCGGG - Intronic
1202687658 1_KI270712v1_random:60720-60742 AGAGCCACAGGGACCGTGTTGGG + Intergenic
925371622 2:3349572-3349594 ACAGGGACAGGGAGCATGCCAGG + Intronic
927083653 2:19654079-19654101 ACAGGCTGAGGCAGCGTGGCTGG + Intergenic
927277789 2:21276290-21276312 ACAGGCAGATGGGGCGTGGCTGG + Intergenic
927924974 2:27005707-27005729 ACATCCAAAGGGAGAGTGGCAGG + Intronic
931661117 2:64564300-64564322 ACAGACACAGGGGGCTTGCCAGG - Intronic
932575600 2:72960819-72960841 ACTGGGACTGGGAGCGTGGCTGG - Intronic
933958696 2:87394865-87394887 AGAGCCACAGGGACCGTGTTGGG - Intergenic
934054411 2:88240063-88240085 ACAGCCACTTGGAGAGTTGCAGG - Intergenic
934242826 2:90286871-90286893 AGAGCCACAGGGACCGTGTTGGG - Intergenic
934270350 2:91529812-91529834 AGAGCCACAGGGACCGTGTTGGG + Intergenic
934901604 2:98164086-98164108 ACAGACACAGACAGCGTGGATGG - Intronic
936439941 2:112542581-112542603 ACAGCAAAAGGCAGCGTTGCAGG + Exonic
936467998 2:112770953-112770975 ACAGCCACAGGGACACCGGCAGG - Intergenic
938105352 2:128526308-128526330 AGAACCAGAGGGAGGGTGGCAGG - Intergenic
940023468 2:149180679-149180701 CCGGCCACAGGCAGCGAGGCTGG - Intronic
942346314 2:175005736-175005758 CCAGCCACAGTGAGCCTGGAGGG - Intergenic
942385774 2:175441247-175441269 ACAGCCACAAGGAGGGTGCTTGG - Intergenic
944256566 2:197628430-197628452 AAAGCCACACAGAGCCTGGCTGG + Intronic
946362491 2:219227882-219227904 ACAGCCATAGGGAGAGTTGATGG - Intronic
946425458 2:219593106-219593128 ACAGCCCCAGGATGAGTGGCCGG - Intergenic
947573944 2:231257615-231257637 CCAGTCACAGGGAGGGTAGCAGG - Intronic
948704565 2:239780821-239780843 ACAGTCACAGGGACCCTGCCAGG - Intronic
1168749652 20:273420-273442 AGAGTGACAGGGAGAGTGGCGGG - Intronic
1169529180 20:6465814-6465836 AAAGCCCCAAGGAGAGTGGCAGG - Intergenic
1170666953 20:18394643-18394665 ACAGCCACATGCAGGGAGGCTGG - Intronic
1170760026 20:19240927-19240949 ACAGCAGCAGGGTGCATGGCCGG + Intronic
1173621822 20:44442738-44442760 AGAGCCACAGGGGGAGGGGCTGG - Intergenic
1173749712 20:45467920-45467942 ACAGACTGAGGGAGAGTGGCAGG - Intergenic
1173911421 20:46673760-46673782 CCAGGCACTGGGAGTGTGGCAGG - Intronic
1174139046 20:48400156-48400178 ACAGGCCGAGGGAGCCTGGCAGG + Intergenic
1175015384 20:55784564-55784586 ACAGACAGAGAGAGAGTGGCTGG - Intergenic
1175920884 20:62450214-62450236 GGAGCCCCAGGCAGCGTGGCCGG - Intergenic
1176099731 20:63359440-63359462 ACAGCCACGGGGAGTGTTGATGG + Intronic
1177118173 21:17110195-17110217 TCAGCCACAGCTAGAGTGGCTGG + Intergenic
1178347972 21:31848483-31848505 ACAGCCAAGGCAAGCGTGGCAGG - Intergenic
1178441294 21:32600575-32600597 ACTGCCACAGGCAGTCTGGCAGG + Intronic
1179434670 21:41351996-41352018 ACACACACAGGGAGCAAGGCAGG - Intronic
1179788286 21:43741573-43741595 GCAGCCTCAGGGAGAGTGGGCGG + Intronic
1179876182 21:44269349-44269371 AAAGCTACAGCCAGCGTGGCAGG - Intergenic
1180314199 22:11264001-11264023 ACAGACACAGTGAGAGAGGCAGG + Intergenic
1180639980 22:17290673-17290695 ACAGCAACAGTGAGGGTGGAGGG - Intergenic
1181350250 22:22250138-22250160 AGAGCCACAGGGACCGTGTTGGG + Intergenic
1181494256 22:23279162-23279184 ACAGCCACAGTCAGGGTGGCTGG - Intronic
1182468158 22:30530972-30530994 ACATCCACAGGGACATTGGCAGG + Intronic
1183406584 22:37633263-37633285 ACAGCCTCAGGGGGCCAGGCTGG + Exonic
1183494325 22:38133810-38133832 GCACACACAGGGAGCCTGGCTGG - Intronic
1183498881 22:38166257-38166279 CCAGCCAAAGGGAGGGTGGAAGG - Intronic
1183953824 22:41367658-41367680 GCAGCCACAGGCACAGTGGCAGG + Intronic
1184363068 22:44030399-44030421 TCAGCCACTGGGAGCCTGCCTGG - Intronic
1184754606 22:46508819-46508841 ACAGACACAGGGAACGTCTCAGG - Intronic
1184791211 22:46701273-46701295 ACTGCCACAGGCAGTATGGCGGG + Intronic
1184812257 22:46844082-46844104 ACACCCACAGGAAGGCTGGCTGG - Intronic
1184934194 22:47707056-47707078 ACAGACACAGGCAGGCTGGCAGG - Intergenic
1185158131 22:49206508-49206530 GCAGGCAGAGGGAGGGTGGCTGG - Intergenic
950951369 3:17003654-17003676 GCTGCCACAGGGAGCAGGGCAGG - Intronic
952744509 3:36764451-36764473 ACAGCCACCGGGAACGTCTCCGG + Intergenic
952979932 3:38726563-38726585 ACAGCCACAGGCAGTGGGGAGGG - Intronic
953850622 3:46463463-46463485 ACACCCACGGGGAGCAGGGCAGG + Intronic
954107181 3:48415682-48415704 ACAGCCACAGGGAGCGTGGCAGG + Exonic
954335144 3:49911905-49911927 ACAGCCACAAGGAGGGTACCAGG - Exonic
960417272 3:117399781-117399803 ACAGACATAGGCTGCGTGGCTGG + Intergenic
961506297 3:127372445-127372467 GCAGCCACACGGAGGGTGGAGGG + Intergenic
961616168 3:128182864-128182886 CCAGCCACAGAGATCGGGGCGGG + Intronic
965413489 3:168362840-168362862 TCACCCACAGGGAGAGTGACAGG + Intergenic
966282147 3:178244361-178244383 ACAGGCACAGGGCCGGTGGCAGG - Intergenic
966423982 3:179761322-179761344 ACATCCACAGGGACCTTGGAAGG - Intronic
966892309 3:184416423-184416445 GCAGCTGCAGGGAGGGTGGCAGG + Intronic
967462314 3:189760979-189761001 TCAGCCACAGGTAGAATGGCTGG + Intronic
967842689 3:194019531-194019553 ACAGGCAACGTGAGCGTGGCAGG - Intergenic
968603965 4:1522819-1522841 ACAGCCACAGGCAGAGGGGGAGG - Intergenic
968809756 4:2794529-2794551 CCAGGCAAAGGGAGCCTGGCGGG - Intronic
969048668 4:4356938-4356960 AAAGGCGCAGGGAGCGTGGGAGG - Intronic
969858700 4:10019531-10019553 AGAGGGGCAGGGAGCGTGGCTGG + Intronic
971307778 4:25498576-25498598 TCAGCCATAGGGAGCGAGGCTGG + Intergenic
971506323 4:27370009-27370031 ACATCCACAGGTAGGGTGGCTGG + Intergenic
973087098 4:46078473-46078495 ACAGAGAAAGGGAGGGTGGCAGG + Intronic
975116644 4:70688006-70688028 ACAGCCTCAGGCAGCGCCGCTGG - Intergenic
975646160 4:76548182-76548204 AGCGGCACAGGGAGCATGGCAGG - Intronic
976194930 4:82523215-82523237 ACAGCCAGAGGGATGGGGGCGGG + Intronic
980881222 4:138711855-138711877 AAAGACAAAGGGAGCATGGCTGG - Intergenic
985841840 5:2312194-2312216 GAAGCCACAGGCAGTGTGGCTGG + Intergenic
985967699 5:3350227-3350249 AAAGCCATAGAGAGCCTGGCAGG - Intergenic
986096200 5:4556081-4556103 TGTGCCACGGGGAGCGTGGCCGG - Intergenic
989535297 5:42556743-42556765 ACATCCACAGGGATAGTTGCGGG + Intronic
990335325 5:54766937-54766959 CCAGCCACTGGGAGCGCTGCAGG + Intergenic
990622716 5:57578110-57578132 AAAGCCACAGGGAGAGTTACTGG + Intergenic
994276346 5:97842933-97842955 TCAGCAACAGGGAGAGTGACTGG - Intergenic
998165341 5:139839472-139839494 ACAGCACCAGGGGGCCTGGCTGG + Intronic
998526771 5:142849817-142849839 ACAGAAACAGGGAGCATGGGAGG - Intronic
998949894 5:147382857-147382879 TCAGCCTGAGGGAGAGTGGCTGG + Intronic
999169503 5:149581502-149581524 ACAGCCACCCGGAGCGGCGCGGG + Exonic
999208522 5:149867914-149867936 ACAGCAAAAGTGAGGGTGGCAGG - Intronic
1000157238 5:158563856-158563878 CCAGCCACAGGGAGCGTGAGGGG - Intergenic
1000896524 5:166861758-166861780 TCAGCCACAGGGTGCATGGCAGG + Intergenic
1001477899 5:172064126-172064148 ACAGCTACAGGAAGCCTCGCTGG + Intronic
1002042757 5:176526686-176526708 GCAGCCAAAGGCAGCGTGGGCGG + Exonic
1003052591 6:2793343-2793365 ACAGCTACAGGTAGAGAGGCAGG - Intergenic
1005565318 6:27086943-27086965 ACAGACTCAGGGAGGGTGGTGGG - Intergenic
1005915231 6:30345404-30345426 ACAGCCACGGGGCGGGCGGCGGG + Intronic
1006271330 6:32969187-32969209 ACAGCCAATGGGAGCGTGGAGGG + Intronic
1006360200 6:33583418-33583440 AGAGCCCCAGGAAGCTTGGCAGG - Intergenic
1006379788 6:33690849-33690871 GCAGCCCCAGTGAGAGTGGCCGG + Intronic
1012224128 6:96685867-96685889 TCAGCCACAGCTAGAGTGGCTGG - Intergenic
1014714544 6:124849026-124849048 TCAGCCACAGCTAGAGTGGCTGG - Intergenic
1017607283 6:156147770-156147792 CCAGCCCCAGGGAGAGTAGCGGG + Intergenic
1018834990 6:167476256-167476278 ACAGGAGCAGGGAGCGGGGCAGG - Intergenic
1020086028 7:5311263-5311285 ACAGCCACAGGCAGGCTGGAAGG + Intronic
1020132905 7:5569708-5569730 GAAGACACAGGGAGGGTGGCAGG + Intergenic
1021824123 7:24530984-24531006 ACAGTAACAGGGAGTGTGGGGGG + Intergenic
1021905453 7:25328723-25328745 ACAGACACAGGGAGAATGCCAGG + Intergenic
1022163569 7:27736043-27736065 ACAGCCACAGGGAGGGAAGACGG + Intergenic
1024586839 7:50849525-50849547 ACATGCACAGGGAGCAGGGCTGG - Intergenic
1025663674 7:63571069-63571091 ACAGCCACAGGTAGGCTGGAAGG + Intergenic
1026112510 7:67469663-67469685 ATAGCCCCAGGAAGGGTGGCTGG - Intergenic
1028405522 7:90469743-90469765 CCAGCCACTGGGAACCTGGCAGG - Intronic
1029107363 7:98189316-98189338 ACAGCCACAGCGAGAGCGGAAGG - Intronic
1029530122 7:101119911-101119933 TCAGCCAATGGGAGCGTGTCAGG + Intergenic
1032109960 7:129067664-129067686 ACAGCCACAAGGAGCCTTGCTGG + Intergenic
1032182467 7:129692093-129692115 CCTGCCACCGGGAGGGTGGCAGG - Intronic
1032226760 7:130038253-130038275 ACAGCCACAGGCTGCCTGTCTGG - Intronic
1033307800 7:140237992-140238014 AGAGCAGCAGGGAGCCTGGCTGG + Intergenic
1033989561 7:147266428-147266450 TCAGCCTCAGGGATCTTGGCAGG + Intronic
1034417950 7:150975043-150975065 CCCGCCACAGGAAGCATGGCTGG + Intronic
1034489785 7:151387079-151387101 GCAAGCACAGGGAGCCTGGCTGG - Intronic
1035790013 8:2296029-2296051 ACAGCCACAGCCAGCCTGGATGG + Intergenic
1035802792 8:2425676-2425698 ACAGCCACAGCCAGCCTGGATGG - Intergenic
1037666903 8:20977607-20977629 ACAGCAACAGAGAGCTTGGCTGG - Intergenic
1038422410 8:27441843-27441865 AGAGCCACAGGGAGCTGTGCAGG + Intronic
1041240417 8:55844613-55844635 ACAGCCACCCTGACCGTGGCCGG - Intergenic
1044296484 8:90533660-90533682 ACAGCCACAGGGTCCCAGGCTGG + Intergenic
1045506268 8:102780960-102780982 ACAGCCTCAGGGAGGGTGGGAGG + Intergenic
1046004144 8:108458605-108458627 TCGGCCACAGGGGGAGTGGCTGG + Intronic
1046616915 8:116487980-116488002 TCAGCCACAGCTAGCTTGGCTGG - Intergenic
1047385829 8:124408290-124408312 AGAGCAAAAGGGAGCATGGCAGG - Intergenic
1049085786 8:140477567-140477589 TCAGCCACAGCCAGAGTGGCTGG + Intergenic
1049183452 8:141235551-141235573 AAAGCCACAGGGAGCCAGGCTGG + Intronic
1053173441 9:35906619-35906641 GCAGCCTCAGCGAGCGTGGCGGG - Exonic
1054721476 9:68608563-68608585 ACAGACACAGAGAGAGAGGCTGG + Intergenic
1056626298 9:88256407-88256429 ACAGCCTCAGGCATGGTGGCGGG + Intergenic
1056848339 9:90059379-90059401 GCTGACACAGGGAGCGTGGAGGG + Intergenic
1060021705 9:120137124-120137146 ACAGCAACAGGGAGGGAGGGAGG + Intergenic
1060593557 9:124834568-124834590 ACAGCGACAGGGAACCAGGCAGG + Intergenic
1060997348 9:127882718-127882740 ATTGCCCCAGGGAGCCTGGCTGG + Intergenic
1061715920 9:132518819-132518841 ACAGCCACCTGCAGTGTGGCCGG - Intronic
1062095427 9:134700797-134700819 ACAGCCATCGGGAGAATGGCAGG - Intronic
1062137413 9:134936982-134937004 CCAGCCTCATGGAGGGTGGCAGG + Intergenic
1062383724 9:136299866-136299888 CCAGCCACAGGGAGTGGGTCTGG - Intronic
1062533241 9:137010798-137010820 ACAGCCAGAGGATGCGAGGCTGG - Intronic
1185510807 X:663914-663936 ACCGCCATCGGGAGCCTGGCTGG - Intergenic
1187396991 X:18927422-18927444 ACGGCCACAGGGAGAGAGGTTGG + Intronic
1187796217 X:23006760-23006782 TCAGCCACAGGTGGCATGGCTGG + Intergenic
1188753845 X:33936236-33936258 TCAGCCACAGGTGGAGTGGCTGG + Intergenic
1189276643 X:39791119-39791141 ACAACCACAGAGAGCTTGACAGG + Intergenic
1190324450 X:49198452-49198474 ACAGACGCAGGGAGAGAGGCAGG - Intronic
1191110878 X:56802514-56802536 GCAGTCACAGGGCGTGTGGCAGG - Intergenic
1195297334 X:103491909-103491931 ACAGCCACAGGAACTGTGCCCGG - Intergenic
1195343533 X:103926814-103926836 ACAGGGACAGGAAGCCTGGCAGG - Intronic
1197403925 X:126027513-126027535 ACTGCCACAGTCAGCGTGTCGGG + Intergenic
1200085624 X:153603230-153603252 ACAGCCACAGCAAGGGTGGCCGG + Intergenic
1200184524 X:154173558-154173580 ACAGTCACAGGGAGCCTGGCTGG + Intergenic
1200190176 X:154210696-154210718 ACAGTCACAGGGAGCCTGGCTGG + Intergenic
1200195929 X:154248498-154248520 ACAGTCACAGGGAGCCTGGCTGG + Intergenic
1200201583 X:154285616-154285638 ACAGTCACAGGGAGCCTGGCTGG + Intronic
1200243907 X:154512692-154512714 ACAGCCAAAGGTAGCCTGCCAGG + Intronic